ID: 1097178921

View in Genome Browser
Species Human (GRCh38)
Location 12:57159841-57159863
Sequence GGGTGTGGCCGTGGACTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 260}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097178909_1097178921 9 Left 1097178909 12:57159809-57159831 CCTCTTCCCCCAACAGGCATCCA 0: 1
1: 0
2: 3
3: 46
4: 423
Right 1097178921 12:57159841-57159863 GGGTGTGGCCGTGGACTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 260
1097178912_1097178921 1 Left 1097178912 12:57159817-57159839 CCCAACAGGCATCCACAATGTGG 0: 1
1: 0
2: 2
3: 12
4: 88
Right 1097178921 12:57159841-57159863 GGGTGTGGCCGTGGACTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 260
1097178910_1097178921 3 Left 1097178910 12:57159815-57159837 CCCCCAACAGGCATCCACAATGT 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1097178921 12:57159841-57159863 GGGTGTGGCCGTGGACTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 260
1097178914_1097178921 0 Left 1097178914 12:57159818-57159840 CCAACAGGCATCCACAATGTGGA 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1097178921 12:57159841-57159863 GGGTGTGGCCGTGGACTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 260
1097178911_1097178921 2 Left 1097178911 12:57159816-57159838 CCCCAACAGGCATCCACAATGTG 0: 1
1: 0
2: 1
3: 14
4: 102
Right 1097178921 12:57159841-57159863 GGGTGTGGCCGTGGACTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 260
1097178908_1097178921 10 Left 1097178908 12:57159808-57159830 CCCTCTTCCCCCAACAGGCATCC 0: 1
1: 1
2: 0
3: 33
4: 355
Right 1097178921 12:57159841-57159863 GGGTGTGGCCGTGGACTGGATGG 0: 1
1: 0
2: 1
3: 13
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097178921 Original CRISPR GGGTGTGGCCGTGGACTGGA TGG Exonic
900344735 1:2205259-2205281 GGGTGTGGGCGCTGCCTGGAAGG - Intronic
901764298 1:11490125-11490147 GGGGGTGGGGGTGGTCTGGACGG + Intronic
901814200 1:11784745-11784767 GGATGTGGCCCAGGACTAGATGG - Intronic
901850849 1:12014285-12014307 ACGTGTGACCGTGGACTCGAGGG - Intergenic
903999572 1:27331183-27331205 GGGTGTGGCCATGGAGAAGAGGG + Intronic
906382503 1:45341596-45341618 AGGTGTGGCTGTGGGGTGGAGGG + Intronic
907989348 1:59564472-59564494 GGGTGTGGCCTGGGCCTGGGGGG + Intronic
909443559 1:75724305-75724327 GGGCGTGGCTGGGGCCTGGAGGG - Intergenic
915164926 1:153943024-153943046 GGGGGTGCCCGGGGCCTGGAGGG + Exonic
915339303 1:155167543-155167565 GGGAGTGGCGGGGGACGGGATGG - Intergenic
917797561 1:178542861-178542883 GGGGCTGGCCTCGGACTGGATGG + Intronic
918241382 1:182623347-182623369 GGCTGAGGTCCTGGACTGGAGGG + Intergenic
