ID: 1097187193

View in Genome Browser
Species Human (GRCh38)
Location 12:57202241-57202263
Sequence CTATAAGGAGGTTTGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097187193_1097187203 4 Left 1097187193 12:57202241-57202263 CCTGTCCCCAAACCTCCTTATAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1097187203 12:57202268-57202290 CACGTCTCAAAACACCGCCTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1097187193_1097187204 14 Left 1097187193 12:57202241-57202263 CCTGTCCCCAAACCTCCTTATAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1097187204 12:57202278-57202300 AACACCGCCTGGGCTCCCCGCGG 0: 1
1: 0
2: 0
3: 9
4: 105
1097187193_1097187202 3 Left 1097187193 12:57202241-57202263 CCTGTCCCCAAACCTCCTTATAG 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1097187202 12:57202267-57202289 CCACGTCTCAAAACACCGCCTGG 0: 1
1: 0
2: 1
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097187193 Original CRISPR CTATAAGGAGGTTTGGGGAC AGG (reversed) Intronic
900097938 1:947931-947953 CATTCAGGAGGTTTGGGGGCAGG - Intronic
909412170 1:75367451-75367473 CTATTAACAGGTTTGTGGACAGG + Intronic
909585149 1:77281539-77281561 CTATAGGGAGCTGTGGGGAAGGG - Intergenic
909666146 1:78135210-78135232 CTATTAGGAGGTTGGGGAAGGGG + Intronic
910265474 1:85332873-85332895 CTACCTGGAGGATTGGGGACTGG + Intronic
911793171 1:102044962-102044984 CAATAAGAAGGCTTGGGGGCTGG + Intergenic
912946936 1:114093136-114093158 ATACATGGAGGTTTGGGGTCGGG + Intronic
913695169 1:121317775-121317797 CTATAATCAGGTTTGGGGGAAGG - Intronic
914142394 1:144962285-144962307 CTATAATCAGGTTTGGGGGAAGG + Intronic
915565652 1:156711246-156711268 CTATAAGGAGGGGTGGGGGTGGG - Intergenic
918532952 1:185543121-185543143 ATATCAGCAGGTTTGGGGATGGG - Intergenic
920165611 1:204033582-204033604 GTAGAAGCAGATTTGGGGACAGG - Intergenic
920482501 1:206336154-206336176 CTATAATCAGGTTTGGGGGAAGG - Intronic
924318765 1:242826207-242826229 CTATAAGGAAGTTTAGGGGAAGG - Intergenic
924705786 1:246500865-246500887 CTGTAACGAGGTTTGGGAAAGGG - Intronic
1064245556 10:13665324-13665346 CTATAGGGGGCTTAGGGGACAGG - Intronic
1070409602 10:76127477-76127499 ACATAAGTAGGTTTGGGAACAGG - Intronic
1073838814 10:107474919-107474941 ACATAAGAAGCTTTGGGGACAGG - Intergenic
1074103370 10:110371221-110371243 CTGTCAGGAGGTTGGGGGCCAGG + Intergenic
1076486864 10:130826353-130826375 TAATAAGGAGGTGTGGGGAAGGG - Intergenic
1077899795 11:6479098-6479120 CCATAAGGAGTTTTGGGGAAGGG + Intronic
1083075836 11:60036391-60036413 CTATTTGGAGGTTTGTGGAATGG + Intergenic
1086020097 11:82217217-82217239 CTAAAAGAAGATTTGGGGAATGG - Intergenic
1086958260 11:92956379-92956401 CTAGTAGCTGGTTTGGGGACTGG + Intergenic
1088223931 11:107598613-107598635 GTGCAAGGAGGTTTGGGGAAAGG - Intronic
1089132634 11:116224453-116224475 CCATAAGGAGGGTTGGGGGTGGG - Intergenic
1091313807 11:134596592-134596614 CTTTGAGGAGGTTTTGGGCCAGG + Intergenic
1092584171 12:9879289-9879311 CTATATGGAAGTCTGGGGATTGG - Intergenic
