ID: 1097187347

View in Genome Browser
Species Human (GRCh38)
Location 12:57202903-57202925
Sequence CTGTGTTTGGGGAGGGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 984
Summary {0: 2, 1: 0, 2: 4, 3: 124, 4: 854}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097187347_1097187361 18 Left 1097187347 12:57202903-57202925 CCCGCTCCCCTCCCCAAACACAG 0: 2
1: 0
2: 4
3: 124
4: 854
Right 1097187361 12:57202944-57202966 CCAGGGACCTGTGTCCTCTCTGG 0: 1
1: 0
2: 4
3: 25
4: 276
1097187347_1097187356 -10 Left 1097187347 12:57202903-57202925 CCCGCTCCCCTCCCCAAACACAG 0: 2
1: 0
2: 4
3: 124
4: 854
Right 1097187356 12:57202916-57202938 CCAAACACAGTCTGTTCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 171
1097187347_1097187359 1 Left 1097187347 12:57202903-57202925 CCCGCTCCCCTCCCCAAACACAG 0: 2
1: 0
2: 4
3: 124
4: 854
Right 1097187359 12:57202927-57202949 CTGTTCTGAGGGCAAGGCCAGGG 0: 1
1: 0
2: 2
3: 35
4: 286
1097187347_1097187358 0 Left 1097187347 12:57202903-57202925 CCCGCTCCCCTCCCCAAACACAG 0: 2
1: 0
2: 4
3: 124
4: 854
Right 1097187358 12:57202926-57202948 TCTGTTCTGAGGGCAAGGCCAGG 0: 1
1: 0
2: 1
3: 31
4: 240
1097187347_1097187357 -5 Left 1097187347 12:57202903-57202925 CCCGCTCCCCTCCCCAAACACAG 0: 2
1: 0
2: 4
3: 124
4: 854
Right 1097187357 12:57202921-57202943 CACAGTCTGTTCTGAGGGCAAGG 0: 1
1: 0
2: 2
3: 28
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097187347 Original CRISPR CTGTGTTTGGGGAGGGGAGC GGG (reversed) Intronic
900001403 1:16826-16848 CTGGGTTCTGGGATGGGAGCTGG - Intergenic
900021123 1:187348-187370 CTGGGTTCTGGGATGGGAGCTGG - Intergenic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900204614 1:1426722-1426744 GTGTGTTTGGGGAGGGGCTGGGG - Intronic
900251789 1:1674759-1674781 CTGCCTTTGGGGACGGGAGGAGG - Intronic
900262197 1:1737615-1737637 CTGCCTTTGGGGACGGGAGGAGG - Intronic
900341484 1:2191379-2191401 CTGCGTGTGGGCAGGGGAGCAGG + Intronic
900379579 1:2377232-2377254 CTGTGTTTTGGGTGTGGACCTGG - Intronic
900387476 1:2417144-2417166 CTGGGATTGGGGAGGGGTGCTGG + Intergenic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
900981393 1:6048084-6048106 CTGAGTTTGGGGATGTGAGTGGG - Intronic
901008981 1:6187908-6187930 CTGTGTGTTGGGTGGTGAGCAGG - Intronic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901029873 1:6300817-6300839 CTGTGTTTGTGGAGAGGGACCGG - Intronic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901436532 1:9250368-9250390 GTGTGTGTGGGGTGGGGAGTGGG - Intronic
901436569 1:9250482-9250504 GTGTGTGTGGGGTGGGGAGTGGG - Intronic
901526745 1:9827879-9827901 GGGTGTTTGTGGAGCGGAGCCGG + Intergenic
901792413 1:11661334-11661356 CTGGGCTTGGGAAGGGGAGGTGG + Exonic
902717671 1:18283577-18283599 CTGTGTAGGGGGAGGGGCACAGG - Intronic
902816039 1:18917322-18917344 CACAGTTTGGGGAGAGGAGCAGG + Intronic
902973512 1:20072148-20072170 GTGTGTTTGGGGATGGGGACGGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903344789 1:22677251-22677273 CTGTGTTTGCCGTGGGGATCTGG - Intergenic
903387328 1:22936025-22936047 TTGTGGTTGGAGAGGGGAGCGGG - Intergenic
903663262 1:24991516-24991538 CTTAGTTTGGGCAGGTGAGCAGG + Intergenic
903814897 1:26057773-26057795 CTCAGTTTGGGGTGGGGAGCAGG - Intronic
903832266 1:26182462-26182484 CTGCACTGGGGGAGGGGAGCGGG - Exonic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904392380 1:30194628-30194650 GTGTGTCTGGGGTGGGGAGGGGG + Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
904466999 1:30714204-30714226 CTGGGGCTGGGGAGGGGCGCAGG - Intronic
904532946 1:31181336-31181358 CTGTTTTTGGACAGGGGGGCAGG + Exonic
904941227 1:34165902-34165924 TTGTGTGTGGGGTGGGGAGGGGG + Intergenic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905147901 1:35902295-35902317 CTGTTTTTGGGGTGCGAAGCAGG - Exonic
905301485 1:36989100-36989122 GTGTCTATGGGGAGGGGAGTGGG - Intronic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
906057086 1:42925697-42925719 GTGTGTGTGGGGAGGGGTGCAGG + Exonic
906078315 1:43068133-43068155 CTGCGACTGGGGAAGGGAGCAGG + Intergenic
906508450 1:46397051-46397073 CTGTGCTTGTGTAGGGGAGATGG - Intronic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
906799513 1:48723932-48723954 CTGAGGTAGGTGAGGGGAGCTGG + Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
907105480 1:51878725-51878747 CTGGGTTGGGGGAGGGGTTCAGG - Exonic
907276914 1:53321786-53321808 CTGTGCCTGGGGAGGAGAGGAGG - Intronic
907459117 1:54594707-54594729 CTGTGCATGGGGAGGGTAGCTGG + Intronic
907459776 1:54598526-54598548 CTGCGTCTGGGGATGGGACCAGG + Intronic
907679683 1:56551534-56551556 CTTTGAGTGGGGAGGGGAGGAGG - Intronic
907705835 1:56831677-56831699 CTGTGTATGGGGGGTGGAGGCGG - Intergenic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
908229211 1:62087183-62087205 CTGTCAGTGGAGAGGGGAGCTGG + Intronic
909261728 1:73498686-73498708 CTGATTTTAGGGAGGGGAGGCGG - Intergenic
909674326 1:78222144-78222166 AGGTGGTTGGGGAGGGGAGTTGG + Intergenic
910337997 1:86155647-86155669 CGGGGACTGGGGAGGGGAGCAGG - Intronic
910444049 1:87282714-87282736 AAGAGTTGGGGGAGGGGAGCTGG - Intergenic
911185027 1:94894595-94894617 CTGTTTTTGGGAAAGGGAGATGG - Intronic
912137479 1:106679661-106679683 CTGTGTTTGGGGAAAGGATTTGG - Intergenic
912154306 1:106898512-106898534 ATGTGTATGGGGAGGGGTGTTGG - Intergenic
912203082 1:107480465-107480487 CTTCGTTTGTGGAGGGGAGGGGG + Intronic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
912442894 1:109712482-109712504 GTGTGTTTGGGGGTGGGGGCGGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912764463 1:112396219-112396241 CTGTGGATGGGGAGTGGAGGCGG + Exonic
913973147 1:143431922-143431944 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914067531 1:144257529-144257551 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
914111622 1:144708825-144708847 CTGTCTCTGGGGAGAGGAGCAGG + Intergenic
914244592 1:145876309-145876331 AGGTGTGAGGGGAGGGGAGCCGG - Intronic
914983683 1:152438765-152438787 GTGTGTTTGGGGAGAGGTGGAGG + Intergenic
915214445 1:154330485-154330507 CTCTGTTTGGAGAGGGGAATGGG + Intronic
915449761 1:155996437-155996459 TTGAGATGGGGGAGGGGAGCTGG + Intronic
915528455 1:156490148-156490170 CTGTGTGTGGGATGGGGAGAGGG - Intronic
916443346 1:164848830-164848852 CTGTGTGTGCTCAGGGGAGCAGG + Exonic
917316551 1:173731714-173731736 TTGTGTTGGGGGAGGGGGGAGGG + Intronic
918309059 1:183272563-183272585 ATGTGTTTGGGGTGGGGATGGGG + Intronic
918315047 1:183316434-183316456 ATGTGTATGGGGAGGTGAGGGGG - Intronic
918855334 1:189747465-189747487 CTGTTGTTGGGGAGGGGAGGGGG + Intergenic
919061240 1:192635549-192635571 GTGTGTGTGGGGAGGGGTGGGGG - Intergenic
919855222 1:201701256-201701278 CTGTTGTGGGGGTGGGGAGCTGG + Intronic
920176887 1:204107644-204107666 CTGTGCTTGGGGAGGGGGAGAGG + Intronic
920324059 1:205147702-205147724 CTGTGTTTGATGAGGAGTGCTGG - Exonic
920442018 1:205987133-205987155 CTGAGGTTGGGGTGGGGAGGAGG - Intronic
921131567 1:212224320-212224342 GTGTGGCTGGGGAGGTGAGCAGG + Intergenic
921584274 1:216929472-216929494 GTGCGTGTGTGGAGGGGAGCTGG + Intronic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
922378553 1:224996592-224996614 CTGAGTTAGGGTAGGGAAGCTGG + Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