920384901 1:205564197-205564219 GAGTGTGGCGGTGGATTGGAAGG - Intergenic
922565184 1:226597017-226597039 GGGAGTGGCCAGGGACAGGAAGG + Intronic
922809923 1:228409628-228409650 GCGTGTGGCCGTGGGCTGACAGG - Intronic
924468077 1:244315856-244315878 GGGTGTGGCTCTGGATTGGCTGG + Intergenic
924587735 1:245374865-245374887 GGATGGGGCCGTGGTCTGAAGGG + Intronic
1063501224 10:6556513-6556535 GGGGGTGGCCTGGGACTGAAAGG + Intronic
1064099720 10:12453015-12453037 GGGGCTGGCCGTAGACTGGGAGG - Intronic
1064782110 10:18853395-18853417 GGGTGTGGTGGAGGACTTGAAGG + Intergenic
1066987990 10:42485055-42485077 GGGTGTGGAGGTTGTCTGGATGG + Intergenic
1067851349 10:49756707-49756729 GGGTGTGGCCAGGCACTGAAGGG - Intronic
1069118209 10:64534802-64534824 GAGTGTGGGCGTAGATTGGAAGG + Intergenic
1070826250 10:79392020-79392042 GGGTGGGCCTGTGGACTGGGTGG - Intronic
1070961488 10:80502983-80503005 GGGTGTGTCAGTGGAATGGTTGG + Intronic
1071191718 10:83108966-83108988 GGGGGTGGCCATGGGCTGGGGGG - Intergenic
1073139727 10:101239101-101239123 GGGTGTGGCAGGGGAGAGGAAGG - Intergenic
1073319443 10:102605663-102605685 GGGTGTGGCTGTGGGATCGAGGG - Intronic
1076751386 10:132545219-132545241 GGGTGTTTCCGTGGACTTGTTGG + Intronic
1077187705 11:1242888-1242910 GGGTGTGGCTGTGGACATGGTGG - Exonic
1077188128 11:1244559-1244581 GGGTGTGGCTGTGGACATGGTGG - Exonic
1077188664 11:1246659-1246681 GGGTGTGGCTGTGGACATGGTGG - Exonic
1077189083 11:1248330-1248352 GGGTGTGGCTGTGGACATGGTGG - Exonic
1077189646 11:1250514-1250536 GGGTGTGGCTGTGGACATGGTGG - Exonic
1077189831 11:1251285-1251307 GGGTGTGGCCGTGGAATTGGTGG - Exonic
1077234291 11:1472477-1472499 GGTTGTGGCCATGGTGTGGAGGG - Intronic
1081046332 11:38278577-38278599 GCGTGTGGCGGGGGACTGGCGGG - Intergenic
1081676164 11:44971001-44971023 GGGTGTTTTCTTGGACTGGAGGG - Intergenic
1081717006 11:45257560-45257582 GGGAGTGGACGTGGTCTGGCAGG + Intronic
1081771059 11:45650852-45650874 GCGGATGGCCGTGTACTGGATGG + Exonic
1083182915 11:60999495-60999517 GGGTGAGGACGGGGACTGAAGGG + Intronic
1083265008 11:61542546-61542568 GGTAGTGGCCGTGGACAGGGTGG + Intronic
1083306970 11:61766278-61766300 GGCTGTGGCCGTGACCTGGGAGG + Intronic
1083411903 11:62499657-62499679 GGGTGTGGCCGAGTGCTGGTGGG + Intronic
1083940432 11:65892545-65892567 GAGTGTGGCAGTGATCTGGAAGG + Exonic
1084327448 11:68409985-68410007 GGGCATGGCCGTTGACTGGATGG + Exonic
1084652923 11:70499591-70499613 GGGTTTGGCCTTGGATTGAAGGG + Intronic
1085332711 11:75667341-75667363 GGGTGTGGCCTGGGACTGGAGGG + Intronic
1089289364 11:117428516-117428538 GGGTGGGGCCGGGGGCTGGGGGG + Exonic
1089297820 11:117480575-117480597 GGGTGCGGCAGTGGAGGGGAGGG + Intronic
