ID: 1097186062

View in Genome Browser
Species Human (GRCh38)
Location 12:57197127-57197149
Sequence GCTGTGGGGGTCGCCGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097186062_1097186072 14 Left 1097186062 12:57197127-57197149 CCCGCGGCGGCGACCCCCACAGC 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1097186072 12:57197164-57197186 TGGTGAGATGCGCGCTTGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 57
1097186062_1097186073 21 Left 1097186062 12:57197127-57197149 CCCGCGGCGGCGACCCCCACAGC 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1097186073 12:57197171-57197193 ATGCGCGCTTGGAGGGCATGAGG 0: 1
1: 0
2: 1
3: 5
4: 60
1097186062_1097186074 30 Left 1097186062 12:57197127-57197149 CCCGCGGCGGCGACCCCCACAGC 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1097186074 12:57197180-57197202 TGGAGGGCATGAGGTGACCCAGG 0: 1
1: 0
2: 5
3: 29
4: 324
1097186062_1097186070 10 Left 1097186062 12:57197127-57197149 CCCGCGGCGGCGACCCCCACAGC 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1097186070 12:57197160-57197182 TGACTGGTGAGATGCGCGCTTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1097186062_1097186069 -6 Left 1097186062 12:57197127-57197149 CCCGCGGCGGCGACCCCCACAGC 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1097186069 12:57197144-57197166 CACAGCTGCAAGGCTGTGACTGG 0: 1
1: 0
2: 0
3: 21
4: 391
1097186062_1097186071 13 Left 1097186062 12:57197127-57197149 CCCGCGGCGGCGACCCCCACAGC 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1097186071 12:57197163-57197185 CTGGTGAGATGCGCGCTTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097186062 Original CRISPR GCTGTGGGGGTCGCCGCCGC GGG (reversed) Exonic
900237738 1:1600556-1600578 ACTGCGCGGGTCCCCGCCGCGGG - Intergenic
902629681 1:17697214-17697236 GCGGTGGGCGTCGCGGGCGCAGG - Exonic
904006594 1:27366327-27366349 GCTGCGGGGGCGGCCGCGGCCGG + Exonic
905922268 1:41727585-41727607 GCTGAGGGGCGCGGCGCCGCCGG + Intronic
906551283 1:46668294-46668316 GCTGTGGTGGTGGCGGCTGCGGG - Exonic
907429852 1:54405711-54405733 GCGGTGGGGGGAGCCGCCGGAGG - Intronic
914887095 1:151594357-151594379 CCTGTGCAGGTGGCCGCCGCCGG + Intergenic
915203420 1:154251145-154251167 GCTGTGGAGGTAGCCACTGCAGG - Exonic
915960487 1:160262454-160262476 GCGGTGGTGGTGGCGGCCGCTGG - Intronic
916727393 1:167535191-167535213 GCTGTGGGGGGCCCCACCGGTGG - Intronic
920457227 1:206110378-206110400 GCTGTGGGGGTCCCCAGCCCAGG - Exonic
921037903 1:211400017-211400039 GCTGTGTGAGTCGCAGCCGCAGG - Intergenic
921171967 1:212558525-212558547 ACTATGGGGGACGGCGCCGCGGG - Intergenic
922937284 1:229432394-229432416 GTTGTGGGTGACGCCGTCGCCGG + Exonic
1064137538 10:12763941-12763963 GCTGTGGGGGTGGGGGCCACAGG - Intronic
1069899911 10:71701398-71701420 GCTGTGGGGTTCACCGCCCCTGG + Intronic
1072701006 10:97641187-97641209 GGGGTGGGGACCGCCGCCGCGGG + Intronic
1074511471 10:114116537-114116559 GCTGTGGGGCTGGCCACCTCTGG - Intergenic
1076871628 10:133197606-133197628 CCTGTGGGTGTTGCCGGCGCTGG + Intronic
1076948440 10:133666550-133666572 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1076949429 10:133669860-133669882 CCTGTGGGCGTCGCCGTTGCCGG - Intronic