1092702743 12:11250830-11250852 CTATCAGGAGGTGGGGGGAAGGG - Intergenic
1093603892 12:21065879-21065901 CTCAAAGGAGATTTGGGGAAGGG - Intronic
1093861447 12:24172118-24172140 CTGTAAGCAGGCTTGGGGATTGG + Intergenic
1095356986 12:41286419-41286441 CTCTAAGGAGGTTGGGAGAGTGG - Intronic
1097187193 12:57202241-57202263 CTATAAGGAGGTTTGGGGACAGG - Intronic
1097488499 12:60235339-60235361 CAATAAGGAGGCATGGGGTCAGG - Intergenic
1098270116 12:68761906-68761928 CCAGAAGGAGGTTTGGGGCTGGG + Intronic
1098984557 12:76997827-76997849 TTTTAAGGAGATTTGGGGATGGG - Intergenic
1099556761 12:84118523-84118545 CTAAGATGAGATTTGGGGACTGG + Intergenic
1101557442 12:105823525-105823547 CTATTAAGAGTTTTGGAGACAGG + Intergenic
1103277446 12:119724530-119724552 CTATGAGGAGCGTTGGGGAAGGG + Intronic
1106583389 13:31036603-31036625 CTATAAGGAGCTCTGGGCCCGGG - Intergenic
1106843608 13:33712781-33712803 CTGTAAGGAGGTATGGCGTCTGG - Intergenic
1110691990 13:78441682-78441704 CAATAAGGAGGTTAGGAAACAGG + Intergenic
1110861820 13:80352586-80352608 ACATCTGGAGGTTTGGGGACAGG + Intergenic
1112638769 13:101247800-101247822 CTATCAGGAGGTGGGGGGAGGGG - Intronic
1114636126 14:24187886-24187908 CTTTCAGGAGGTGTGGGCACAGG + Intronic
1115322690 14:32101248-32101270 CTGTAATGGGGTTTGGAGACTGG + Intronic
1120917596 14:89723448-89723470 CTATCAGGAGGATTTGGGGCAGG - Intergenic
1121160148 14:91730539-91730561 CTCTAAGGAACTTGGGGGACAGG + Intronic
1121244655 14:92453124-92453146 CAAGAAAGAGGTCTGGGGACAGG + Intronic
1122370782 14:101227900-101227922 CTGAATGCAGGTTTGGGGACTGG + Intergenic
1126002604 15:44225263-44225285 CTGTAAGTAGGTTTGGGAAAAGG + Intergenic
1127853153 15:62933063-62933085 CTTTAAGGAGACTTGGGGAGGGG + Intergenic
1129462659 15:75707680-75707702 CTATAAACAGGTTTGTGGAGTGG + Intronic
1129722212 15:77883736-77883758 CTATAAACAGGTTTGTGGAGTGG - Intergenic
1131983489 15:98018148-98018170 CTAAAAGGAGGATTAGGGTCAGG - Intergenic
1132934744 16:2474763-2474785 CTGGAAGGAGGTTCTGGGACGGG - Intergenic
1134687531 16:16169346-16169368 CTGTCTGGAGGTTTGGGGGCAGG + Intronic
1137033682 16:35548663-35548685 ACATATGGAGGCTTGGGGACAGG + Intergenic
1138153727 16:54683830-54683852 GTACAAGGAGGTGTGGGCACAGG - Intergenic
1140245130 16:73241492-73241514 ATAAAAGGAGGGTTGGGGGCCGG + Intergenic
1140341417 16:74167884-74167906 CTGTCAGGAGGTGTGGGGAGGGG - Intergenic
1141212654 16:81995507-81995529 CTATAAGGAGGTCAGGGAATGGG - Exonic
1141867239 16:86758941-86758963 CTATTAGGGGATTTGGTGACAGG + Intergenic
1142558051 17:793060-793082 CTATAAGGAACTGTGGGGATGGG + Intergenic
1145098453 17:20052727-20052749 CTCTAGAGAGGTTTGGGAACAGG + Intronic
1147372747 17:40004737-40004759 CTATGAGAAGGTTTTGGGATTGG - Intergenic
1151144621 17:72029576-72029598 CTAAAATGAGATCTGGGGACTGG + Intergenic
1151636298 17:75350836-75350858 CTGTAGTGAGGCTTGGGGACGGG + Intronic
1155818381 18:30344895-30344917 CTATAACTAGGGTTGGGGACAGG - Intergenic
1157454016 18:47810265-47810287 GGCTCAGGAGGTTTGGGGACAGG - Exonic