922934017 1:229410179-229410201 GGGTGTTGGGGGAGGGGTGCAGG - Intergenic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
923792758 1:237126406-237126428 CTGGGCATGGTGAGGGGAGCTGG + Intronic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1063002678 10:1939530-1939552 CTGGGGTTGGGGAGGAGAGCAGG - Intergenic
1063501901 10:6563055-6563077 TTTTGTTGGGGGAGGGGAGGTGG - Intronic
1063624290 10:7675023-7675045 TTGTGTGTGGGGGGGGGGGCGGG - Intergenic
1063643895 10:7859381-7859403 CTGAGTTTCAGGAGGGCAGCGGG + Intronic
1063665392 10:8057757-8057779 CTGTATTTGGTGCTGGGAGCTGG + Intronic
1065225843 10:23543086-23543108 TTGTCTTTGGAGAGGGGACCTGG - Intergenic
1065500983 10:26382096-26382118 CAGTGTTGGGGGAAGGGACCTGG + Intergenic
1066129631 10:32380081-32380103 GTGTGTGTGGGGAGGGGAAGAGG - Intergenic
1066479850 10:35785387-35785409 CTGTTTTTGGAGAAGGCAGCAGG - Intergenic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067228333 10:44389717-44389739 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1067511537 10:46898904-46898926 GTGTGTGTGGGAAGGGGAGGTGG + Intergenic
1067616978 10:47763783-47763805 GTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1067785667 10:49244150-49244172 ATGTGTGTGGGGGTGGGAGCGGG + Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1067969935 10:50958380-50958402 TTTTGTTGGGGGGGGGGAGCGGG + Intergenic
1068300736 10:55135431-55135453 TTGTGTTTAGGGAGTGGAGCTGG - Intronic
1069319167 10:67146089-67146111 GTGTGTGTGTGGAGGGGTGCTGG - Intronic
1069461853 10:68603025-68603047 CTGTGTTTGGGAGGGAGAGTGGG + Intronic
1069627558 10:69877529-69877551 CTGAGGTTGGGGTGGGGATCGGG - Intronic
1069686934 10:70324504-70324526 CTGTGGTTGGCCAGGGGAGAAGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069778709 10:70941682-70941704 CTGTGTGAGGGGTGGGGAGGAGG + Intergenic
1069913930 10:71775655-71775677 CTGGGCTTGGGGAGGGAAGGTGG - Intronic
1072892019 10:99331914-99331936 TTGAGTTTGGGGAGGAGAGTTGG - Intronic
1073345081 10:102776836-102776858 CTGTGTTGGGGGTGGGGTGAGGG + Intronic
1073381248 10:103079525-103079547 CTGAGTCTGGGGAGAGGAGAGGG + Exonic
1074122080 10:110500085-110500107 CTGTCTCTGGGGAGTGGAACTGG - Intronic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074768540 10:116718303-116718325 CTGTCCCTGGGGAGGGGAGAGGG + Intronic
1074777825 10:116779271-116779293 TTGTGTTTGGGGTGGGCACCCGG - Intergenic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1075690957 10:124393849-124393871 ATGTGTTGGGGGTGGGGAGGGGG + Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1076572133 10:131439807-131439829 CTGTGTCTGGGTTGGGGAGGAGG + Intergenic
1076620259 10:131782696-131782718 CTGTATTGGGGGTGGGGAACAGG + Intergenic
1077041680 11:527420-527442 CAGGGGCTGGGGAGGGGAGCTGG - Intergenic
1077063114 11:626367-626389 CTGCATTTGGGGTGGGGGGCAGG - Intergenic
1077240832 11:1509634-1509656 CTTTTTTTGGGGAGGGGTGATGG - Intergenic
1077274103 11:1695376-1695398 CTGTGTGTGGGGTGGGGCACTGG + Intergenic
1077329277 11:1976838-1976860 CTGTGCTGGGGGTGGAGAGCAGG + Intronic
1077789762 11:5425521-5425543 GTGTGTGTGGCGAGGGGAGGAGG + Intronic
1078142629 11:8703072-8703094 CTTTGTCTGGGGAGGTGGGCAGG - Intronic
1078374748 11:10784443-10784465 CTGCGTTTGTGAAGGGGACCTGG - Intergenic
1079026230 11:16950072-16950094 GTGTGTGTGGGGCGGGGGGCGGG + Intronic
1079126806 11:17723112-17723134 GTGTGTTGGGGGTGGGGAGGTGG - Intergenic
1079812539 11:25013218-25013240 GTGAGTTGGGGGAGGGGAGGAGG + Intronic
1080426862 11:32162951-32162973 GGGTGGTTGGGGAGGGGCGCTGG + Intergenic
1081287126 11:41284615-41284637 CTGTCTGTGGGGAGGGCTGCTGG - Intronic
1081707956 11:45196701-45196723 CTGTGTGTGGTCAGGGTAGCGGG + Intronic
1082071601 11:47943949-47943971 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1082126268 11:48434736-48434758 CTGTGTTGTGGGTGGGGAGGGGG - Intergenic
1082559854 11:54605564-54605586 CTGTGTTGTGGGTGGGGAGGGGG - Intergenic
1082874364 11:57972825-57972847 CTGTGTATGCTGAGGGGAGTGGG + Intergenic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1083721968 11:64607719-64607741 CTGAGGTTGGGCCGGGGAGCGGG + Exonic
1083731180 11:64653550-64653572 TTGAGTGTGGGGAGGGGTGCAGG - Intronic
1083842978 11:65315211-65315233 CTGGGTCTCGGGAGGGGGGCGGG - Intronic
1084415230 11:69028345-69028367 CTGAGTTTGGAGAGGAAAGCAGG - Intergenic
1084587895 11:70073843-70073865 CTGTCTTGGGGGTGGGGGGCGGG - Intergenic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1085214880 11:74820615-74820637 GTGTGTTTGGGGAGGGATTCAGG + Intronic
1085386696 11:76161827-76161849 CTGTGGTGGGGGTGGGGAGTGGG - Intergenic
1085784105 11:79436840-79436862 CTGTGGTGGGGGAAGGGATCAGG - Intronic
1085832505 11:79916473-79916495 CTGGGTTTGGAGAGGGCAGTTGG + Intergenic
1085991742 11:81856177-81856199 CTGTGTGTGGGAATGGGAACAGG - Intergenic
1086064535 11:82732475-82732497 CGGGGTTTGGGAAGGGGCGCCGG - Exonic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087065734 11:94026448-94026470 CTGAGGTAGGGGAGGGGAGCAGG - Intronic
1088919771 11:114252370-114252392 TGGTCTTTGGGGAGGGGGGCGGG + Intergenic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1089402870 11:118174672-118174694 GAGTGTTTGGGGTGGGGAGATGG - Intronic
1089432771 11:118436904-118436926 CCGTGTTTGGGGAGAGCGGCGGG + Exonic
1089478903 11:118790247-118790269 GTGTGTTTGGGGCGTGGGGCGGG - Intronic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1089915199 11:122147940-122147962 CTTTTTTTGGGGGGCGGAGCGGG + Intergenic
1090086153 11:123653086-123653108 TGGTGTTAGGGGAGGAGAGCTGG - Intronic
1090359107 11:126160433-126160455 CTGTGTTTGTGCAGGGGTGGAGG + Intergenic
1090408055 11:126489179-126489201 CTGCGTTTGCGGTGGAGAGCCGG + Intronic
1090612083 11:128480286-128480308 TTGTGGTTGGGCAGGGCAGCCGG + Exonic
1090634802 11:128684256-128684278 CTGGGTGTGGGGGGGGGGGCAGG - Intergenic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091037516 11:132247004-132247026 CCAGGTTTGGGGAGGGGAGGAGG - Intronic
1091196717 11:133737825-133737847 CTGTTGTGGGGTAGGGGAGCGGG + Intergenic
1091298865 11:134492428-134492450 CTGTTGTGGGGTAGGGGAGCAGG - Intergenic
1091335971 11:134766031-134766053 GTGTGTTTGGTGAGGCGAGGAGG - Intergenic
1202812256 11_KI270721v1_random:32017-32039 CTGTGCTGGGGGTGGAGAGCAGG + Intergenic
1091428029 12:408528-408550 CTGCTTTTGGAGAGGGGAGTGGG + Intronic
1091461449 12:646459-646481 CTAGGGTTGGGAAGGGGAGCAGG - Intronic
1091875314 12:3928929-3928951 CTGTATATGGGGAGGTGGGCAGG - Intergenic
1091973841 12:4809838-4809860 CTGGGTCTGGGGAGGTGACCTGG - Exonic
1092046630 12:5435536-5435558 TTGTGTATTGGGAAGGGAGCTGG + Intronic
1092065867 12:5589296-5589318 CTGGGATGGGGGAGGGGAGGAGG + Intronic
1092126724 12:6079897-6079919 CAGTGTGTGAGGTGGGGAGCAGG - Intronic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1093149190 12:15601770-15601792 CTGTGTTGGGGTAGAGGAGAGGG - Intergenic
1093235570 12:16605446-16605468 CTGTGTTTGGGCATGGGGGCGGG - Intronic
1093903471 12:24662307-24662329 CTGTTTTTGAGGAGTGGAGGTGG - Intergenic
1094039794 12:26110658-26110680 GAGAGTTTGGGGAGGGGAGGGGG + Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094232890 12:28128271-28128293 CTGTGTTTGGGGAGTAGTGGGGG - Intergenic
