ID: 1097185884

View in Genome Browser
Species Human (GRCh38)
Location 12:57196070-57196092
Sequence TGTGCTCTGCGGAGGGGCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097185884_1097185891 14 Left 1097185884 12:57196070-57196092 CCTCCGCCCCTCCGCAGAGCACA 0: 1
1: 0
2: 0
3: 28
4: 256
Right 1097185891 12:57196107-57196129 TCACAGTTCCTGTGCAGCAGTGG 0: 1
1: 1
2: 1
3: 15
4: 272
1097185884_1097185892 15 Left 1097185884 12:57196070-57196092 CCTCCGCCCCTCCGCAGAGCACA 0: 1
1: 0
2: 0
3: 28
4: 256
Right 1097185892 12:57196108-57196130 CACAGTTCCTGTGCAGCAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 185
1097185884_1097185894 25 Left 1097185884 12:57196070-57196092 CCTCCGCCCCTCCGCAGAGCACA 0: 1
1: 0
2: 0
3: 28
4: 256
Right 1097185894 12:57196118-57196140 GTGCAGCAGTGGGCGCTGTGTGG 0: 1
1: 0
2: 3
3: 24
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097185884 Original CRISPR TGTGCTCTGCGGAGGGGCGG AGG (reversed) Exonic
900089800 1:915075-915097 GGTGCTCTGCCCAGGGGCTGAGG - Intergenic
900239405 1:1607763-1607785 TGTGCTTTGCAGAGGTGCCGGGG - Intergenic
900609449 1:3538329-3538351 TGTGCTCTGAGGCCGGGTGGGGG - Intronic
900624456 1:3601847-3601869 TGGGATCTGCGGAGGAGCCGAGG - Intronic
901861907 1:12079737-12079759 CTTGCTGTGCGGAGGGGCTGTGG - Intronic
902214119 1:14924035-14924057 TGGGCGCCGCGGCGGGGCGGGGG + Intronic
902444833 1:16455905-16455927 CATGTTCTGCGGAGGGGCTGGGG + Intronic
902458170 1:16551159-16551181 TGTGCTCTGAGCAGGGGCGCCGG - Intergenic
902475476 1:16682174-16682196 TGTGCTCTGAGCAGGGGCGCCGG - Intergenic
902493989 1:16856760-16856782 TGTGCTCTGAGCAGGGGCGCCGG + Intronic
903233805 1:21937127-21937149 TGTGCGGGGCAGAGGGGCGGGGG - Intronic
904562969 1:31411102-31411124 TGTGCTCTGGGTAGGAGAGGGGG + Intronic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906097487 1:43234220-43234242 TGCTCTCGGTGGAGGGGCGGGGG - Intronic
907341901 1:53740961-53740983 TGTGTTTTGCAGCGGGGCGGCGG - Intergenic
907682412 1:56577416-56577438 TGTGCTCTGTGGAAGGGTGGAGG - Intronic
911440490 1:97920733-97920755 GGAGCTCTGCGGGGGAGCGGAGG - Intronic
912489550 1:110054361-110054383 TGTGCTCTGGGGTGGGGGTGGGG + Exonic
913611969 1:120517282-120517304 TGTGCTCTGAGCAGGGACGCCGG - Intergenic
914579221 1:149004957-149004979 TGTGCTCTGAGCAGGGACGCCGG + Exonic
914899450 1:151704063-151704085 TGTTCTTTGGGGAGGGGCCGCGG - Intronic
919639133 1:200032242-200032264 TGTGCTCTGGGGAGGCCCTGGGG + Intronic
919686297 1:200486737-200486759 TGGGCTGTGGGGAGGGCCGGTGG - Intergenic
920307901 1:205030816-205030838 AGGGCTCTGAGGAGGGGCTGGGG - Intergenic