1076950413 10:133673159-133673181 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1076951398 10:133676458-133676480 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1076952388 10:133679768-133679790 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1076953376 10:133683078-133683100 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1076955344 10:133742729-133742751 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1076956334 10:133746039-133746061 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1076957322 10:133749348-133749370 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1076958311 10:133752658-133752680 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1076959295 10:133755957-133755979 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1076960284 10:133759267-133759289 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
1077487971 11:2847846-2847868 TCTGGGGGGGCCGCCGCTGCCGG - Exonic
1084175670 11:67421039-67421061 GCTGTGGGCCGCGCCGCGGCTGG + Exonic
1088868882 11:113875157-113875179 GACGTGGGGTTCTCCGCCGCAGG - Intronic
1096495421 12:52037063-52037085 GCTGCGTCGGCCGCCGCCGCCGG + Intronic
1096774425 12:53955474-53955496 GCTGCCGGGGTCGCCTGCGCCGG - Exonic
1096848168 12:54419123-54419145 GCAGCGGGGGTCGGCGCCGGGGG + Exonic
1097185258 12:57193248-57193270 GCAGTGGGGGACGCCGTCGCAGG - Exonic
1097186062 12:57197127-57197149 GCTGTGGGGGTCGCCGCCGCGGG - Exonic
1100329784 12:93572033-93572055 GCGGTGGTTCTCGCCGCCGCGGG - Exonic
1103889075 12:124224963-124224985 GCTCTGGGGCTGGCCACCGCTGG - Intronic
1104653691 12:130557251-130557273 GCTGTGGGGGGCTCCACTGCAGG - Intronic
1104963964 12:132500847-132500869 GCTGTGGGGGACACTGCGGCAGG - Intronic
1104980173 12:132570128-132570150 GCTGCGGGGGTGGCGGCTGCGGG - Exonic
1106674691 13:31945906-31945928 GCTGTGACGGTGGCTGCCGCTGG + Intergenic
1107307384 13:39037732-39037754 GCGGTGAGGGTCGCGGCCGGCGG - Exonic
1110705970 13:78602240-78602262 GTCGTGGGCGCCGCCGCCGCCGG + Exonic
1111951278 13:94711391-94711413 GCAGCGGCGGCCGCCGCCGCCGG - Exonic
1112050621 13:95641776-95641798 GCTGTGGCCGCCGCCGCCGCGGG - Exonic
1112768761 13:102773650-102773672 GCGGTGGCGGTTGGCGCCGCCGG - Intronic
1113856050 13:113446021-113446043 TCTGTGGGGTTTGCAGCCGCTGG - Intronic
1115235835 14:31207808-31207830 GCCGGCGGGGTCGCCGCCGGGGG - Intergenic
1122503621 14:102218002-102218024 GCTGTGGAGGTCACCTCCACTGG - Intronic
1122608892 14:102967632-102967654 GCTGTGCGGGACGCTGCCGGCGG + Intronic
1123025328 14:105421217-105421239 GCTGTGGGAGGGGCTGCCGCTGG - Intronic
1129644741 15:77419843-77419865 GTTCTGGGTGGCGCCGCCGCCGG - Intronic
1130230095 15:82090501-82090523 GCTGTGAGGGTGGCCGCCCCAGG - Intergenic
1130918478 15:88324405-88324427 GCTGCGAGGGTGGCCGCTGCAGG + Intergenic
1132519692 16:381572-381594 GGGTTGGGGGTCCCCGCCGCGGG - Intronic
1136458402 16:30395337-30395359 CCTGTGGGGGTCGCCCGCGTCGG - Exonic
1139409979 16:66751437-66751459 GCCGTGGGGGGCGCGGCCTCTGG - Intronic
1139528110 16:67528821-67528843 GCTGCCGCTGTCGCCGCCGCAGG - Intronic
1139631985 16:68236538-68236560 GCTGTGGGGGTCAACACGGCAGG + Exonic
1141489206 16:84360611-84360633 GCAGTGGGGCTCCCCGCTGCAGG + Intergenic
1142066732 16:88067247-88067269 GCTGAGGGGGTCAGAGCCGCTGG + Intronic
1142849505 17:2697567-2697589 GCACCGGGGGTCCCCGCCGCTGG - Intronic
1142987485 17:3705119-3705141 GCTGTGGGGGAAGCCAGCGCCGG - Intergenic
1144565078 17:16353229-16353251 GCTGAGGCGCTCGTCGCCGCGGG - Exonic
1147457625 17:40548015-40548037 GCTGTGGGGGTCACAGCCCCTGG + Intergenic
1148081049 17:44967890-44967912 GCTCAGGGCGTCGCCGCCGTCGG + Exonic
1150549067 17:66192201-66192223 GCGCCGGTGGTCGCCGCCGCCGG - Intergenic