1090049191 11:123362469-123362491 GGGGGTGGCCATGGACTTCAGGG + Intergenic
1091305043 11:134531359-134531381 GGGTCTGGCGGGGGGCTGGAGGG + Intergenic
1091383779 12:79027-79049 AGGGGTGTCAGTGGACTGGAAGG - Intronic
1091393125 12:138154-138176 GGGTGGGGCCCAGGAATGGACGG - Intronic
1091969255 12:4772094-4772116 GGGTGAGGACGTGGAGAGGAGGG + Intronic
1094159327 12:27373162-27373184 GAGAGTGGCCCTGGACAGGAAGG + Intronic
1094470044 12:30795177-30795199 GGGGGTGGCAGTGGATGGGAGGG + Intergenic
1097178921 12:57159841-57159863 GGGTGTGGCCGTGGACTGGATGG + Exonic
1101859290 12:108469548-108469570 TGGTGGGGCAGTGGAGTGGATGG - Intergenic
1102990963 12:117315687-117315709 GGATGTGGCTGTGGATTGGGTGG + Intronic
1103340740 12:120219941-120219963 GAGTGTGGCCCTGGCCTCGAGGG + Intronic
1103738184 12:123073894-123073916 GTGGGTGGCCGTGGAGTGCAGGG + Intronic
1103826859 12:123745788-123745810 GGCTGAGGCAGTGGACTGCAGGG + Intronic
1104917386 12:132272891-132272913 GGGTGTGGCTGGGGATGGGAAGG - Intronic
1105772893 13:23629818-23629840 GGGTATGGCCGAGGACAGGCAGG - Intronic
1105928617 13:25032078-25032100 GGGTGTGGCTGTGGGAAGGATGG - Intergenic
1111098497 13:83547123-83547145 GGGGGTGGAAGTGGACTGGCTGG - Intergenic
1113574300 13:111383062-111383084 CGGGGAGGCCGTGGGCTGGAGGG + Intergenic
1114663747 14:24366972-24366994 GGGTGCGGCCCTGAACCGGAGGG + Exonic
1114961044 14:27890067-27890089 GTGTGTGGCCAAGGACTGTAAGG + Intergenic
1116406992 14:44578823-44578845 GGCTGAGACAGTGGACTGGAAGG + Intergenic
1119644322 14:76337548-76337570 GTGTGTGGGCGGGGGCTGGATGG + Intronic
1119781665 14:77280114-77280136 GGGTGTGGCCGAGGATGGGCTGG - Intronic
1121896176 14:97649981-97650003 GGTGGTGGCCCTGGGCTGGATGG + Intergenic
1122835612 14:104429412-104429434 GGTTGTGGCCGTGGGGAGGAAGG + Intergenic
1122874996 14:104659864-104659886 GGGAGAGGCCGTGGGCTGGCGGG - Intergenic
1123042762 14:105497102-105497124 GGGCCTGGCCGTGCACTGGTTGG + Intronic
1123061479 14:105596668-105596690 GTGTGTGGCCCTGGAGTGGCTGG - Intergenic
1123085932 14:105717579-105717601 GTGTGTGGCCCTGGAGTGGCTGG - Intergenic
1123129255 14:105972356-105972378 GGGGGTGGGCCTGGACAGGACGG + Intergenic
1125146531 15:36475861-36475883 GAGTGTGGCCGTGGCGAGGAGGG - Intergenic
1128088978 15:64906122-64906144 GGGTGTCCCAGTGGACTGGCCGG + Intronic
1128756262 15:70185887-70185909 AGGGGTGGCAGTGGCCTGGAAGG + Intergenic
1129359856 15:75017983-75018005 GGGTGTGGCCTGGGGCTGGCAGG + Intronic
1129937563 15:79463404-79463426 GGGTGTGGAAGTGGGCTGGCCGG - Intronic
1131783064 15:95881088-95881110 GAGTGTGTGCGTGGAGTGGAGGG + Intergenic
1132396606 15:101479514-101479536 GGCTGTGGCCATGGGCTGGGTGG + Intronic