922968750 1:229716225-229716247 TGAGCTCTGCGGAGCTGTGGAGG + Intergenic
1064032400 10:11891248-11891270 TGTGCTGTGGGGAGGGTAGGTGG - Intergenic
1064995556 10:21294126-21294148 TGTGCTGGGGGGAGGGGGGGTGG - Intergenic
1067705761 10:48605331-48605353 TGGGCTCTGGGGTGGGGGGGGGG - Intronic
1067944984 10:50683606-50683628 TGTGCTCGCCGGTGGGGCCGGGG - Intergenic
1069001031 10:63265266-63265288 TGTGCTTGGTGCAGGGGCGGGGG - Intronic
1069058400 10:63868184-63868206 TCTGCTCTGGGGAGGCACGGAGG - Intergenic
1070457567 10:76632538-76632560 TGTGGTCTGGGTAGGGGTGGGGG - Intergenic
1071979550 10:90989569-90989591 GTTGCTCTGCAGAGGGGAGGAGG - Intergenic
1072266017 10:93728676-93728698 AGTGTTCTGCAGAGTGGCGGTGG + Intergenic
1072661646 10:97367015-97367037 TGTGCACTGAGCAGGGGCGGGGG - Intronic
1072921258 10:99579035-99579057 TGTGCTCTGGGCAGGAGCAGGGG + Intergenic
1073467526 10:103702972-103702994 TGTGCTCTGCAGTGGGGCCCTGG - Intronic
1076107493 10:127835009-127835031 TGTGCTCTGTGGCTGGGTGGTGG + Intergenic
1076220384 10:128729113-128729135 TCTGCTCTGCGGAGGAGCCCAGG + Intergenic
1076536531 10:131181343-131181365 TGTGCTCAGCACAGAGGCGGAGG + Intronic
1077107601 11:848783-848805 TGTGCCCTGTGGTGGGGCTGGGG + Intronic
1077222119 11:1422358-1422380 GGTGCTCTGGGGAGGGGTGGGGG + Intronic
1077464181 11:2725782-2725804 TGTGCTTTGGGTGGGGGCGGGGG - Intronic
1079373280 11:19870241-19870263 TATGCTTTGCTGGGGGGCGGGGG + Intronic
1081625547 11:44653249-44653271 TGTGCTCTGCAGTGGGGTGAGGG - Intergenic
1083187654 11:61026931-61026953 GGTCCTCTGCGGAGGGGGTGGGG - Intergenic
1083746819 11:64741610-64741632 TGCGCTCTGCGGAGATGCTGGGG + Intronic
1083747736 11:64744906-64744928 GGAGCTCCGCGCAGGGGCGGAGG - Intronic
1084128882 11:67118765-67118787 TGTGCTTTGTGGGGGGTCGGGGG + Intergenic
1084284490 11:68122173-68122195 TGTGCTCTGGGCAGTTGCGGCGG - Intergenic
1085044317 11:73344369-73344391 TGTGCTCTGCCGCAGGGAGGAGG + Intronic
1085666198 11:78417580-78417602 CGGGGCCTGCGGAGGGGCGGGGG - Intronic
1085946637 11:81280433-81280455 TGTGGTCTGTTGGGGGGCGGTGG - Intergenic
1088948465 11:114539283-114539305 TGTGGTCTGGGGAGGGGGGAGGG + Intronic
1089696254 11:120218131-120218153 ACTGCTCTGGGGAGGGGCTGGGG + Intronic
1089696265 11:120218162-120218184 ACTGCTCTGGGGAGGGGCTGGGG + Intronic
1090285284 11:125495014-125495036 TGGGTTCTGCGGAGGAGCAGTGG - Intronic
1090990830 11:131815585-131815607 TGTGCTCTGCAGAGGAAAGGGGG + Intronic
1091603960 12:1934958-1934980 AGTGTCCTGCGGAGGGGAGGCGG - Intergenic
1091768927 12:3139052-3139074 TGGGTTCTGGGGAGGGGCTGGGG - Intronic
1096749702 12:53751211-53751233 AGGGCTCAGAGGAGGGGCGGCGG - Intergenic