1094286442 12:28799371-28799393 ATGTGTCTTGGGAGTGGAGCGGG + Intergenic
1095986548 12:48003288-48003310 GTGTGTCAGGGAAGGGGAGCAGG - Intronic
1096170476 12:49464889-49464911 CTGTGGCTGGGGTAGGGAGCAGG - Intronic
1096197129 12:49655917-49655939 CTGTTATTGGTGAGGGGAGAAGG - Intronic
1096255147 12:50058015-50058037 CGGTGGCTGGGGAGGGGGGCGGG + Intronic
1096838994 12:54369779-54369801 CTCCGTAGGGGGAGGGGAGCAGG - Exonic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097231165 12:57512124-57512146 CTGTGCATGGGGAGGGTAGGCGG + Intronic
1097272261 12:57783284-57783306 GTGTGTGTGTGGAGGGGTGCAGG + Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097920621 12:65068474-65068496 CTGTGTTGGAGGAGTGGAGAGGG + Intronic
1097941171 12:65307452-65307474 CTTTTTTTGGGGCGGGAAGCAGG + Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098434784 12:70457123-70457145 GTGTGTTTGGGGGTGGGAGTAGG + Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1099730060 12:86489275-86489297 CTCTCAGTGGGGAGGGGAGCTGG - Intronic
1100239274 12:92694553-92694575 CTGTGTTGGGGGAAGGGAAAAGG + Intergenic
1100900209 12:99231204-99231226 CTGTGTTTTGGGAGGGCTGTGGG + Intronic
1101373417 12:104150927-104150949 TGGTGGTTGGGGAGGGGAGTTGG - Intergenic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1101998827 12:109544150-109544172 CTGTGTCTGGGAAGGGCTGCAGG - Intergenic
1102753149 12:115313808-115313830 CAGTGAGTGGGGATGGGAGCTGG - Intergenic
1102821052 12:115909533-115909555 TTGTGTTTGGGGTTGGGAGGGGG + Intergenic
1103130107 12:118460697-118460719 CAGTGTTTGGTGAGGGCTGCTGG - Intergenic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103346218 12:120252103-120252125 CTGGGTTTGGGGTGGGGAGGTGG - Intronic
1103613540 12:122138317-122138339 CTGTGGCAGGGCAGGGGAGCTGG + Intronic
1103739380 12:123081154-123081176 CAGTGTCTGGGCAGGGGAGCAGG + Intronic
1103747138 12:123132674-123132696 CAGGGGTTGGGGAGGGGAGATGG - Intronic
1104676851 12:130716979-130717001 CTTGGGGTGGGGAGGGGAGCCGG - Intergenic
1104906987 12:132218837-132218859 CAGTGTTTGGTGAGGTGAGTGGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1104958543 12:132477426-132477448 CTGTGGTGGGGGAGGGGTGGGGG - Intergenic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105502809 13:20988029-20988051 CTGTTTTTGCGGACGGGAACGGG + Exonic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1106395089 13:29371973-29371995 GTGTGTGTGGGGGGGGGGGCGGG - Intronic
1107348561 13:39489551-39489573 CTTTTTTTTTGGAGGGGAGCGGG + Intronic
1109370837 13:61417104-61417126 GTGTGTGTGGGGTGGGGAGGAGG - Intronic
1109809639 13:67495271-67495293 CCTTGTTTGGGGCAGGGAGCAGG - Intergenic
1110366443 13:74691587-74691609 CTGTGTGTGGGAAGGGGATGTGG + Intergenic
1110597131 13:77331504-77331526 AGGAGTTTGGGGAGGGGAGATGG - Intergenic
1111587311 13:90298724-90298746 CTGAGTTTGGGGAAGTGAGGAGG + Intergenic
1112319244 13:98392110-98392132 CTGCCTCTGGGGAGGGGAGAAGG - Intronic
1112481348 13:99778629-99778651 CCGTGCTTGGGAAGGTGAGCTGG - Intronic
1113124275 13:106958997-106959019 TTGTGTTTGGGAAGGGAAGAAGG + Intergenic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1113465282 13:110508237-110508259 GTGTGGTTGGGGAGGGGAACTGG - Intronic
1113665618 13:112139992-112140014 ATTTGTTGGGGGAGGGGAGTGGG - Intergenic
1113692679 13:112322781-112322803 CTGTGCTGGGGGTGGGCAGCAGG + Intergenic
1113957097 13:114104882-114104904 ACGTGTGTGGGGAGGGGAGTGGG - Intronic
1113957105 13:114104908-114104930 ACGTGTGTGGGGAGGGGAGGGGG - Intronic
1114472714 14:22974776-22974798 CTGCCTTTGGGGAGGGGATAGGG - Intronic
1114490229 14:23095759-23095781 CTTTTTTTGGGGAGGGGCGGGGG + Intronic
1114562318 14:23602329-23602351 CTCTGTCAGGGGAGGGGTGCCGG - Intergenic
1114719981 14:24871239-24871261 CTTTGATTGGGAATGGGAGCTGG - Intronic
1114996863 14:28365105-28365127 CTGTGATAGGGGAGTGGGGCAGG + Intergenic
1115474357 14:33799713-33799735 CTCTGTGTGGGGCGGGGGGCCGG - Exonic
1115766160 14:36625540-36625562 CTCTGTTTGGAGAAGGAAGCCGG - Intergenic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1117460405 14:55939447-55939469 CTGTGTCGGGGGAGGAGGGCAGG + Intergenic
1118379777 14:65208172-65208194 GTGGGTTGGGGGTGGGGAGCCGG + Intergenic
1118418550 14:65573217-65573239 CTTTGTTGTGGGTGGGGAGCAGG - Intronic
1118727358 14:68638582-68638604 GGGTGATGGGGGAGGGGAGCTGG + Intronic
1118880156 14:69818948-69818970 CGGTGTTTGGGGAGGCGGGGAGG + Intergenic
1119265348 14:73260838-73260860 CTGGCCTGGGGGAGGGGAGCAGG + Intronic
1119562675 14:75603468-75603490 CTGTCAGTGGGAAGGGGAGCTGG - Intronic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1120939537 14:89934057-89934079 ATGAGGTTGGGGAGGGCAGCAGG + Intronic
1121288821 14:92757871-92757893 CAGTGTCTGGGGAGGGGAACTGG - Intergenic
1121445126 14:93973873-93973895 CTGTGCTAGGGCAGGGGTGCTGG - Intronic
1121595210 14:95157181-95157203 TTGTGTCCGGGGCGGGGAGCGGG - Intronic
1121777940 14:96603059-96603081 GAGTGTCTGGGGAGGGGAGAGGG + Intergenic
1121885388 14:97538294-97538316 CTGTGTGAGGGGAGAGGAGTAGG + Intergenic
1122297150 14:100712086-100712108 CTGGGTTGTGGGAGGGGAGCAGG + Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122309176 14:100783733-100783755 GTGTGGTTGAGGAGGGGAGCTGG + Intergenic
1122424557 14:101598305-101598327 CTGTGTTTCGGCCGGGGAGGGGG + Intergenic
1123981556 15:25609322-25609344 CTCTGTTTGGGGAGAGGAAAAGG - Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1124425481 15:29559294-29559316 CTGTGTGAGGTGAGGGGAACAGG - Intronic
1124606399 15:31172899-31172921 CTTTGTTTGGGCATGGGTGCTGG - Intergenic
1124956328 15:34362903-34362925 CTGGGTTGGGGAAGGGGAGTGGG - Intronic
1125149968 15:36520333-36520355 GTTTGTTTGGGTAGGGGAGGTGG - Intergenic
1125622173 15:41073266-41073288 CTGTGTGTAGGGGGTGGAGCTGG - Intronic
1125740029 15:41956044-41956066 CTGTGTGTGCTGCGGGGAGCTGG - Intronic
1126002791 15:44227372-44227394 CTGTCGGTGGGGTGGGGAGCTGG + Intergenic
1126078604 15:44937241-44937263 TTGTCTCTTGGGAGGGGAGCTGG - Intergenic
1126079244 15:44943084-44943106 TTGTCTCTTGGGAGGGGAGCTGG + Intergenic
1126786102 15:52179237-52179259 CTATCCTTGGGGCGGGGAGCTGG - Intronic
1127465008 15:59235299-59235321 TTGTCTTGAGGGAGGGGAGCTGG - Intronic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128157900 15:65403357-65403379 TTGTCTCTGGGGAGGGGACCTGG + Intronic
1128370730 15:67037200-67037222 CTGGGTTAGGTGAGGGGAGGGGG + Intergenic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1129604222 15:77016964-77016986 ATGTGTGTGGTCAGGGGAGCTGG + Intronic
1129726043 15:77902260-77902282 CTGTGTTTGTGGTGAGGACCGGG - Intergenic
1129731265 15:77934036-77934058 CTATGTTTGGGGAGGTGACTGGG + Intergenic
1129825706 15:78633873-78633895 CAGTGCTGGGGCAGGGGAGCAGG + Intronic
1129833772 15:78688616-78688638 TTGTCTCTTGGGAGGGGAGCTGG - Intronic
1129951876 15:79599302-79599324 CTTTTTTTGGGGAGGGGGGCAGG - Intergenic
1129974622 15:79811929-79811951 GTTTGTTTGGGGTGGGGAGTCGG + Intergenic
1130346274 15:83048608-83048630 CTGTGTTTGGATAGTGGAGAGGG - Intronic
1131700338 15:94928619-94928641 ATGTGTGTTGGGAGGGGAGTTGG + Intergenic
1132025566 15:98401873-98401895 CTGTGCTTGGGGAGGTGGCCAGG - Intergenic