1132592768 16:733577-733599 GGATGTGTCCCTGGACAGGACGG + Intronic
1132606308 16:795188-795210 GTGTGTGGCCCTCGACTGGCTGG + Exonic
1134131936 16:11655977-11655999 GGGTGTGGGCCAGGCCTGGAAGG - Intergenic
1135025913 16:18998877-18998899 GGGTGGGGCCGGTGACTGGCTGG - Intronic
1137685856 16:50386363-50386385 GGGTGGGGCCCTGGGCAGGATGG + Intergenic
1138174752 16:54886589-54886611 TGGAGTGGACCTGGACTGGAGGG + Intergenic
1138736816 16:59260405-59260427 GTGTGTGTCAGTGGACTGGGTGG + Intergenic
1139390451 16:66604270-66604292 GGGGCTGGCCGGGGACAGGAGGG + Exonic
1140067950 16:71626298-71626320 GGGTGCGGCCTTGGTCTGGGTGG - Exonic
1140808301 16:78553487-78553509 GGGTGTGGCTGTGAATTGGTTGG + Intronic
1141562417 16:84878346-84878368 GGGTGTGGCCGGGAGCTGGAGGG - Intronic
1141998395 16:87649051-87649073 GGGTGTGGCAGTGGAGACGAGGG + Intronic
1142203941 16:88773842-88773864 CGGTGGGGCCCTGCACTGGAGGG - Intronic
1142311591 16:89317346-89317368 GGGTGTGGCTGTGTTCTGGGTGG + Intronic
1142984814 17:3689399-3689421 GGGTGTGGACGGGGACTCGTGGG - Intronic
1143118969 17:4595678-4595700 GGGCATGACCGGGGACTGGATGG + Intronic
1143509378 17:7387095-7387117 GGGTGCCTCTGTGGACTGGACGG - Exonic
1143553522 17:7646376-7646398 GAGGCTGGCCTTGGACTGGAGGG - Intergenic
1144280202 17:13718967-13718989 GGGCGTTGCCATTGACTGGATGG + Intergenic
1146789240 17:35742235-35742257 GGGTCTGGTCGTGGGCAGGATGG + Exonic
1147334029 17:39716202-39716224 GGGCATGGCTGTGGGCTGGAGGG - Intronic
1147386223 17:40083966-40083988 GGGCATGGCCATGGACTGTAAGG + Exonic
1147953655 17:44120813-44120835 GGCTGTGGCCATGGTCAGGAGGG - Intronic
1148337123 17:46849450-46849472 GGGTGTGGCTGGGGCCTGGTGGG + Intronic
1150556880 17:66262641-66262663 GGGTGTGGAGGTGGATTGGGAGG - Intergenic
1151540247 17:74761187-74761209 CAGTGTGGCTGTGGCCTGGAGGG - Intronic
1152045032 17:77930029-77930051 GGGTCTGGCTGAGGACTGCAAGG - Intergenic
1152569463 17:81115350-81115372 GGGTGTGGGCCTGGCCTGGTGGG + Intronic
1155198893 18:23500673-23500695 GGGTTTGGCCTTGGGCAGGATGG + Intergenic
1157483766 18:48072936-48072958 GAGTGGGGCTGTGGCCTGGAGGG - Intronic
1158558808 18:58496850-58496872 GGGTGTGGCTCTGGATTGGTTGG - Intronic
1160065904 18:75574116-75574138 GGGTGTGTGCGTGGAGGGGACGG + Intergenic
1160588002 18:79923232-79923254 GGGGGGGGCCGTGGACGGGTGGG + Intronic
1160679599 19:406694-406716 GGGCGGGGCCGTGGACAGGGAGG - Exonic
1160784234 19:892326-892348 GGGTGAGGCCGTGGGCTCAAGGG - Intronic
1160805754 19:991617-991639 GGCTGGGGGCGTGGACTGGCTGG + Intronic
1160814978 19:1030973-1030995 GGGTGGGGCCGGGGACTCCAGGG - Intronic
1160835627 19:1123244-1123266 GGGTGTGGCCGCGGCCTGCTGGG + Intronic