1096789581 12:54036384-54036406 GGGGCTCTGGGGAGGGGCAGGGG + Intronic
1097185884 12:57196070-57196092 TGTGCTCTGCGGAGGGGCGGAGG - Exonic
1097222654 12:57460120-57460142 TGTGCGGTGGGGAGGGGGGGCGG - Exonic
1105015885 12:132786659-132786681 TGTGCCCGGGGGAGGTGCGGGGG - Intronic
1105596828 13:21846859-21846881 GCTGCTCTGGGGAGGGGAGGGGG + Intergenic
1106808405 13:33334858-33334880 TGTGCGCTGCGGGGGGGTGGGGG - Intronic
1113558496 13:111257763-111257785 TGTGCACTTCGGAGAGGGGGAGG + Intronic
1116787773 14:49306991-49307013 TTTGCGCTGGGGAGGGGAGGAGG + Intergenic
1117288414 14:54309495-54309517 TGGGCACTGCTGAGGGGCTGGGG - Intergenic
1118332954 14:64827974-64827996 TGTGCTCTGGGGAGGGGAAGTGG - Intronic
1119207093 14:72802539-72802561 TGTGCTCACAGGAGGGGCTGGGG - Intronic
1122225974 14:100279815-100279837 TGTGCTCTGCGGTGGGCCCTTGG - Exonic
1122401623 14:101470752-101470774 GGTGCTCTGCAGAGGGGCATGGG - Intergenic
1122636621 14:103132629-103132651 TGTGCCTGGTGGAGGGGCGGGGG - Intronic
1122987667 14:105219960-105219982 TGGGCTCTGGGCAGGGGAGGTGG + Intronic
1123989553 15:25673251-25673273 TATGCGCTGGGCAGGGGCGGAGG + Intergenic
1124187268 15:27541742-27541764 CGTCCTCTGCGCAGGGGAGGAGG - Exonic
1124345035 15:28916528-28916550 TGTCCTCTGGGGAGGGGAGCGGG - Intronic
1124962456 15:34409089-34409111 CGTCCTCTGGGGAGGGGAGGGGG - Intronic
1125450407 15:39801399-39801421 TGTGCTCAGGGGTGGGGCAGAGG + Exonic
1125657172 15:41367490-41367512 TGTGCTCTGCTGGGGGCCAGTGG - Intronic
1125717627 15:41828067-41828089 TGTGGCCTGCGGCGGGGCGTCGG + Exonic
1125968808 15:43895371-43895393 TTTGCTCTGCAGAGGGACAGAGG - Intronic
1128356833 15:66934044-66934066 TGACCTCTGGGGAGGGGAGGTGG - Intergenic
1129385417 15:75193550-75193572 TGTGGAGTGTGGAGGGGCGGGGG - Intergenic
1129550155 15:76439735-76439757 GGTGGTCTGTGGAGGGGCAGGGG + Intronic
1130251674 15:82304051-82304073 TGTGGTCTGGGAAGGGGCGTCGG + Intergenic
1131119437 15:89813713-89813735 TGTGTTTTGTGGAGGGGAGGTGG - Intronic
1132147316 15:99436552-99436574 GGTCCTCTGTGGAGGGTCGGGGG - Intergenic
1132630983 16:917333-917355 TGTGCACTGCGGGTGGGCGCAGG + Intronic
1132630991 16:917379-917401 TGTGCGCTGCGGGCGGGCGCAGG + Intronic
1132630999 16:917425-917447 TGTGCGCTGCGGGCGGGCGCAGG + Intronic
1132631007 16:917471-917493 TGTGCGCTGCGGGCGGGCGCAGG + Intronic
1132880208 16:2158759-2158781 TGGGCTCGGCGGGGGGGGGGGGG + Intronic
1133183861 16:4081123-4081145 TGTGGCCTGGGGAGGGACGGTGG + Intronic
1133456329 16:5945671-5945693 TGTGCTGTGCAGAAGGGCAGGGG - Intergenic
1135015788 16:18924169-18924191 TTGGCTCTGGGGAGGGGCGATGG - Intronic