1132147730 15:99438346-99438368 CTGTTTTGGGGGTGGGGAGAGGG + Intergenic
1132452105 15:101974112-101974134 CTGGGTTCTGGGATGGGAGCTGG + Intergenic
1132454788 16:16509-16531 CTGGGTTCTGGGATGGGAGCTGG - Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132746645 16:1438975-1438997 CTGCGTCTGGGAAGGGGGGCAGG + Intronic
1133281980 16:4671760-4671782 CTGTCTCTGGGGAGGCGGGCAGG - Intronic
1133302063 16:4788342-4788364 GTGTGATGGGGGAGGGGAGAGGG + Exonic
1133335693 16:5005387-5005409 CTGGGTTGGGGGAGGGGAGATGG + Intronic
1133373552 16:5264671-5264693 CTGTGATGGGGGAGGGGATGTGG + Intergenic
1133382462 16:5342644-5342666 CTGTGCTGGGGTAGGAGAGCTGG + Intergenic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1134136139 16:11677527-11677549 CTGTGCTTGCGGCAGGGAGCCGG + Exonic
1134182761 16:12061102-12061124 CAGGGCTTGAGGAGGGGAGCTGG - Intronic
1135849154 16:25946958-25946980 ATGTGGTTGGGGAGCTGAGCAGG + Intronic
1135869972 16:26140697-26140719 CTGTCTTTGGGTAGGGGAGAAGG - Intergenic
1136036494 16:27544458-27544480 CTGGGCTGGGGGAGGGGAGGAGG + Intronic
1136073807 16:27804839-27804861 CTGGGATTGGGGACGGGAGAGGG + Intronic
1136186541 16:28591819-28591841 CCCTGTTTGGAGAGGGGAGAGGG - Intergenic
1136281183 16:29212356-29212378 TTGAGAGTGGGGAGGGGAGCTGG + Intergenic
1136330842 16:29575417-29575439 GTGTGTATGGGGAGGGCAGGTGG - Intergenic
1136445477 16:30315145-30315167 GTGTGTATGGGGAGGGGAGGTGG - Intergenic
1136540122 16:30924088-30924110 CGGGGTGGGGGGAGGGGAGCTGG + Intronic
1137415953 16:48279652-48279674 CTGGGGTGGGGGAGGGGATCTGG + Intronic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1137615424 16:49843655-49843677 CTCTCCTTGGGGAGGGGAGGGGG - Intronic
1137932770 16:52604340-52604362 CTCCATTTGGGGAGGGGAACAGG - Intergenic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138618078 16:58188027-58188049 CTGTGTGTGGGGTGGGGAAGGGG + Intronic
1139038758 16:62979157-62979179 TTGTGTTTAGGGAGTGGAGTAGG - Intergenic
1139354325 16:66358328-66358350 TTGGATGTGGGGAGGGGAGCTGG + Intergenic
1139532245 16:67548097-67548119 CAGTATTTGGGGTGGTGAGCTGG + Intergenic
1140324815 16:73991374-73991396 ATGGGTATGGGAAGGGGAGCAGG + Intergenic
1141518982 16:84564974-84564996 CTGTGGCTTGTGAGGGGAGCGGG - Intergenic
1141524775 16:84604245-84604267 GTGAGTGTGGGGTGGGGAGCAGG - Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141869199 16:86773092-86773114 CTGCGTTTTGGGAGAGGAGCAGG + Intergenic
1142085546 16:88178279-88178301 TTGAGAGTGGGGAGGGGAGCTGG + Intergenic
1142194569 16:88733478-88733500 CTGGGCTTGGGGAGGGCAGTGGG + Intronic
1142194579 16:88733510-88733532 CTGGGCTTGGGGAGGCCAGCTGG + Intronic
1142373159 16:89694120-89694142 CTGGGCTGGGGGAGAGGAGCCGG + Intronic
1142614112 17:1125138-1125160 CTGGGTTTGGGGAGGGGTGACGG - Intronic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1143478849 17:7217463-7217485 CTGGGGTGGGGGAGGGGAACTGG + Intronic
1143557831 17:7673571-7673593 CTTTGGCTGGGGAGAGGAGCTGG + Exonic
1143680228 17:8470755-8470777 CTGTGCCTTGGGAGAGGAGCAGG + Intronic
1143712893 17:8746006-8746028 CTCTGTCTGGGAGGGGGAGCGGG + Intergenic
1143777152 17:9206844-9206866 CCGTGCCTGGGGAGGAGAGCAGG - Intronic
1144834183 17:18148344-18148366 CTGTGTGTGGGGGTGGGACCTGG + Intronic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1146131294 17:30278666-30278688 CTTTTTTTGTGGGGGGGAGCGGG + Intronic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146789331 17:35742684-35742706 CTTTCTTTGGCCAGGGGAGCAGG - Exonic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1147156529 17:38546970-38546992 CTGTGCTTGGGGAGGAGGGGAGG - Intronic
1147256418 17:39184859-39184881 CTCTGTCTGGGGGGGGAAGCAGG + Exonic
1147258732 17:39196815-39196837 GGGTGTGGGGGGAGGGGAGCAGG + Intronic
1147444468 17:40466518-40466540 CTGGCTTTTGGGAGGGGAGGTGG + Intergenic
1148022309 17:44561522-44561544 TTATGTTGGGGGAGGGGAACTGG + Intergenic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1148244758 17:46023460-46023482 CTGTCTCTGGGGAGGGTACCTGG + Intronic
1148323208 17:46769754-46769776 AAGGGTTTGGGGAGGGTAGCCGG + Intronic
1148692177 17:49535384-49535406 CTTTTTTTGGGGGGGGGGGCGGG + Intergenic
1148756868 17:49977727-49977749 CTGAGGTGGGGGTGGGGAGCTGG + Intergenic
1148829769 17:50424128-50424150 CTGTGGATGGGGAGGAGGGCTGG - Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149430456 17:56593157-56593179 CGGTGTTTGGGGAGGGGGGGCGG - Intergenic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1150198296 17:63325053-63325075 CTTTGTGTGGGGTGGGGGGCGGG + Intronic
1150433788 17:65139076-65139098 CTGGGGTGGAGGAGGGGAGCTGG - Intronic
1150505155 17:65691160-65691182 AGGTGTTGGGGGAGAGGAGCCGG + Intronic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151550403 17:74819439-74819461 CTGTGTTTGCTGAAGAGAGCAGG + Intronic
1151575251 17:74949883-74949905 AGGTGTGTGGGGAGAGGAGCTGG - Exonic
1151958644 17:77393273-77393295 CTGGGGTTGGGTAAGGGAGCTGG + Intronic
1151965278 17:77427937-77427959 CTGGGCCTGGGGAGGGGCGCTGG - Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152130381 17:78472631-78472653 TGGGGTGTGGGGAGGGGAGCTGG + Intronic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1152497224 17:80682108-80682130 CTTTGTTTGGGGTGGGGGGGGGG - Intronic
1152616066 17:81338450-81338472 CTGTGTGTGGGTTGGGGAGGGGG + Intergenic
1153225387 18:2895830-2895852 GTATGTTTGGGGAGGGAAGGGGG + Intronic
1153457678 18:5296956-5296978 CTGTGTCTGGCGTCGGGAGCTGG + Intronic
1154370905 18:13762321-13762343 TTGTGTTCAGGGAGAGGAGCTGG + Exonic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1154961148 18:21309897-21309919 GTGTGTGTGGGGAGGGGATGGGG - Intronic
1155075578 18:22351195-22351217 GTGTGTTGGGGGAAGGGAGATGG + Intergenic
1155381845 18:25231320-25231342 CTGTGTTGGAGGAGGACAGCTGG + Intronic
1155861711 18:30909584-30909606 CTGTTGTGGGGGAGGGGAGAGGG + Intergenic
1155964094 18:32019596-32019618 CTGTGTTGGGAAAGGGTAGCAGG - Intronic
1155971110 18:32084563-32084585 GTGTGTTTGGGCAAGGGAGAAGG + Intergenic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1156478658 18:37422403-37422425 GTGTGCTGGGGGAGGGGAGCTGG - Intronic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1156911638 18:42417541-42417563 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158395334 18:57075090-57075112 CTGTTGTTGGGGTGGGGGGCTGG + Intergenic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1158617313 18:59000239-59000261 TTGTGTTTGGGGATTGGAGGTGG - Intergenic
1158622808 18:59047424-59047446 CAGTGTCTGGGCAGGAGAGCAGG + Intergenic
1158819728 18:61145599-61145621 CTGTGGTAGGGGGGGGGAGGGGG + Intergenic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1159117997 18:64136973-64136995 ATGGATTTGGGGAGGGGTGCAGG - Intergenic
1159275842 18:66220410-66220432 CTGTTTTAGGGGAGGAGAGTGGG + Intergenic
1159927472 18:74281953-74281975 CTGTGAGTGGGAAGGGGAACAGG + Intronic
1160626443 18:80210890-80210912 GTGTGTTTGGGGATGGGGGGTGG - Intronic
1160798671 19:957106-957128 CTGTGGGTGGGGGGGGGCGCTGG + Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1161208172 19:3053173-3053195 CTTTATTTGGGAAGGGGAGGGGG + Exonic
1161236447 19:3200763-3200785 CTGGGGCTGGGGAGGGGACCAGG - Intronic