1159002674 18:62987787-62987809 CTTGAAGGAGGCTTGAGGACAGG - Intergenic
1160561490 18:79760670-79760692 CTATAAGGAGGGGAGGAGACAGG - Intergenic
1161729834 19:5952528-5952550 CAAGAGGGAGGTTTGGGGACTGG - Intronic
1162872444 19:13596964-13596986 CTATAAGGACGCTTTGGGCCAGG + Intronic
1164051105 19:21586460-21586482 CTTTAAGGAGGGCTGGGGCCGGG + Intergenic
1166358196 19:42239914-42239936 GGACAGGGAGGTTTGGGGACTGG - Intronic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
927697128 2:25246365-25246387 CTGTAAGGAGGGTGGGGGAAGGG - Intronic
928465757 2:31520800-31520822 TTATGAGGTGGGTTGGGGACAGG - Intergenic
929576046 2:43052691-43052713 CTATAAGCAAGTTTGTGGAGAGG - Intergenic
931437271 2:62259129-62259151 CTTCAAGGAGGTTTGTGGAAAGG - Intergenic
931499858 2:62854555-62854577 AAATAAGGAGGTCTGGGGAGTGG + Intronic
937233516 2:120416441-120416463 GTCTAGGGAGGTTTGGGGAAGGG - Intergenic
940734113 2:157429726-157429748 CTATTAAGAAGTTTGGGGCCAGG + Intronic
946264157 2:218523823-218523845 AAATAAAGAGGTTTGGGGATTGG - Intronic
1172906401 20:38373320-38373342 CTCTAATGAGGGTTGGGGGCTGG + Intronic
1175533076 20:59687708-59687730 CTAAGAGAAGGTTTGTGGACTGG + Intronic
1180164802 21:46019492-46019514 AAATCAGGAGGTTTGGGGAAAGG - Intergenic
1182765044 22:32752706-32752728 CCAGAAGGAGGTTAGGTGACTGG - Intronic
954348554 3:50022800-50022822 ATATAAGGGAGTTTGGGGGCTGG + Intronic
954391536 3:50270410-50270432 CTATCGGGAGGTTGGGGGAGAGG - Intronic
955472800 3:59303437-59303459 CTATAAGGAGAGCTGGGGAAAGG + Intergenic
959383946 3:105678163-105678185 ACATAAGGAGGTTTCTGGACTGG + Intronic
960090510 3:113633755-113633777 CTATAAAATGGATTGGGGACGGG + Intergenic
960317780 3:116199188-116199210 CTATAAGGAAGTTTGGAGCTGGG + Intronic
963387283 3:144613549-144613571 CTAGAAGGAGGAGTGGGGAAAGG - Intergenic
965485841 3:169277556-169277578 GTATAGGGAGGTTAGGGGACTGG - Intronic
968541091 4:1168791-1168813 CTGTCAGGAGGCCTGGGGACAGG + Intronic
970035472 4:11730134-11730156 CTATAAGGAGGGTGGGGGGAAGG + Intergenic
971103559 4:23497040-23497062 CTCTAAGGAGGTTTAGAGAAGGG + Intergenic
971754463 4:30689528-30689550 CTATGAGGAGGAGTGGGGAGAGG - Intergenic
973572272 4:52252624-52252646 GTATAAGGAGGTCTGCGAACTGG - Intergenic
974090327 4:57303741-57303763 GTACAAGGAGGTTTGGTCACTGG + Intergenic
974524054 4:63025470-63025492 ATATAAGAAGATTTGGGGAAAGG - Intergenic
976113862 4:81705955-81705977 TTAGAAGGAGGTATGGGGAGGGG - Intronic
978066861 4:104415664-104415686 CTATAAGTAGGTTTGAGGAAAGG + Intergenic
980952875 4:139398990-139399012 GAATAAGGAGGTTTGAGGAGAGG + Intronic
982844520 4:160232858-160232880 CTAGAAGGAAGTTTGGGGGAGGG + Intergenic
983759009 4:171381649-171381671 CTGGAAGGAGGTTAGGGGAAGGG + Intergenic
986733001 5:10649141-10649163 CTGTTAGGAGGCTTGGGGCCAGG + Intronic
990139242 5:52683715-52683737 GTATAAGAATGTTTGGGGCCAGG + Intergenic
992480924 5:77152002-77152024 CTAAAAGGGGGGTTGGGGAGGGG - Intergenic
992812206 5:80400243-80400265 GTGTAAGGAGGTTTGGTGTCTGG + Intergenic