1135113368 16:19707692-19707714 TGTGCTCTGTAGAGTGGTGGGGG - Intronic
1135321404 16:21499982-21500004 TTGGCTCTGGGGAGGGGCGATGG - Intergenic
1135374237 16:21931477-21931499 TTGGCTCTGGGGAGGGGCGATGG - Intergenic
1135437549 16:22439237-22439259 TTGGCTCTGGGGAGGGGCGATGG + Intergenic
1137655200 16:50153361-50153383 GGGGCTCGGCGGAGGGGCGGAGG + Intronic
1138531650 16:57637722-57637744 TCTGCTCCACGGAGGGGCGGGGG + Intronic
1139615313 16:68085186-68085208 TGGGCTCTGCGGGGGGGGGGGGG + Intronic
1139683029 16:68580375-68580397 TGGACTCTGGGGTGGGGCGGGGG + Intergenic
1139952700 16:70679872-70679894 AGTGCGCTGCGGAGGGCGGGCGG + Exonic
1140371800 16:74418116-74418138 TGTGGTTTGCAGAGGGGCAGCGG - Exonic
1141528576 16:84629644-84629666 TGGGGTCTGCGGTGGGGAGGTGG - Intergenic
1141620558 16:85234914-85234936 TATCTACTGCGGAGGGGCGGGGG + Intergenic
1142699168 17:1649164-1649186 GGGGCTCTGGGGCGGGGCGGGGG - Intronic
1144344778 17:14339925-14339947 TGTGCCCAGAGGAGGGGCAGAGG + Intronic
1144991723 17:19237894-19237916 CGTGCTCTGGGGAGGGGGCGGGG - Intronic
1147469746 17:40648152-40648174 CGAGCCTTGCGGAGGGGCGGTGG + Exonic
1147896030 17:43751963-43751985 TTTGCTCTGTGGAGGGGATGAGG - Intergenic
1148109996 17:45139009-45139031 TGTGCTCCGCAGAGGGGTTGCGG + Exonic
1148130797 17:45261788-45261810 TGTGCACCGCGCAGGGGCTGAGG + Intronic
1148228484 17:45916290-45916312 TGTGCTCTGCAGAGGGCGGGTGG + Intronic
1148352288 17:46949813-46949835 TGTGCTCTGGGAAGGGCAGGAGG + Intronic
1148442599 17:47719503-47719525 AGTGCTCTGGGCAGGGGCTGGGG + Intergenic
1149623113 17:58060799-58060821 TGTGCACTGCGGATGGAGGGGGG + Intergenic
1149965673 17:61161705-61161727 TGTGCTGAGGGGAGGGGCGCTGG - Intronic
1150819674 17:68425177-68425199 TGTGCTCTGTGGAGGGCAGCAGG - Intronic
1150840545 17:68601669-68601691 TGCGCTCTGCAGGGGGGCGGAGG - Intergenic
1151143466 17:72017169-72017191 AGTGCTCAGCGGCGGGGAGGGGG + Intergenic
1152079233 17:78176138-78176160 TGTGCCTTGAGAAGGGGCGGGGG + Intronic
1152231739 17:79117332-79117354 TGGGCTTTGCGGTGGGGAGGAGG + Intronic
1152375486 17:79916727-79916749 TGTGGTTTGCCCAGGGGCGGCGG - Intergenic
1153238672 18:3012601-3012623 CGTGATCTGCGGCGAGGCGGGGG - Intronic
1153564567 18:6406564-6406586 TGTCCTCTGGGGAGGGGTGGAGG - Intronic
1155218272 18:23662433-23662455 TGTGCCCGGCGACGGGGCGGCGG - Intronic
1156483620 18:37451133-37451155 TGTCCTCTGCAGTGGGACGGGGG - Intronic
1156497703 18:37536871-37536893 TGTGCTCTGCGAAGGGAGAGAGG + Intronic
1157417765 18:47520371-47520393 TGGGCACTGCGGGGGGGGGGGGG - Intergenic
1157613538 18:48974278-48974300 TGTGTGCTGCTGGGGGGCGGTGG + Intergenic
1157618335 18:49001168-49001190 TGGGCTGTGGGGTGGGGCGGAGG + Intergenic