1161352849 19:3803481-3803503 CAGTGTTTGGGACGGGGGGCAGG - Intergenic
1161489108 19:4552187-4552209 CTGCCTTTGGGGAGAGGAGCAGG - Intronic
1161650833 19:5483693-5483715 CAGTGTTTAGGGAGGTGAGGCGG + Intergenic
1161652729 19:5495258-5495280 CGGTGTCTGGGGCCGGGAGCAGG + Intergenic
1161926154 19:7301679-7301701 CTGGGGCTGGGGAGGGGAGGTGG - Intergenic
1162392920 19:10400314-10400336 CTGTCTCTGGGCAGGAGAGCCGG + Intronic
1162566742 19:11448819-11448841 CTGTGTGTGGGGACTGGAGGAGG + Intronic
1162788840 19:13052777-13052799 CTGTGTGTGTGGACGGGTGCAGG - Intronic
1162967748 19:14164086-14164108 CTGGGTGGGGGGTGGGGAGCAGG - Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163188604 19:15658821-15658843 CTGTGTTTGAGGCGGGGACGGGG + Intronic
1163263214 19:16203796-16203818 ATGGGTGTGGGGAGAGGAGCAGG + Intronic
1163519220 19:17781857-17781879 CTGTGTTGGGGGAGTCCAGCAGG + Intronic
1163783618 19:19263078-19263100 CTGTGCTTTGGCAGGGGACCTGG + Intergenic
1163884017 19:19950166-19950188 CTGTTGTTGGAGAGAGGAGCTGG - Intergenic
1164785122 19:30924381-30924403 GTGTGTTTGGGGTGGGGAGGAGG + Intergenic
1165344241 19:35233813-35233835 TTGTGTGTGGGGAGGGTAGGGGG + Intergenic
1165354532 19:35295534-35295556 ATGTGGTTGGGGATGGGAGCCGG + Intronic
1165749903 19:38253305-38253327 CTGGGATTCGGGAGAGGAGCTGG + Intronic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166006013 19:39907179-39907201 TGGAGTTTGGGGAGGGGAGCAGG - Intronic
1166133991 19:40764225-40764247 CAGTGTTTGTGGTGGGGAGTTGG + Intronic
1166257244 19:41615297-41615319 CTGTGTCTGGGAGGGGGAGCTGG + Intronic
1166762806 19:45235343-45235365 CTGTGACTGAGGAGGGGATCTGG + Intronic
1166874216 19:45887207-45887229 CTGTCTTTGGGGAAGGGCGGAGG + Intergenic
1166999345 19:46736796-46736818 GTGTGCTCGGGGAGGGGGGCTGG - Intronic
1167078830 19:47265465-47265487 CTGTGTGAGGGGTGGGGACCTGG + Intronic
1167859317 19:52270124-52270146 CTGTGTTGGGGGAGGTGGCCGGG + Intronic
1168065207 19:53915348-53915370 CTGTCTCTGGGGAGGGGATGGGG - Exonic
1168115424 19:54219563-54219585 CTGGGGCAGGGGAGGGGAGCAGG - Intronic
1168121253 19:54253785-54253807 CTGGGGCAGGGGAGGGGAGCAGG - Intronic
1168122632 19:54260748-54260770 GTGTGCTTGGGGAAGGGAGAAGG - Intronic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
1168181136 19:54663750-54663772 GTGGGTTTGGGGAGGGGCCCTGG - Exonic
1168181551 19:54665464-54665486 CTGGGGCAGGGGAGGGGAGCAGG + Intronic
1168187327 19:54708598-54708620 CTGGGTTTGGGGAGGGTCCCTGG - Intergenic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
1168555709 19:57338207-57338229 CTGTCTTTGGAGAGGGCTGCAGG + Intergenic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
925551067 2:5074985-5075007 TGGTGTGTGGGGTGGGGAGCTGG - Intergenic
925814633 2:7735669-7735691 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925814719 2:7736463-7736485 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925903773 2:8527082-8527104 CTGCCTTGGGGGTGGGGAGCAGG - Intergenic
926094869 2:10074530-10074552 TTGTCTCTGGAGAGGGGAGCTGG + Intronic
926229108 2:10989520-10989542 CTGTATTTGTGGGGCGGAGCAGG + Intergenic
926348835 2:11976637-11976659 CTGGGTTGGGGGTGGGGCGCTGG + Intergenic
926685400 2:15694191-15694213 CTGAGACTGGGGTGGGGAGCGGG - Intronic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
927681976 2:25145802-25145824 ATGTGTCAGGGGAGGGGAGGGGG - Intronic
927683903 2:25157914-25157936 CTGTGTATGGGAAAGGGGGCTGG - Exonic
927949605 2:27158797-27158819 CTGGGTTTGGGAGGGAGAGCAGG + Intergenic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
930019654 2:46993872-46993894 CTGTGTTGGGGCAGGCAAGCAGG - Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931014777 2:57964093-57964115 CTGTGTTGGGGGAGAGGGGAAGG - Intronic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
931414520 2:62068233-62068255 CTGTATGTGTTGAGGGGAGCAGG + Intronic
931766743 2:65463571-65463593 CTGGGCTTGGGGATGGGAGCTGG + Intergenic
932368885 2:71171478-71171500 TTGTCTCTTGGGAGGGGAGCTGG - Intergenic
932400158 2:71474930-71474952 CTGTGATAGGGGAGGGGAAGTGG + Intronic
932460452 2:71878850-71878872 CTGTGTGTGGGGAGCACAGCTGG - Intergenic
933136636 2:78743571-78743593 CTGTGTTTGGGGAGCAGAGTTGG - Intergenic
933536751 2:83584946-83584968 CTGTGCTGGGGGTGGGGAGTAGG + Intergenic
933708069 2:85306101-85306123 TTGTCTCTGGGGAGGGGCGCGGG - Intronic
933746817 2:85577721-85577743 CTGTGTCGGGGGAGGAGAGTTGG + Intronic
933902205 2:86858166-86858188 CTGTGTTTCGGGATGCAAGCCGG - Exonic
934177843 2:89592879-89592901 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934288141 2:91667180-91667202 CTGTCTCTGGGGAGAGGAGCAGG - Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
934666224 2:96172919-96172941 CTGTCCCTGGGGAGGGGAGATGG + Intergenic
935467879 2:103420863-103420885 GTGTGTTGGGGGAGGGGATAGGG + Intergenic
935778339 2:106491102-106491124 CTGTGTTTCGGGATGCAAGCCGG + Intergenic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
936568322 2:113596588-113596610 CTGGGTTCTGGGATGGGAGCTGG + Intergenic
936652328 2:114442262-114442284 CTGGGTTAGGGGTGGGGAGAGGG + Intergenic
937469595 2:122163858-122163880 ATGTGTTTGGGTAGGATAGCAGG + Intergenic
937818232 2:126276683-126276705 GTGTGTGTTGGGATGGGAGCAGG + Intergenic
937984531 2:127632614-127632636 CAGTGGTGGGGCAGGGGAGCTGG - Intronic
938265213 2:129923381-129923403 GGGTGGTAGGGGAGGGGAGCAGG + Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
941182320 2:162274484-162274506 CTGCATCTAGGGAGGGGAGCTGG + Intronic
941771373 2:169349418-169349440 CTGTGCATGGGGAGAGGAGAAGG + Intronic
941831610 2:169967260-169967282 CTGTGTGTGGGGGGGGGCGGGGG - Intronic
942076046 2:172358081-172358103 CAGGGTTTGGGGAGGAGAGCGGG + Intergenic
942118045 2:172748558-172748580 TTGTGTTGTGGGAGGGGACCCGG - Intronic
942135097 2:172917493-172917515 GTGGGGTTGGGGAGGGGTGCAGG + Intronic
942506302 2:176645030-176645052 CTGTGGTTGGGGAGGCCAGTTGG + Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943465271 2:188221240-188221262 GTGTGTTTGGGCAGGTGAGTAGG + Intergenic
944033959 2:195270008-195270030 TTTTTTTTGGGGAGGGGAACAGG - Intergenic
944661095 2:201922622-201922644 CGGTGGTTGTGGAGGGGAGTGGG - Intergenic
944734061 2:202545208-202545230 AGGTGTGTGGGGAGGGGAGGGGG - Intronic
945032857 2:205681975-205681997 CGGTGTTTGGGGTAGCGAGCCGG - Intronic
945943789 2:215974785-215974807 CTGTGTTTAGGAACTGGAGCAGG - Intronic
946024543 2:216664136-216664158 CGGTGTTTGGAGAGGGGCGGGGG - Exonic
946025242 2:216667990-216668012 CTGAGATTGGGGAGAGGAGCGGG + Intergenic
946164618 2:217856420-217856442 CTGTCTGTGGGAAGGGAAGCTGG - Intronic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
947732186 2:232437406-232437428 GTGTGGAAGGGGAGGGGAGCTGG + Intergenic
948132971 2:235614439-235614461 ATGTATTTGGGGAGGGAAGAAGG + Intronic
948190193 2:236052308-236052330 GTGTGTTTGGGGGTGGGGGCAGG - Intronic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948776258 2:240290444-240290466 CTGTGCTTGTGGTGGGGAGGCGG - Intergenic
948779495 2:240310163-240310185 CTGTGCTTGGGGACAGGAGGGGG - Intergenic
948941921 2:241201016-241201038 CTGTGTGTGGTGAGGGGTTCTGG + Intronic
949052318 2:241903828-241903850 CTGGGCATGGGGAGGGCAGCTGG - Intergenic