1151773215 17:76178376-76178398 GCTGTGGGGCTGGCAGCCCCAGG - Intronic
1151983162 17:77526261-77526283 GCTGGGGGGGTCGGGGGCGCCGG - Intergenic
1152632602 17:81417260-81417282 GCTGCGGGGGGCGGCGCCGAGGG + Intronic
1152698535 17:81807881-81807903 GCTGTGGGAGTCACAGCCCCTGG - Intronic
1152924116 17:83079766-83079788 GCTCCGGGGGTCGCGGACGCGGG + Exonic
1155872149 18:31042304-31042326 GCTCTGGCGGGCGCCGTCGCGGG - Intronic
1160528295 18:79549713-79549735 GCCGTGGGAGTTGGCGCCGCTGG - Intergenic
1160696734 19:488709-488731 GCTGCGGGGGTCGGGGCCGCAGG - Intergenic
1160866600 19:1259027-1259049 GCTGTGGGGGTCCCGGCACCTGG + Exonic
1161800808 19:6415930-6415952 GGTGCGGGGGTGGCCGCAGCCGG + Intronic
1162059332 19:8085454-8085476 GCTGTGGGGGTGGCCGGGGCTGG - Exonic
1162725437 19:12687681-12687703 GCTGAGGGGGTCCCTGCCCCAGG - Intergenic
1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG + Exonic
1165070610 19:33253135-33253157 GCTGTGGGGGCGGCTGCCTCTGG + Intergenic
1165696917 19:37907466-37907488 GCCGTGGGGGGCGGCGGCGCCGG + Intronic
1166295372 19:41886846-41886868 GCTGTGGGGAGCCCCGCCGCTGG + Intronic
1167526651 19:49988464-49988486 GCTCTGGAGGTCGCTGCGGCGGG + Exonic
1168257220 19:55173593-55173615 GCCGTGGGGGCGGCCGCCGGCGG - Exonic
926325253 2:11779615-11779637 GCTGTGGGGAGAGCTGCCGCAGG + Exonic
927156683 2:20224899-20224921 GCTGCGCGGGTCGCGGCTGCGGG + Exonic
929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG + Exonic
934105586 2:88691877-88691899 GCTGTTGGAGTCCCCGCAGCTGG - Exonic
935901882 2:107801712-107801734 GCTGTGGGGCTGGCAGCAGCGGG - Intergenic
946247473 2:218396025-218396047 GGCGTGGGAGTCGCGGCCGCCGG - Exonic
948801817 2:240436494-240436516 GCTGTGGGGCTCGGCGTGGCCGG + Intronic
948850235 2:240702112-240702134 GCTGTGGAGGTCGCCTCCAGTGG + Intergenic
1171175584 20:23049202-23049224 GCGCTTGGGGTCGCCGCAGCCGG + Exonic
1171768009 20:29300748-29300770 GCCTTGTGGGGCGCCGCCGCCGG - Intergenic
1171866144 20:30488565-30488587 GCCTTGTGGGGCGCCGCCGCCGG - Intergenic
1172731953 20:37095876-37095898 GCGGCGGTGGTCGCCGCAGCCGG - Exonic
1172919960 20:38473021-38473043 GCCGGGGCGGGCGCCGCCGCCGG - Exonic
1172975959 20:38906113-38906135 GCTGTGGGGGAGGCCGGCACAGG + Intronic
1175429125 20:58890316-58890338 GCCGAGGAGGGCGCCGCCGCCGG + Intronic
1175931796 20:62497028-62497050 GCTGTGGGAGGCGCAGCTGCGGG + Intergenic
1176287799 21:5027950-5027972 GCTGTGGGGGGCGCTGACGACGG - Exonic
1179529855 21:42010850-42010872 GCTGTCGGGGTCGTCGGCTCGGG - Intergenic
1179869382 21:44235525-44235547 GCTGTGGGGGGCGCTGACGACGG + Exonic
1180066819 21:45416439-45416461 GGTGTGGGGGTGGCCGGGGCAGG + Intronic
1181471840 22:23145480-23145502 GCCATGGTGATCGCCGCCGCTGG + Exonic
1182494225 22:30694944-30694966 GCTGTGGCGGCCGCTCCCGCGGG + Exonic
961192987 3:124977910-124977932 ACTGTGGTGATCGCAGCCGCGGG - Exonic
962753645 3:138452143-138452165 GCTGTGGGGGTGACAGCCGCGGG - Intronic
964961100 3:162427710-162427732 GCTGTGGTGGTCACGGCCACAGG + Intergenic
968746303 4:2362377-2362399 GCTGTGGGGGTCACAGCTGTGGG - Intronic
969723139 4:8904362-8904384 GTTGCGGGGGTGGCCGCGGCTGG - Intergenic
975402339 4:73952529-73952551 GCTGTGTGAGTCGCAGCCGCAGG + Intergenic
980920914 4:139084467-139084489 GCTGTGGCGGCCGCCGCAGCTGG + Intronic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
985451894 4:190067355-190067377 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
985452883 4:190070646-190070668 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