1160523942 18:79524652-79524674 TGAGCTCTCGGGAGGGGAGGAGG - Intronic
1161075278 19:2282287-2282309 TGTCCTCTGCGGGCGGGCAGGGG - Intronic
1161301067 19:3543538-3543560 TGTAGGCTGCGGTGGGGCGGGGG - Exonic
1161478554 19:4499380-4499402 TGTGCTCCCGGGAGGGGCTGCGG + Intronic
1163009428 19:14415740-14415762 GCTGCTCTGGGGAGGGGCTGGGG - Intronic
1164201688 19:23024360-23024382 TGTACTCTGCCTACGGGCGGGGG - Intergenic
1164534783 19:29076957-29076979 TGGGAGCTGCAGAGGGGCGGGGG + Intergenic
1164608461 19:29616623-29616645 TGAGCTTTGGGGAGGGGTGGTGG - Intronic
1167435951 19:49478845-49478867 TTTGGCCTGCGGAGGGGCGGTGG + Intronic
1168275743 19:55277381-55277403 TGTACTCTGGGGAGTGGCAGTGG + Intronic
1168584707 19:57583362-57583384 AGTTCTCAGCCGAGGGGCGGTGG + Intronic
1202709713 1_KI270714v1_random:11228-11250 TGTGCTCTGAGCAGGGGCGCCGG - Intergenic
925060650 2:887520-887542 TGTGCTCTGTTGAGGGGAGTGGG - Intergenic
925079985 2:1056251-1056273 TGTGCTGTGGGGAGGGAGGGAGG + Intronic
925080052 2:1056458-1056480 TGTGCTGTGGGGAGGGAGGGAGG + Intronic
925080184 2:1056911-1056933 TGTGCTGTGGGGAGGGAGGGAGG + Intronic
926794976 2:16611753-16611775 CGTACTGGGCGGAGGGGCGGAGG + Intronic
927062742 2:19439878-19439900 TGTGCTTTGCTGTGGGGCAGTGG - Intergenic
929378455 2:41319650-41319672 TGTGCTATGCAGAGTGGAGGAGG + Intergenic
929548691 2:42875272-42875294 TGGGCTTTGCCGGGGGGCGGGGG + Intergenic
936010584 2:108922749-108922771 TGTGGTCTGGGGAGAGACGGAGG - Intronic
937033630 2:118762477-118762499 TGTGCTGTGCTGATGGGCGTAGG + Intergenic
937324830 2:120984364-120984386 TGGGCTCTGCTGAGGGGCGTGGG + Intronic
937865840 2:126751454-126751476 TGTGATCTGTGGGGTGGCGGGGG - Intergenic
938066094 2:128282784-128282806 TGGGCACTGCGGAGGAGCAGAGG + Intronic
939792770 2:146599926-146599948 TAAGCTTTGCGGTGGGGCGGGGG - Intergenic
939953990 2:148509653-148509675 TGTGATCAGAGGAAGGGCGGAGG - Intronic
941676326 2:168346835-168346857 TGTCCTCTGCTGAGGAGCCGTGG + Intergenic
943569455 2:189556033-189556055 TGTGCTCTGGGCAGGGGTTGTGG + Intergenic
945033369 2:205685006-205685028 TGTGCTGTGCGGAGCGGGAGGGG + Intronic
1172033393 20:31996430-31996452 TGGGGTCTGGGGAGAGGCGGAGG - Intronic
1172605767 20:36212537-36212559 TGAGCTCTGGGGAGGGGCAACGG + Intronic
1172764940 20:37346264-37346286 GGGGGTCCGCGGAGGGGCGGGGG - Intronic
1173845809 20:46187757-46187779 TGTGCTCTGTGGTGAGGGGGTGG - Intronic
1174483683 20:50848312-50848334 TGGCCTCTGAGGAGGGGCTGTGG + Intronic
1174597553 20:51696188-51696210 TGTGCTGTGCGGTGGGGAGGGGG + Intronic
1175764497 20:61583141-61583163 AGGGCTCTGCGGAGGGACAGAGG + Intronic