993324974 5:86523128-86523150 ATATAAGGAAGTTTTGGGCCAGG + Intergenic
994351483 5:98751179-98751201 TTATAATGAGGTTTGCTGACTGG + Intergenic
996655008 5:125925191-125925213 CTTCAAGGAGGTTTAGGGCCTGG - Intergenic
998429004 5:142054478-142054500 GTAGAAGGATATTTGGGGACAGG - Intergenic
1000748732 5:165068478-165068500 CTGTCAGGAGGTTGGGGGAAGGG - Intergenic
1002763184 6:217582-217604 CTAAGAGCAGGCTTGGGGACGGG + Intergenic
1004635040 6:17459009-17459031 CTTTAAGGCGTTTTGGGGACAGG - Intronic
1006084817 6:31588042-31588064 CTGAGAGGAGGGTTGGGGACGGG + Intronic
1006201882 6:32300753-32300775 CAATGCAGAGGTTTGGGGACTGG - Intronic
1006915553 6:37591592-37591614 CTGTAGGGAGGCTTGGGGACAGG - Intergenic
1009808607 6:68634384-68634406 CTAGTAACAGGTTTGGGGACGGG - Intergenic
1011454241 6:87529919-87529941 CTATTAGGAGGTTTGAGAAGAGG - Intronic
1012630815 6:101464813-101464835 TTATAAGAATGTTTGGGGCCGGG - Intronic
1013993900 6:116284666-116284688 CTATCATGAGGTTGGGGGAGGGG - Intronic
1014665007 6:124227131-124227153 CAATAAGGAGGTTTGAGTTCAGG - Intronic
1014714032 6:124842775-124842797 CTACAAGGAGCTTTGGGGTTAGG - Intergenic
1015090510 6:129351431-129351453 CTATAACAATGTTTGAGGACTGG - Intronic
1017613187 6:156213496-156213518 CCATCAGGATGTTTGAGGACAGG - Intergenic
1017964230 6:159250193-159250215 TTATCAGGAAGTTTGGGGAGTGG - Intronic
1019176717 6:170162948-170162970 CTGAAAGGAAGTTTGGTGACGGG - Intergenic
1021309356 7:19073870-19073892 CTACATGGAGGCCTGGGGACTGG + Intronic
1021522478 7:21551536-21551558 CTTTAAGGAGCTTTAGGGCCTGG + Intronic
1028922620 7:96323812-96323834 ATAAAAAGAGGTTTGGGGAGTGG + Intergenic
1031093228 7:117387823-117387845 CAATATGAAGGTCTGGGGACAGG - Intronic
1032301483 7:130691303-130691325 CTAGAAGTTGGTTTGGAGACTGG - Intergenic
1032696681 7:134342792-134342814 CTATAAGGAGATAAGGGGGCTGG - Intergenic
1034910784 7:154996838-154996860 CAAAAAGGTGGTTTGGGGTCAGG + Intronic
1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG + Intergenic
1039338854 8:36624373-36624395 CTATAGGGAGGCTTGGGTATGGG + Intergenic
1042695023 8:71547018-71547040 CTTTTATGAGGGTTGGGGACGGG - Intronic
1043818537 8:84834416-84834438 CTATGAGGATGTTAGTGGACTGG + Intronic
1046410691 8:113838658-113838680 CTAGCAGAAGTTTTGGGGACAGG - Intergenic
1050159925 9:2707613-2707635 CTATCAGGGGGTGGGGGGACAGG + Intergenic
1053263846 9:36695892-36695914 CTAAAAAGAGCTTTGGGGAAGGG + Intergenic
1059691172 9:116687390-116687412 CGGGAAGGAGGGTTGGGGACTGG + Intronic
1060787355 9:126461014-126461036 CTGTTATGAGGTCTGGGGACAGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1062130577 9:134890790-134890812 CAAGAAGGAGGTTTTGGGAAAGG - Intergenic
1062433188 9:136535055-136535077 CTGGAAGGAGGTCTGGGGCCTGG - Intronic
1186519170 X:10190063-10190085 CTAGAGGGAGGGGTGGGGACAGG + Intronic
1190483870 X:50904880-50904902 CTATATAGAGGTTTGGGGCATGG - Intergenic
1194444238 X:93967472-93967494 ATCTAAGGATGTTTGGGGAATGG + Intergenic
1194932534 X:99904797-99904819 CAAGAAGGATGTTTGGGGAAAGG + Intergenic