985453870 4:190073939-190073961 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
985454858 4:190077232-190077254 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
985455846 4:190080529-190080551 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
985456829 4:190083823-190083845 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
985457817 4:190087119-190087141 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
985458805 4:190090416-190090438 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
985463057 4:190173179-190173201 CCTGTGGGCGTCGCCGTTGCCGG - Intergenic
998168944 5:139860751-139860773 GATGTGGGGGTCTCCGTCACAGG - Intronic
1002204505 5:177553778-177553800 GCTGAGGGGGCCGCGGCTGCAGG + Intronic
1003624091 6:7727052-7727074 GCTGCCGCGGCCGCCGCCGCCGG + Exonic
1005303768 6:24495022-24495044 GCTGTGGGGCCCGGCGCCTCGGG + Exonic
1013369236 6:109455531-109455553 GCGGTGGGGGTCCCCGACACTGG + Intronic
1014710386 6:124799848-124799870 GCTGTGGGGGTCTGCACCACTGG - Intronic
1019112017 6:169724249-169724271 GCTGAGGCGGTGGCCGCGGCCGG - Intronic
1019421700 7:953975-953997 GCTGTGGGGTCCGCCGGCTCCGG - Intronic
1019909866 7:4093669-4093691 GCTGTCGCTGTCGACGCCGCCGG - Intronic
1022410289 7:30134880-30134902 GCCGTGGGGGTTGGCGCGGCCGG - Exonic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1023860906 7:44217319-44217341 GGTGTGGTGGTGGCGGCCGCTGG - Exonic
1029445977 7:100612929-100612951 GCTGTCGGGGTCCGCTCCGCTGG - Exonic
1029607229 7:101606343-101606365 GCTGTGGGAGCCGGCGGCGCCGG + Intergenic
1031361915 7:120857701-120857723 GCTCTGGGGCTCCCTGCCGCCGG - Intronic
1031966463 7:128031313-128031335 GCTCTGCGGGCCGCCGCCGGAGG + Intronic
1031966578 7:128031733-128031755 GCTGCGGCCGCCGCCGCCGCCGG - Intronic
1031966628 7:128031909-128031931 GCAGCGGGGGTCGCGGCTGCGGG + Intronic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1038484199 8:27922009-27922031 GCTGTGGGGGCTGCAGGCGCAGG - Exonic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1039516335 8:38136979-38137001 GCTGTGGGGGAGGCTGACGCAGG + Intronic
1039895540 8:41714165-41714187 GCTGTGCGGGGAGCCGCCCCGGG + Exonic
1041045091 8:53880788-53880810 GCGGTGGAGTGCGCCGCCGCTGG + Intronic
1052869098 9:33486073-33486095 GCTGTGGTGGTGGCCGCCTGTGG + Intergenic
1056475256 9:86946671-86946693 GCTGCTGGGCTCGGCGCCGCGGG - Exonic
1060544601 9:124452697-124452719 TCTGTGGGGGTCTCCGCAGAGGG - Exonic
1061052336 9:128204019-128204041 GGTGTGGGGGACGCTGCCCCCGG - Intronic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1062386169 9:136312367-136312389 GCTGTGGGGGGCCCGGCTGCCGG + Intergenic
1062596472 9:137302083-137302105 GGGCCGGGGGTCGCCGCCGCGGG + Exonic
1185765993 X:2726295-2726317 GCTGTCGTGGTCGCCGTGGCTGG + Exonic
1189332665 X:40153106-40153128 GCAGTCGGGGACGCCGCCGCAGG + Intronic
1189978795 X:46488891-46488913 GCTGTGTGAGTCGCGGCCGCGGG + Intronic
1189988458 X:46573940-46573962 ACTCTCGGCGTCGCCGCCGCCGG - Exonic
1194325874 X:92515501-92515523 GCTGTAGCCGCCGCCGCCGCGGG + Intronic
1197415136 X:126165406-126165428 GCTGTTGGGGTTTTCGCCGCCGG + Exonic
1197445867 X:126552090-126552112 GCTGTTGGGGTTTTCGCCGCCGG + Exonic
1199736898 X:150693621-150693643 GCCGCGGGGGGCGCCACCGCCGG + Exonic
1200634596 Y:5634659-5634681 GCTGTAGCCGCCGCCGCCGCGGG + Intronic
1201176713 Y:11314375-11314397 CCTGTGGGTGTCGCCGTTGCCGG - Intergenic
1201179402 Y:11331797-11331819 CCTGTGGGTGTCGCCGTTGCCGG - Intergenic