1175764510 20:61583182-61583204 AGGGCTCTGCGGAGGGACAGAGG + Intronic
1175831205 20:61966214-61966236 GGTGCTCTGAGGAGGGGGTGTGG + Intronic
1175873067 20:62217452-62217474 TTTGTTCTGTGGCGGGGCGGGGG - Intronic
1175937940 20:62523532-62523554 AGGGCTCTGGGGAGGGCCGGGGG - Intergenic
1176301931 21:5102620-5102642 TGTCATCTGCTGAGGAGCGGAGG + Intergenic
1178417111 21:32412829-32412851 TGCGCTGCGCGGCGGGGCGGAGG - Exonic
1179170140 21:38966592-38966614 TGAGATCTGCGGGGGGGGGGGGG - Intergenic
1179621280 21:42617781-42617803 CGTGCTCAGCAGAGGCGCGGGGG - Intergenic
1179718311 21:43301480-43301502 TGTGCTGTGCTGTGGGGCAGGGG - Intergenic
1179785586 21:43728069-43728091 TGTGCTCTGAGCAGGGCTGGGGG + Intronic
1179855099 21:44159280-44159302 TGTCATCTGCTGAGGAGCGGAGG - Intergenic
1179951737 21:44712163-44712185 TGTGCTCTGCGGGGGGTGGGGGG + Intergenic
1180985988 22:19904162-19904184 AGTGCACTGGGGTGGGGCGGGGG - Intronic
1181085579 22:20437964-20437986 GGGGCTGCGCGGAGGGGCGGTGG - Intronic
1181440746 22:22934118-22934140 AGAGCTCTGCAGAGGGGCAGGGG + Intergenic
1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1183108469 22:35630917-35630939 GGTGCTCCGCTGAGGGGAGGTGG + Intronic
1183385797 22:37513769-37513791 TCAGCACTGCTGAGGGGCGGTGG - Intronic
1183986633 22:41573898-41573920 TGTCCTCTGAGTAGGGGCTGAGG + Intronic
1184481792 22:44752514-44752536 GGGGCTGGGCGGAGGGGCGGGGG + Intronic
1184522204 22:45001428-45001450 TGTGCTGTGCTGAGGGGTGTGGG - Intronic
1185019043 22:48362887-48362909 TGTGTTCTGGGGAGAGGCGGTGG + Intergenic
1185142529 22:49110936-49110958 TGGGCACTGCGGAGGGGAGAGGG - Intergenic
1185194857 22:49462837-49462859 AGAGCTCCCCGGAGGGGCGGTGG + Intronic
950018405 3:9769779-9769801 TGGGCGCTGCGTGGGGGCGGTGG - Intronic
950536270 3:13580803-13580825 TGTGCGCTACGGAGGAGCTGTGG - Intronic
951803864 3:26624565-26624587 TGCGATTTGTGGAGGGGCGGGGG - Intronic
952998558 3:38908947-38908969 TCTGCTCTGGGGAGGGGAAGGGG - Intronic
953780136 3:45861494-45861516 TGTGTGCTGAGGAGGGGTGGGGG + Intronic
954713521 3:52516240-52516262 TGAGGACTGGGGAGGGGCGGGGG + Intronic
959889132 3:111534258-111534280 TGACCTCTGAGGAGGGGAGGGGG + Intronic
961008351 3:123419930-123419952 TGTGCTGGGTGGAGGGGTGGGGG - Intronic
961433232 3:126898043-126898065 TGTGCTCTGCTGATTGGCAGTGG + Intronic
961677905 3:128578661-128578683 TGTGCTCTACTGAGGGGTGTGGG - Intergenic
962284194 3:134073147-134073169 TGTGCACTGCACAGGGGCAGAGG + Intronic
964244688 3:154638093-154638115 AGTGCTCTGGGGAGGGGAGACGG + Intergenic
966119439 3:176506067-176506089 TGTAGCCTGCGGCGGGGCGGGGG + Intergenic