1160875865 19:1295941-1295963 GGGTGGGGCCGGGGAGTGGGCGG + Intronic
1160904985 19:1447751-1447773 GGGGGTGGCCAGGGCCTGGAGGG - Intronic
1161015563 19:1981121-1981143 GGGGGCGGCCCTGGACTGGCGGG + Exonic
1161070241 19:2256285-2256307 GGGTGTTGCAGAGGACTGTAAGG - Intronic
1162402079 19:10452778-10452800 GGGTGTGTCCATGGAGGGGATGG + Intronic
1163724111 19:18912915-18912937 GGGTGGGGCTGGGGACAGGAAGG - Intronic
1165167947 19:33870527-33870549 GTGGGTGGCAGTGGAGTGGAGGG + Intergenic
1166194417 19:41196584-41196606 GGCTCTGGCCGAGGAATGGATGG + Intronic
1167284682 19:48592479-48592501 GTGTGTGGAGGCGGACTGGATGG + Intronic
1167410288 19:49340144-49340166 GGGTGGGGCCGTGAATTGGGCGG - Intronic
1167432521 19:49462648-49462670 CGGAGTGGCCGAGGGCTGGATGG + Exonic
925173737 2:1768057-1768079 GTGAGTGGCCGTGGATTGGATGG - Intergenic
925364232 2:3300514-3300536 GGATGTGGCCGTGGACATGCAGG - Intronic
925994301 2:9279316-9279338 GGCTTTGGACGTGGACCGGATGG + Exonic
926784499 2:16507105-16507127 GGCTGTGGGAGTGGGCTGGAGGG + Intergenic
927186908 2:20488489-20488511 GGGTGCTGCCTTGGGCTGGAAGG - Intergenic
928107565 2:28481057-28481079 GGTGGTGGCCAGGGACTGGAGGG - Intronic
935618115 2:105106449-105106471 GGGTGTGGCTCTGGATTGGCTGG - Intergenic
936375929 2:111941625-111941647 GGGTGGGGCTGGAGACTGGAGGG - Intronic
936759089 2:115752201-115752223 TGGTATGGCTGTAGACTGGATGG + Intronic
937263641 2:120602093-120602115 GGGTGTGGCTGGGGTGTGGAGGG - Intergenic
937982501 2:127623774-127623796 GGGTGTGGGCGTGGAATTGGGGG - Intronic
938331232 2:130449929-130449951 GGGTGCGCCTGTGGTCTGGAGGG - Intergenic
938358720 2:130671574-130671596 GGGTGCGCCTGTGGTCTGGATGG + Intergenic
938692736 2:133807389-133807411 GGTTGGGGCAGTGGACTGAAAGG + Intergenic
946249286 2:218402966-218402988 GGGGGTGGCCGAGGGCTGGCAGG - Intronic
946427146 2:219605404-219605426 GGGTGTGGCCTTGAACTGTTAGG + Intronic
946692299 2:222319099-222319121 GGGTGCGGCCGCGGGCTCGACGG - Intergenic
948296214 2:236862602-236862624 GGCTGTGGCTGTGGGCTGCAGGG + Intergenic
948810366 2:240472216-240472238 GCGTGCGGCCGTGGATTGGTAGG - Intergenic
948933484 2:241147981-241148003 GGCTGTGGCTGTGGAGTGCACGG - Intronic
1169207909 20:3750270-3750292 GGGAATGACCGTGCACTGGAGGG + Intronic
1169997307 20:11572526-11572548 GGGTGTGGCGGGGGAGGGGAGGG + Intergenic
1170099146 20:12679296-12679318 GGGTGTGGCTGTGGAGAGAAGGG + Intergenic
1172033735 20:31997902-31997924 GGAGGTGGCCGTGGAAGGGATGG + Exonic
1172426032 20:34856741-34856763 CGATGTGGCCATGGACTGGGAGG + Intronic
1173251284 20:41365446-41365468 GGGTGTGGCAGGGCACTTGAGGG - Intronic
