ID: 1097185127 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:57192659-57192681 |
| Sequence | CTGTGGGAGGGCCAGGTGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 6189 | |||
| Summary | {0: 1, 1: 0, 2: 6, 3: 291, 4: 5891} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1097185127_1097185134 | 4 | Left | 1097185127 | 12:57192659-57192681 | CCATGCACCTGGCCCTCCCACAG | 0: 1 1: 0 2: 6 3: 291 4: 5891 |
||
| Right | 1097185134 | 12:57192686-57192708 | CATCCCCATGCCCTCCCCACTGG | 0: 1 1: 0 2: 2 3: 55 4: 395 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1097185127 | Original CRISPR | CTGTGGGAGGGCCAGGTGCA TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||