966391570 3:179458218-179458240 TGTGATGTGGGGAGGGGCAGGGG + Intergenic
966735041 3:183181269-183181291 TCTGCTCTGGGGAGGGCCTGGGG - Intronic
967762547 3:193241535-193241557 TGTGCTGGGCGGAGTGGGGGAGG + Intronic
969603988 4:8193141-8193163 CGTGCTCTGGGTAGGGCCGGGGG - Intronic
969669756 4:8583180-8583202 AGTGCTGTGCTGAGGGGCAGGGG + Intronic
970071426 4:12163989-12164011 TGTGTTCTGTGGAGGGCAGGAGG + Intergenic
979950565 4:126887746-126887768 AGTGCTCTGGGGAGGGAAGGAGG + Intergenic
984177082 4:176432422-176432444 TGTGCTTTGGGAAGGGGAGGAGG - Intergenic
985625346 5:982619-982641 TGTGTTGTGGGGAGGGGCCGGGG + Intergenic
985777472 5:1852343-1852365 TGTGGTGGGCGGGGGGGCGGGGG - Intergenic
989206632 5:38815742-38815764 TGTGGTCAGAGGAGGGGAGGGGG - Intergenic
990287076 5:54310750-54310772 TGTGCTGAGCGGAGGAGCCGGGG + Intergenic
992716124 5:79513583-79513605 TGTGCTCGGCGGCGGGGGGCGGG - Exonic
993825245 5:92676431-92676453 TGTTCTCTGGAGAGTGGCGGAGG + Intergenic
994960936 5:106601708-106601730 TGAGCTCTGAGGAGGGGTGAGGG + Intergenic
997266319 5:132497099-132497121 TGAGGTCTGCGCAGCGGCGGGGG + Intergenic
997781928 5:136667738-136667760 TGTGCTCTGCCATGGGGTGGGGG - Intergenic
999150779 5:149424550-149424572 TGGGCTATGAGGAGGGGCAGAGG - Intergenic
999250178 5:150177904-150177926 TGGGCTCTGGAGAGGGGCTGTGG - Intronic
999453541 5:151696489-151696511 GCTGCTCTGGGGAGGGTCGGAGG + Intergenic
1000077575 5:157806282-157806304 TGTGCGCTGGGGAGGGGAAGTGG + Intronic
1003142572 6:3483760-3483782 TGTGCACTGAGGAGGGACAGAGG - Intergenic
1004100831 6:12609215-12609237 TGTGCTGTGCCGGGGGGCGGGGG + Intergenic
1004199616 6:13535661-13535683 TGTGGTGTGTGCAGGGGCGGCGG - Intergenic
1004518888 6:16343942-16343964 AGTGCCTTGCGGAGGAGCGGTGG - Intronic
1006169316 6:32084089-32084111 TGTGCTGTGCTGAGGGGCTTGGG - Intronic
1006622308 6:35374296-35374318 AGTTCTCGGCGGTGGGGCGGGGG + Intronic
1007078138 6:39080741-39080763 TAAGCTCTGAGGAGGGACGGTGG + Intronic
1007090045 6:39178387-39178409 TGTGCGCTGAGGTGGGGAGGGGG + Intergenic
1007406642 6:41639367-41639389 TGTGCACAGGGCAGGGGCGGCGG - Intronic
1007749461 6:44063130-44063152 TGTGCTCGCCAGAGGGGTGGGGG + Intergenic
1012111803 6:95244450-95244472 TGAGCCCTGGGGAGGGGTGGGGG - Intergenic
1019174784 6:170154451-170154473 TGTGTTCTGTGGAGGGGCCCTGG - Intergenic
1019702461 7:2480531-2480553 GGAGCTCTGCAGAGGGGCAGCGG + Intergenic
1019733264 7:2638764-2638786 TGTGCTATGGGTAGGGGCTGGGG + Intronic
1022855380 7:34309179-34309201 TGTGCACTGCGGAGGGGGGCGGG + Intergenic
1022961527 7:35430657-35430679 AGTGCTCTGAGGAGGCGGGGAGG - Intergenic
1023464181 7:40435608-40435630 TGAGCTCTGGGGAGGGTAGGTGG - Intronic