1173448189 20:43138751-43138773 GGCTGTGGCAGGGGACTGGTGGG - Intronic
1173602216 20:44303950-44303972 GGGAGTGGCCATGGAGTAGATGG - Exonic
1174112874 20:48208284-48208306 GGGGGTGGCAGTGAACTGGCAGG - Intergenic
1174280399 20:49434916-49434938 GGGTGTGGCAGTGGCCGGGGAGG + Intronic
1174560416 20:51427097-51427119 GGGTGTGGCCTGGGACTCAAAGG - Intronic
1175612834 20:60365552-60365574 GGGTTTGGAAGGGGACTGGAAGG + Intergenic
1176254748 20:64146110-64146132 GAGTGTGTCAGTGGACTGGCAGG + Intergenic
1178488011 21:33030977-33030999 GAGGGTGGCCCTGGACTGGTGGG + Intergenic
1179176333 21:39010725-39010747 GTGTGTGGTCGTGGCCTGGGAGG - Intergenic
1179585382 21:42371022-42371044 GGGTGTGGGTGGTGACTGGAGGG - Intergenic
1179713850 21:43277744-43277766 GGCTGTGACAGTGGGCTGGATGG - Intergenic
1179881216 21:44294075-44294097 GAGTGTGGCTGTGGAGTGTAGGG - Intronic
1179939617 21:44629105-44629127 GGGTGTGGGTGAGGACTGGAGGG - Intronic
1180028733 21:45186058-45186080 ACGTGTGGAGGTGGACTGGAAGG - Intronic
1180921723 22:19524746-19524768 GGATGTGGGAGTGGACTGGGTGG - Intronic
1181000285 22:19984947-19984969 GGGTGGGGCTGTGGAATGGTGGG + Intronic
1181054894 22:20256256-20256278 CAGTGTGGCCTTGGACTTGAGGG - Intronic
1181057662 22:20267756-20267778 GGCGGGGGCCGTGGGCTGGAAGG - Intronic
1181977358 22:26740383-26740405 GGGAGAGGCGGTGGCCTGGAGGG + Intergenic
1183380899 22:37490050-37490072 GGGTGTGGCCTCCGACTGAAGGG - Intergenic
1183538643 22:38417279-38417301 AGGTGGGGCCGTGGAGAGGATGG - Intergenic
1183706721 22:39478926-39478948 GGCAGTGGCCATGGCCTGGAGGG - Intronic
1184877409 22:47284283-47284305 TGGTGAGGCTGTGGACTGGATGG + Intergenic
1185070166 22:48651770-48651792 GGCTGTGGACGTGGGGTGGAAGG - Intronic
1185299460 22:50072018-50072040 GGGTGTGGCCCTGGCCAGGGAGG + Intronic
950494146 3:13323828-13323850 GGGTGTGGCCAGGTACAGGATGG - Intronic
953550059 3:43894952-43894974 GGGTGTGGCTGGGGACTGGCTGG - Intergenic
953913429 3:46904162-46904184 GGGTGTGGCCAGGGACCCGAGGG - Intergenic
954753751 3:52827939-52827961 GTGTGTGGCAGTGGGCAGGAGGG + Intronic
956238868 3:67106778-67106800 GGCAGTGGCAGTGGAATGGAAGG - Intergenic
962405199 3:135094452-135094474 GGGCTGGGCCGTGGACAGGAGGG + Intronic
963721424 3:148866333-148866355 GGCAGTGGCAGTGGAATGGAGGG - Intronic
965932140 3:174057629-174057651 TGGTGTGGCCGTGGATGGAAGGG + Intronic
966146036 3:176813257-176813279 GGGTGTGGCTGTAGCCTGTAGGG - Intergenic
966439901 3:179933009-179933031 GGCTGTGGGTGTGGGCTGGAGGG - Intronic
967390093 3:188947110-188947132 GGGTGGGGGTGGGGACTGGAGGG + Intergenic
968460200 4:720966-720988 GGGAGTGGCCGAGGACAGCAAGG + Intronic
968481655 4:835690-835712 GCGTGCGGCCGTGGCCTGAAGGG - Intergenic