1168831151 20:845908-845930 TTGTATTGGGGGAGGGGAGGAGG - Exonic
1168855592 20:1005508-1005530 CTGTATTGGGGTAGGGGAACTGG - Intergenic
1169266953 20:4172631-4172653 CGCTGTCTGGGAAGGGGAGCGGG + Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170026421 20:11893008-11893030 ATGTGTTTGGGCAGGGAAGTAGG - Intronic
1170372675 20:15666763-15666785 CTGTGGTTGTGCAGGGGTGCTGG - Intronic
1170428612 20:16258589-16258611 GTGTGTTTGGGGATGGGAAGGGG - Intergenic
1170573173 20:17643861-17643883 ATGTGTGTGGGGAGGGGCGTGGG - Intronic
1170690100 20:18606772-18606794 CTGTGGTGGGGGGGGGGAGGGGG + Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1171275841 20:23855901-23855923 TTGTGTTTGGTGAGTGGGGCAGG + Intergenic
1171473472 20:25390317-25390339 CGGTGCCTGGGGAAGGGAGCGGG + Intronic
1171525223 20:25803833-25803855 ATGTGTTCGGGGAGGGAATCAGG + Intronic
1171551604 20:26052051-26052073 ATGTGTTCGGGGAGGGAATCAGG - Intergenic
1171792727 20:29543354-29543376 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1171855743 20:30341048-30341070 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1172178682 20:32987589-32987611 CAGGGTTTGGGGACAGGAGCTGG - Intronic
1172281705 20:33712403-33712425 TGGTGTGGGGGGAGGGGAGCAGG - Intronic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1172600346 20:36178685-36178707 TTGTGTTTGGGGAGGTGGGTGGG + Intronic
1172943250 20:38668963-38668985 CTAGGTTTGGGGTGGGGAGTCGG + Intergenic
1173404430 20:42752594-42752616 CTGTGTTATGGGATGGGATCTGG - Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173672224 20:44806575-44806597 GTGGGTTTGGGGAGGGGAGAAGG - Intronic
1173723383 20:45279529-45279551 TGGTGTTTGGGGAGGAGAGGAGG - Intergenic
1174106200 20:48164101-48164123 GTGTGCTTGTGTAGGGGAGCTGG - Intergenic
1174130245 20:48339477-48339499 TTGTGTGTGTGGCGGGGAGCTGG - Intergenic
1174263492 20:49314525-49314547 TTGTCTTTAGGGAGAGGAGCTGG - Intergenic
1174463687 20:50700873-50700895 CTGAGTTTGGGGAGAGGATTAGG + Intergenic
1174520454 20:51126069-51126091 CTGTCTTTTGGAAGTGGAGCTGG + Intergenic
1174837020 20:53866167-53866189 CTGTGGCTGGGGAGGAGAGGAGG - Intergenic
1175211237 20:57357426-57357448 CTATGTTTGGGGTGGGATGCTGG + Intronic
1175247661 20:57591450-57591472 CTGAGTTTTGGCTGGGGAGCAGG + Intergenic
1175320530 20:58084703-58084725 CTGTGTGGAGGGAGGGGATCTGG - Intergenic
1175405398 20:58722747-58722769 CCTTGCTTGGGGAGGGGACCAGG + Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175901327 20:62361011-62361033 CTGGGCTGGGGGAGGGGAGATGG - Intronic
1175922672 20:62457432-62457454 CTGTGTGTGGGGAGGGTCCCCGG - Intergenic
1175938139 20:62524568-62524590 CTGTGTTGGGGGAGGGTCCCAGG + Intergenic
1176958600 21:15134292-15134314 CTGTTCTGGGGGAGGGGGGCAGG - Intergenic
1176960598 21:15154753-15154775 GTGTGTTGGGGGAGGGGAGGTGG + Intergenic
1178437970 21:32576006-32576028 CTGTGTGTGGGGTGGAGGGCTGG + Intergenic
1178690249 21:34744340-34744362 CTGTGCTTGGGGAGGGGCGGAGG + Intergenic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1179106318 21:38403797-38403819 CTGTGCTTGTGGAAGGCAGCTGG - Intronic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179675127 21:42975370-42975392 CAGTGTTTGGGGCCGGGTGCTGG + Intronic
1180816487 22:18792756-18792778 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
1181202674 22:21227088-21227110 CTGTGTGTGGGGAGGGCACGGGG - Intronic
1181492302 22:23268229-23268251 GGGTGCGTGGGGAGGGGAGCAGG + Intronic
1181577491 22:23804546-23804568 CTTTTTTTTGGGAGGGGAGATGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182072851 22:27475725-27475747 CAGTGTGTGGGGAGGTGAGAGGG + Intergenic
1182096801 22:27631002-27631024 TTGTGATGGGGGATGGGAGCAGG - Intergenic
1182139296 22:27938934-27938956 CTGTTTTGGGGGTGGGGAGGAGG + Intergenic
1182246533 22:28962675-28962697 CTGTATTTGGGGAGGTATGCAGG + Intronic
1182489685 22:30663108-30663130 CTGTTTTTGGGGAGGGCTGCAGG + Exonic
1182966905 22:34530574-34530596 GTGTGTTTGGGGCGGGGAGTGGG + Intergenic
1182971283 22:34580693-34580715 CTGTAGTTGGGGAGTGGAGTAGG - Intergenic
1182973479 22:34599772-34599794 CTGTGTCTGAGGAGTGGAGAGGG - Intergenic
1183055535 22:35303117-35303139 GTGTGTGTTGGGAGGGGAGGTGG - Intronic
1183154959 22:36067676-36067698 ATGTATTTGGGGAGGGGGGTGGG - Intergenic
1183343667 22:37295351-37295373 GTGTGGTGGGGGAGGGGAGGAGG - Intronic
1183777161 22:39973791-39973813 CTGTGGCTGGTGAGAGGAGCTGG - Intergenic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1183981124 22:41540923-41540945 ATGAGTTTGTGGAGGGGACCAGG + Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184516155 22:44964029-44964051 CTGTGTGTTGGGAGGGTTGCTGG + Intronic
1184770803 22:46595447-46595469 CTGTGTCTGGAAAGGGGAGGTGG + Intronic
1184804147 22:46781615-46781637 CTGTTTTTGGGGAGGGCATGGGG + Intronic
1185086142 22:48742131-48742153 GTGGGGTTGGGCAGGGGAGCCGG - Intronic
1185110545 22:48897917-48897939 CTGTGCTTGGGCAGGGGTGGAGG - Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185297576 22:50061926-50061948 CTGGCTCTGGGGCGGGGAGCGGG + Intronic
1203224239 22_KI270731v1_random:68325-68347 CTGTGTGTGGGGAGGGCACGGGG + Intergenic
1203266587 22_KI270734v1_random:18467-18489 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
950260572 3:11540900-11540922 CTTTTTTTGGGGGGGGGAGGGGG + Intronic
950472748 3:13196780-13196802 GTGTGTGTGTGGTGGGGAGCAGG + Intergenic
950483117 3:13256918-13256940 CTGTTTTTGGGTTGGGGAGCAGG - Intergenic
950751907 3:15135841-15135863 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
951359775 3:21711613-21711635 GTGTTTTTGGGGATGGGAGATGG - Intronic
952078665 3:29730296-29730318 CTGTGTTCTGGGCGGGGGGCGGG + Intronic
953005656 3:38976827-38976849 CTGGGTTTGGGTAGGGGGACGGG - Intergenic
953265029 3:41378626-41378648 CTGTCATGGGGTAGGGGAGCGGG + Intronic
953752519 3:45619825-45619847 CTTTTTTTGGGGGGGGGGGCGGG - Intronic
953872481 3:46639270-46639292 ATGTGTTTGGGGATGGGGGTGGG + Intergenic
954373933 3:50184465-50184487 GCGGGTTTGGGGAGAGGAGCAGG + Intronic
954701069 3:52451198-52451220 CTGGGGTTGGGGAGGGGGTCGGG - Exonic
954787558 3:53105412-53105434 CTCTTTTTGGGGGGGGGGGCGGG - Intronic
955072348 3:55582400-55582422 CACTGTTTGAGGAGGAGAGCAGG - Intronic
955281240 3:57596959-57596981 CTGTGGTGGGGGAGGGGCGCCGG - Intronic
955366863 3:58318228-58318250 CTTAGTTAGGGGAAGGGAGCAGG + Exonic
955566329 3:60250894-60250916 CTGTGTTTGGTGAGGGCAGTGGG - Intronic
955584303 3:60459871-60459893 TTGGGGTTGGGGAGGTGAGCAGG + Intronic
956182112 3:66527284-66527306 CTCTGTATGGGGTGGGGGGCGGG + Intergenic
956214277 3:66832242-66832264 CTTTGTGTGGGGGGGGGAGTGGG + Intergenic
956723592 3:72138969-72138991 CTGGGTTTGGAGAGAGGGGCAGG - Intergenic
956826045 3:72997282-72997304 CTGGGCTGGGGGAGGGGAGCCGG + Intronic
957223280 3:77411766-77411788 CTGTTTATGGGGAGGAGAACTGG + Intronic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
959105940 3:102064084-102064106 GTGTGTTTGGTGAGGGTAGGAGG - Intergenic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959377931 3:105607676-105607698 CTGTTTATGGGGAGGTGACCAGG + Intergenic
959747396 3:109792692-109792714 ATGTATTTGGGGAGTGGAGTAGG + Intergenic