1024472134 7:49775319-49775341 TGTTCTCTCCGCAGGGACGGCGG + Exonic
1026101837 7:67390269-67390291 TGTGCTGTGGGAAGGGGAGGGGG - Intergenic
1026601946 7:71784625-71784647 TGTGCTTTCCAGGGGGGCGGCGG + Exonic
1028585572 7:92447935-92447957 GTTGCTCTGCGGAGGGGTGGCGG - Exonic
1029379050 7:100200722-100200744 TGTGCTGTGGGGATGGGAGGAGG - Exonic
1032239963 7:130153085-130153107 TGTGCTGTGCGGAGGAGCAGAGG + Intergenic
1032417176 7:131744668-131744690 TGGGCTCTGAGGAGGGGTGGAGG + Intergenic
1037154512 8:15684093-15684115 AGTGCTCTGGGGAGGGAAGGCGG + Intronic
1037304759 8:17493697-17493719 AGTGCTCTGGGTCGGGGCGGTGG + Intergenic
1038420293 8:27430226-27430248 TCTGGTCTGGGGAGGGGTGGAGG - Intronic
1040640523 8:49329245-49329267 TGTGCTCTGAGTTGGGGTGGTGG + Intergenic
1041177259 8:55209588-55209610 TGTGCTCCGCGGACGTGCCGTGG + Intronic
1048539581 8:135330635-135330657 GGTGCACTGGGGTGGGGCGGGGG + Intergenic
1049013367 8:139903036-139903058 TGTGCACTGCTGAGGGGTGTTGG - Intronic
1049340331 8:142108988-142109010 CGGGCTCTGCGGAGGGGGGAAGG + Intergenic
1049735523 8:144202805-144202827 GGCTCTCTGTGGAGGGGCGGGGG + Intronic
1049735537 8:144202836-144202858 CGCTCTCTGTGGAGGGGCGGGGG + Intronic
1052048527 9:23821682-23821704 CGAGCTCCGCGGAGAGGCGGTGG + Intronic
1052739699 9:32381813-32381835 TGTGCTCTGGTGGGGGGCAGAGG - Intergenic
1053569510 9:39289074-39289096 TGTGCTAGAGGGAGGGGCGGAGG + Intergenic
1053835471 9:42130094-42130116 TGTGCTAGAGGGAGGGGCGGAGG + Intergenic
1054091141 9:60848059-60848081 TGTGCTAGAGGGAGGGGCGGAGG + Intergenic
1054112552 9:61123615-61123637 TGTGCTAGAGGGAGGGGCGGAGG + Intergenic
1054127636 9:61329935-61329957 TGTGCTAGAGGGAGGGGCGGAGG - Intergenic
1054719110 9:68585749-68585771 TGTCATCGGCGGTGGGGCGGGGG - Intergenic
1057194771 9:93110854-93110876 TGGCCTCTGGGGAGGGGCTGAGG - Intronic
1057869923 9:98709424-98709446 AGCGCTCGGCGGAGCGGCGGCGG - Intergenic
1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1061370114 9:130193236-130193258 GGTGCTGTGAGGAGGGGCAGGGG + Intronic
1061808946 9:133151442-133151464 TGTGCTCTGCACAGGGTGGGAGG - Intergenic
1062363095 9:136196777-136196799 TGTGGTCTGGGGAGAGGAGGGGG + Exonic
1062366044 9:136209542-136209564 TGTGGTCTGGGAAGTGGCGGAGG - Intronic
1062591992 9:137278439-137278461 GGGGCCCTGCGGAGGGGCGGAGG + Intronic
1190047059 X:47120718-47120740 TGGGCTCTGCAGAGGGGCCTGGG - Intergenic
1199760014 X:150898370-150898392 TGTGCGAGGCGGAGCGGCGGGGG - Intronic
1199953205 X:152721950-152721972 TGACCTCTGCGGGGGGGCGGGGG - Intergenic
1199956477 X:152746496-152746518 TGACCTCTGCGGGGGGGCGGGGG + Intergenic