971370732 4:26016667-26016689 GGTTGTGGCCTGGCACTGGAGGG - Intergenic
972714677 4:41633621-41633643 TGGAGTGGCAGTGGACTGAAAGG + Intronic
974365749 4:60946859-60946881 GTTAGTGGCCGTGGACTGGGTGG - Intergenic
977229436 4:94434320-94434342 GGGTGGGGCCGAGGAAGGGATGG - Intergenic
978609997 4:110526827-110526849 AGGAGTGGCTGTGGGCTGGAGGG + Intronic
980063542 4:128156523-128156545 GAGTGTGGCAGTGATCTGGAAGG - Intronic
980531072 4:134055310-134055332 GGGTGAGGCCTTGGTCTGGTAGG + Intergenic
985574177 5:665911-665933 GGGTGGGGGCGGGGCCTGGAAGG - Intronic
985952516 5:3234497-3234519 GGGTGTGGCCCCGCACTGGCGGG + Intergenic
985966532 5:3342504-3342526 TGGTGTGGCCCAGGACAGGAGGG - Intergenic
987732131 5:21787330-21787352 GGGTCTTGCCTTGAACTGGATGG - Intronic
988725493 5:33922325-33922347 GGATGTGGTGATGGACTGGATGG - Intergenic
991303167 5:65148446-65148468 GGGTGTGGCCGTGGCCAGTCTGG + Intergenic
992965636 5:81997115-81997137 AGATGTGGCTGGGGACTGGAGGG - Intronic
993995822 5:94721449-94721471 GGGAGTGGCGGTGGACTGGGTGG - Intronic
995123109 5:108556088-108556110 GGGTGTGGTGATGGATTGGAGGG + Intergenic
995508512 5:112884765-112884787 GGGGGGGGCCAAGGACTGGAGGG - Intronic
997369710 5:133350745-133350767 GGGTGTGGCCCTGGGCTCCATGG + Intronic
997997191 5:138596416-138596438 GGGTTAGGCCGTGGGCTAGAGGG - Intergenic
998155932 5:139787297-139787319 GGGCGTGGGGGTGGAGTGGAGGG - Intergenic
999247579 5:150163463-150163485 GGATGTGTCCGTGGAGTGGGAGG + Intergenic
999381451 5:151124211-151124233 GGGTTTGGCCGTGGGCTGGCAGG - Intronic
1000948573 5:167452270-167452292 GAGTGTGGTCCTAGACTGGAAGG + Intronic
1001280065 5:170380443-170380465 GGGAGTGGCCGAGGCCTGCAAGG - Intronic
1006134733 6:31888578-31888600 AGGTGGGGCCGTGGGCTGGTGGG - Exonic
1006804883 6:36781657-36781679 GGATGTGGCCCAGGACTTGATGG + Intronic
1007077827 6:39079084-39079106 GGGTGGGGCCGGGGATTGGCAGG - Intronic
1013349251 6:109290747-109290769 GGGTCTGGCCGGGGTCTGGCCGG - Intergenic
1017203712 6:151782831-151782853 GGATGTGGCGGAGGAATGGAAGG - Intronic
1018040370 6:159916320-159916342 GGTGGTGGCCGGGGGCTGGAGGG + Exonic
1018922361 6:168184136-168184158 AGGTCTGGCCCTGGACTGGGGGG + Intergenic
1019348787 7:543436-543458 GGGACTGTCCGTGGTCTGGAGGG + Intergenic
1020004246 7:4773837-4773859 GGGAGTGGGCGTTGACTGGGAGG + Intronic
1020192333 7:6009584-6009606 GGGTGGGGCCGTGAACCGGTTGG - Intronic
1022795269 7:33727005-33727027 GGGTGTGCCTGTGGGCTGGCAGG + Intronic
1023826691 7:44014585-44014607 GGGTGAGGGCGGGGCCTGGAGGG - Intergenic
1025007975 7:55369627-55369649 TGTTGTGGCCGTGGACTTAAGGG + Intronic