960327743 3:116317642-116317664 CTGTCTTTGGGGCCGGGCGCGGG - Intronic
960688087 3:120313901-120313923 TTGTGACGGGGGAGGGGAGCAGG - Intergenic
960943403 3:122949263-122949285 TTGTTTTTGGGGAGAGGAGGGGG - Intronic
961284707 3:125791857-125791879 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
961330637 3:126135947-126135969 CTGGGTGTGGTGAGGGGAGCCGG + Intronic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961637881 3:128344471-128344493 CTGCCTTTGGGGAGGGGACCTGG - Intronic
961813735 3:129536789-129536811 TTGGGGTTGGGGCGGGGAGCTGG - Intergenic
962473965 3:135739772-135739794 GTGTGATGGGGGAGGGGTGCTGG - Intergenic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
964394799 3:156234142-156234164 CTGGGGTTGGGGAGAGGAGGAGG + Intronic
964502665 3:157365943-157365965 CAGTCTCTGGGGAGGGGAGAGGG - Intronic
964620658 3:158717467-158717489 CTTGGTGTGGGGAGGAGAGCTGG + Intronic
965519822 3:169661300-169661322 GTGTGTGTGGGGGGGGGAGTTGG - Intronic
966413505 3:179666594-179666616 TTGCATTTGGGGAGTGGAGCTGG + Intronic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
968515053 4:1012243-1012265 CGGTGTTTGGAGAGGGGGGGCGG + Intronic
968576927 4:1371022-1371044 CTCTGTTTGGAGAGAAGAGCTGG - Intronic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
968697823 4:2041460-2041482 CTGGGTTGGGGGTGGGTAGCCGG + Intronic
968727034 4:2252552-2252574 CTGGGGTGGGGGAGGGCAGCAGG + Intronic
968815087 4:2817951-2817973 AGGTGTTGGGGGAGTGGAGCGGG + Intronic
969013034 4:4083004-4083026 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
969042395 4:4309508-4309530 CTGTCTTTGGGGAGAGGAGTAGG + Intronic
969292696 4:6251023-6251045 TTGTCTTTGGGGTGGGGATCGGG - Intergenic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969437033 4:7194152-7194174 ATTTGTATGGGGAGGGGAGATGG + Intronic
969542692 4:7803535-7803557 CTGTGGTTGGGGATCGGGGCCGG - Intronic
969680004 4:8637599-8637621 CTGTGTGGTGGGCGGGGAGCTGG + Intergenic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
969740810 4:9024790-9024812 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
971161448 4:24137867-24137889 CTGTGTTTGAGGGGGGAAACGGG - Intergenic
971260759 4:25054658-25054680 CTGTCTTTGAGGAGTGGAGGTGG + Intergenic
971846214 4:31922154-31922176 GTGTGTTTGTGGTGGGGAGCAGG - Intergenic
973570479 4:52233939-52233961 GTGTGTGTGGGGGGGGGAGGGGG + Intergenic
973772254 4:54217716-54217738 CAGTGCTGGGGGAGGGGAGGAGG - Intronic
975048682 4:69832202-69832224 CACTGTTAGGGGAGGGGCGCCGG + Intronic
975651851 4:76601252-76601274 CTGTGTGTGGTGTGGGGAGGGGG + Intronic
975659053 4:76670423-76670445 CTGGGTTAGGGGGTGGGAGCAGG + Intronic
975814442 4:78202940-78202962 CTGTGCATGGGGTGGTGAGCTGG + Intronic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
976260061 4:83136874-83136896 CTGTCCTTGGGTAGGAGAGCTGG - Intronic
976441136 4:85076075-85076097 CTGTGTGTTGGGTGGGGGGCAGG - Intergenic
978444113 4:108764234-108764256 CTGTGTTTTGAAAGGGCAGCAGG + Intergenic
978583700 4:110256578-110256600 CTGTGTCTGGGGAGGGCTGCAGG + Intergenic
978759717 4:112343664-112343686 TTGTGTTTGGAGATGGGATCAGG - Intronic
978768057 4:112425025-112425047 CTGTGATTGGGGTGTGGGGCCGG - Intronic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
979858543 4:125664813-125664835 CTGTCAGTGGGAAGGGGAGCTGG + Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
981584444 4:146286010-146286032 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584450 4:146286058-146286080 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584487 4:146286318-146286340 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584490 4:146286342-146286364 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584496 4:146286390-146286412 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584499 4:146286414-146286436 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584511 4:146286506-146286528 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584514 4:146286530-146286552 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584546 4:146286746-146286768 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584557 4:146286838-146286860 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584573 4:146286982-146287004 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
981584576 4:146287006-146287028 CTGTGTTTGGAGTGGTGAGAAGG + Intronic
982120690 4:152140302-152140324 GTGAGTTGGGGGAGGGGAGAGGG + Intergenic
982149294 4:152434953-152434975 GTGTGTGGGGGGGGGGGAGCGGG - Intronic
982228207 4:153184767-153184789 CTGTCTTTGGGAAGTGGAGTAGG + Intronic
982443458 4:155462873-155462895 CTATGTTTGGGGTGGGATGCTGG + Intergenic
982671045 4:158320404-158320426 CTCTGAGTGGGAAGGGGAGCTGG + Intronic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
983469806 4:168142313-168142335 TTGTGTTAGGGAAGGGGAGAGGG - Intronic
983478639 4:168245935-168245957 ATGTCTTTGGGGAGTGGAACAGG + Intronic
984779061 4:183506779-183506801 CCGTGTTTGGGGAGGGGGTGGGG + Intronic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985754027 5:1702482-1702504 CTCTGTGTGGGGGTGGGAGCAGG + Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985936469 5:3101502-3101524 CTGGGTTGGGAGAGGGGAGCAGG - Intergenic
986555630 5:9007863-9007885 CTGGGTGTGAGGAGGGGAGGTGG + Intergenic
986746301 5:10747926-10747948 CTGGGTGTGGGGTGGGGAACAGG + Intronic
986968256 5:13301580-13301602 GTGTGTTGGGTGAGGGGAGGTGG + Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
988603586 5:32661651-32661673 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
989164922 5:38424420-38424442 CTCTGTCTGGGGTAGGGAGCAGG - Intronic
990951747 5:61305243-61305265 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
992431627 5:76716120-76716142 CTGTGTCTGGGGCGGTTAGCGGG - Exonic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
994576858 5:101589304-101589326 CTGTTGTTGGGGTGGGGAGGGGG + Intergenic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
995095237 5:108228269-108228291 CTATCCTTGGGGAGTGGAGCTGG - Intronic
995507853 5:112879318-112879340 ATGTGTTTGGGGGGGGGGGCTGG + Intronic
995603937 5:113830478-113830500 CTGTGTTTGGGCAGGGGGTGAGG + Intergenic
995774762 5:115713101-115713123 ACGTGTTTTGGGAGGGGAGCCGG - Intergenic
996360620 5:122641443-122641465 GTGTGTGTGGGGAGGGGAGGGGG - Intergenic
996982726 5:129519374-129519396 TTGTGCTTGAGGAGGGGAGAGGG - Intronic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997208177 5:132062448-132062470 CTGCCTCTGGGGAGGAGAGCAGG + Intronic
997229813 5:132234142-132234164 CTGTTTTGGGGAAGGGGAGTGGG + Intronic
997290835 5:132733095-132733117 CTGGGTTGGGGGAAGGGAGGTGG + Intronic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
997844562 5:137275280-137275302 CTATGGTGGGGGAAGGGAGCAGG - Intronic
998026748 5:138823528-138823550 TGGTTTTTGGGGTGGGGAGCGGG + Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998812339 5:145978880-145978902 CTGTGTGTGGGGAGAGGCCCTGG + Intronic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999276423 5:150333685-150333707 CTGTGTGGGGTGAAGGGAGCAGG - Intronic
999418836 5:151422941-151422963 TTGTGTGTGGGGAGTGGAGTGGG - Intergenic
