ID: 1097185127

View in Genome Browser
Species Human (GRCh38)
Location 12:57192659-57192681
Sequence CTGTGGGAGGGCCAGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6189
Summary {0: 1, 1: 0, 2: 6, 3: 291, 4: 5891}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097185127_1097185134 4 Left 1097185127 12:57192659-57192681 CCATGCACCTGGCCCTCCCACAG 0: 1
1: 0
2: 6
3: 291
4: 5891
Right 1097185134 12:57192686-57192708 CATCCCCATGCCCTCCCCACTGG 0: 1
1: 0
2: 2
3: 55
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097185127 Original CRISPR CTGTGGGAGGGCCAGGTGCA TGG (reversed) Intronic
Too many off-targets to display for this crispr