1026144836 7:67737702-67737724 GGGTTTGGACGTGGCTTGGAAGG + Intergenic
1029737850 7:102474340-102474362 GGGTGAGGGCGGGGCCTGGAGGG - Exonic
1029754980 7:102567989-102568011 GGGTGAGGGCGGGGCCTGGAGGG - Exonic
1029772930 7:102667069-102667091 GGGTGAGGGCGGGGCCTGGAGGG - Exonic
1036234028 8:7022691-7022713 GGGTGTGGCCATGCGGTGGAGGG + Intergenic
1038194089 8:25350793-25350815 GGGTGGGGCCCTGGACTGACGGG - Intronic
1039922348 8:41902421-41902443 GGGTATGGCACTGGACTGGATGG - Intergenic
1040601795 8:48891967-48891989 GGATGTGGGTGGGGACTGGATGG - Intergenic
1042069687 8:64917544-64917566 GGGATTGCCTGTGGACTGGATGG - Intergenic
1045383457 8:101648863-101648885 GGGCCTGGCCGTGACCTGGAGGG - Intronic
1047221284 8:122920718-122920740 GGCTGCGGCTGTGAACTGGAGGG - Intronic
1048200995 8:132373879-132373901 GGGGGTTGCCGTGGCCTGCAGGG - Intronic
1048289723 8:133171539-133171561 GGCTGTGGCCTTTGGCTGGAAGG - Intergenic
1048315150 8:133356241-133356263 GGCTGTGGCTCTGGACTGGAAGG + Intergenic
1048581235 8:135731378-135731400 AGGTGTGGCTGGGGCCTGGATGG + Intergenic
1049064517 8:140302267-140302289 GGGTGTGCCCTTGGTCTGGAGGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049270180 8:141691423-141691445 GGGTGTGGTCCTGGTGTGGATGG - Intergenic
1049411476 8:142475703-142475725 GGGTGGGGCCCTGGAGAGGAGGG + Intronic
1049605604 8:143527932-143527954 TGGTGTGGGCGTGGCCTGGCGGG - Intronic
1049692303 8:143966819-143966841 GGGTCTGGCCGTGGGCTTGTGGG - Intronic
1049741605 8:144243619-144243641 GAGCGTGGCCGTGGCCTGGCAGG + Intronic
1049918950 9:345660-345682 AGGTGAGGCTGGGGACTGGAAGG - Intronic
1050480861 9:6085694-6085716 GGGTGTGGCCACGGACTAGTTGG - Intergenic
1056759974 9:89407549-89407571 CTTTGTGGCAGTGGACTGGAGGG - Intronic
1057296884 9:93851569-93851591 GTATGTGGGTGTGGACTGGAAGG + Intergenic
1057667441 9:97056806-97056828 GGGAGTGGGAGTGGACTGGGGGG + Intergenic
1059241565 9:112810631-112810653 GGGAGAGGCTGTGGAATGGAAGG + Intronic
1061045428 9:128162440-128162462 TGGAGTGGCCGTGGAGGGGAGGG + Intronic
1061050203 9:128190919-128190941 GGGAGTGGCGGTGGATGGGAGGG - Intronic
1062630583 9:137461418-137461440 GGGCGTGGACGTGGGCGGGAGGG + Intronic
1062731350 9:138111852-138111874 GGCTGCGGCTGTGGACAGGACGG - Intronic
1194113381 X:89866888-89866910 TGTTGTGGCCTTAGACTGGAAGG - Intergenic
1195657168 X:107343121-107343143 GGCTCTGGCCTTGGACTGGCAGG - Intergenic
1200213472 X:154357096-154357118 AGATGAGGCCGTGGGCTGGAGGG - Intronic
1200466066 Y:3521947-3521969 TGTTGTGGCCTTAGACTGGAAGG - Intergenic
1201309219 Y:12579973-12579995 GGGAGTGGCCCTGGTCGGGAAGG - Intergenic
1202143176 Y:21750553-21750575 AGGTGTGGCCTTGCAGTGGATGG - Intergenic