999578273 5:153005310-153005332 CTGTGTTTGTTGATGGCAGCTGG - Intergenic
1000014823 5:157267011-157267033 CTCTGCTTGGGGATGGGGGCAGG + Intronic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000643226 5:163730396-163730418 TTGTGTTGGGGGTGGGGAGTAGG + Intergenic
1000792421 5:165624206-165624228 TTGTGTCTGGGGTGGGGAGCAGG + Intergenic
1000795892 5:165663912-165663934 GTGTGTGTGTGGAGGGGTGCTGG + Intergenic
1000850073 5:166329256-166329278 CTGAGGTTGGGGCGGGGAACTGG - Intergenic
1001474273 5:172038855-172038877 CTTTTTTTGGGGTGGGGAGGGGG + Intergenic
1001542307 5:172548110-172548132 CTATATTTGGGAAGGGGAGTTGG + Intergenic
1001865510 5:175100884-175100906 ATGTGTGTGGGGTGGGGGGCGGG - Intergenic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002200338 5:177524399-177524421 CTGAGGCTGGAGAGGGGAGCCGG - Exonic
1002317898 5:178356196-178356218 CTGGGGTTGCGGAGGGGAGGAGG + Intronic
1002399651 5:178984551-178984573 CTGAGGCTGGGGAGGAGAGCTGG + Intronic
1002467768 5:179416336-179416358 CTGGGTGTGGGGAGGGGCGTGGG - Intergenic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1003157201 6:3606922-3606944 CTGAGGTTGGCGGGGGGAGCGGG + Intergenic
1003407917 6:5838675-5838697 CTGTCTTTGGGGTGGGGTGGGGG + Intergenic
1003555978 6:7140915-7140937 CTGTTTCTGGGGAGGGGCGAGGG + Intronic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1004570527 6:16840344-16840366 CTGACTTTGGGGAAAGGAGCAGG + Intergenic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1005342673 6:24858054-24858076 CTCTAGTTGGGGAGAGGAGCAGG - Intronic
1005573796 6:27173044-27173066 GTGTGTTTGTGTAGGGGAGGAGG + Intergenic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006104930 6:31710733-31710755 CTGTGTATGGGGAGGGGTGGGGG + Intronic
1006342183 6:33452858-33452880 CTGTGTTGGAGGAGGGGTGTTGG + Exonic
1006367090 6:33622019-33622041 CTGAGTTGGGGAAGGGCAGCCGG + Intronic
1006417467 6:33913212-33913234 CTGTGCCTGGGTAGGGGAGCAGG - Intergenic
1007095539 6:39210494-39210516 CTGTGCATGGGTCGGGGAGCTGG - Intronic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1007421609 6:41723260-41723282 ATGTCTTTGGGGAGGGGTGGGGG - Intronic
1007589456 6:43012666-43012688 CGGGGATTGGGGAGGGGAGCTGG - Intronic
1007677187 6:43606302-43606324 CTGGGATGGGGGAGGGGAGGAGG - Intronic
1007756471 6:44102802-44102824 CTGTTCCTGTGGAGGGGAGCTGG - Intergenic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1009314530 6:62201079-62201101 CTGTTTGGGGTGAGGGGAGCAGG + Intronic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1009901581 6:69813414-69813436 CCATGTTTGGCAAGGGGAGCAGG + Intergenic
1010852720 6:80797520-80797542 CTGTTGTTGGGGAGGTGAGCAGG + Intergenic
1011009908 6:82692128-82692150 GTGTGTATGTGGAGGGGAGGAGG - Intergenic
1011592724 6:88985999-88986021 GTGTGTTTGGGGCAGTGAGCAGG + Intergenic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1012862892 6:104582028-104582050 GTCTGTTGGGGGTGGGGAGCTGG - Intergenic
1012950163 6:105509738-105509760 GTGTGTGTGGGGTGGGGAGGTGG + Intergenic
1013035821 6:106381687-106381709 CCGTCTTTGGGGAGAGGAGCTGG + Intergenic
1013166556 6:107598667-107598689 ATGGGTTGGAGGAGGGGAGCAGG + Intronic
1013278468 6:108610089-108610111 CTGTATATGGGGAGGGGAAGGGG - Intronic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1013767903 6:113595494-113595516 ATGTGTTTGGGGTGGGGTGGGGG - Intergenic
1016630539 6:146224957-146224979 CTGTATTTGGGGTGGGGAGAAGG - Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017615577 6:156243508-156243530 CTGAACTGGGGGAGGGGAGCAGG - Intergenic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1018488601 6:164268888-164268910 CAGGGTTTGGGGAGTGGAGGAGG + Intergenic
1019194729 6:170274509-170274531 AGGTGTGTGGGGTGGGGAGCAGG + Intergenic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1019630341 7:2045732-2045754 GTGGGGTGGGGGAGGGGAGCGGG + Intronic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1019878615 7:3838650-3838672 CTGTGTTCAGGGACGGGGGCTGG - Intronic
1019911401 7:4102504-4102526 CTGCGTGTGGGGAAGGGAGGAGG - Intronic
1020905831 7:14062988-14063010 CTGTGTGGGGTGAGGGGAGGGGG - Intergenic
1020979991 7:15054799-15054821 CTTGGTTTAGGAAGGGGAGCGGG - Intergenic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1021513481 7:21458780-21458802 GTGTGTGGGGGGAGGGGAGCGGG - Intronic
1021859723 7:24894558-24894580 CTGTGCTTGGGGCGGGGAGGGGG + Intronic
1021926078 7:25534930-25534952 CGGTGGCTGGGGAGAGGAGCAGG + Intergenic
1022088231 7:27089237-27089259 CAGTGTTTGAAGAGGTGAGCTGG - Intergenic
1022335283 7:29415982-29416004 CTGGGTTTGGGGAGAAGAGTGGG + Intronic
1023658302 7:42448379-42448401 GTGTGTCTGGGGAGGTGGGCTGG + Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1025740060 7:64187736-64187758 CTGTTTTTGAGGAGGGGAGGTGG + Intronic
1026438012 7:70416828-70416850 GTGTGTCAGAGGAGGGGAGCAGG - Intronic
1026443148 7:70460968-70460990 CTGGGTTTGGGAAGGGCAGAAGG + Intronic
1026828894 7:73599961-73599983 CTGGGGCTGGGGAGGGGAGGGGG - Intronic
1026840688 7:73668534-73668556 CTGGCGTTGGGGAGGGGTGCTGG + Intronic
1027200857 7:76063144-76063166 TTGTGCATGGGGAGTGGAGCCGG + Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027633468 7:80638580-80638602 CTTTTTTTGGGGGGGGGAGGGGG + Intronic
1027696767 7:81421670-81421692 CTGTTTTTGGGGTGGGGGGAGGG - Intergenic
1028795506 7:94897302-94897324 CTGGGGTTGGGGAGGTGAGAAGG - Intergenic
1028873649 7:95796175-95796197 GTGTGTTTAGTGAGGGGAGAAGG + Intronic
1029071691 7:97904638-97904660 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1029140721 7:98407926-98407948 CTGGGTTGGGGTAGGGGGGCAGG - Intergenic
1029162661 7:98563587-98563609 ATGTGTTGGGGGAGGGGTGGTGG + Intergenic
1029610784 7:101625519-101625541 AGGCGTTGGGGGAGGGGAGCAGG - Intronic
1030154945 7:106445434-106445456 CAGAGTTTGGGAAGGGGAGTAGG - Intergenic
1030154963 7:106445506-106445528 CAGAGTTTGGGAAGGGGAGTAGG - Intergenic
1030818198 7:114062947-114062969 ATGTGTTTGGGCATGGGAGTGGG - Intronic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1033187518 7:139241991-139242013 CTTTTTTTGGGGGGGGGAGCTGG - Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033534373 7:142298582-142298604 CTGAGATGAGGGAGGGGAGCTGG + Intergenic
1033997568 7:147370033-147370055 CTGTGTTTGGGGAGAGGCAAGGG - Intronic
1034285478 7:149880778-149880800 GTGGGTCTGGGGAGGGGAGCAGG + Intergenic
1034400785 7:150860289-150860311 GTGCATTTGGGGAGGGGGGCGGG + Intronic
1034412802 7:150950149-150950171 CTGGGTATGGGGTGGGGGGCGGG - Exonic
1034581923 7:152050938-152050960 CTGTGTTTGGGGGAGGGAGAGGG - Intronic
1034760235 7:153665533-153665555 TTCTGTTTTGGGAGGGGAGGGGG + Intergenic
1035327674 7:158075488-158075510 CTGCGTTGGGGGCGGGGAGGGGG - Intronic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1035656756 8:1313771-1313793 TTATGTCTGGGGAGGGGAGAAGG + Intergenic
1035984202 8:4408030-4408052 CTACATTTGGGGAGGGGAGGAGG - Intronic
1036124609 8:6051595-6051617 CTGCTTTTGGGAAGGGAAGCTGG - Intergenic
1036246015 8:7117358-7117380 CTGTGGTGGGGGAGGGGATGTGG + Intergenic
1036888255 8:12576670-12576692 CTGTGGTGGGGGAGGGGATGTGG - Intergenic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037881354 8:22574951-22574973 CTGTATTTGGGGAGTGGGGTGGG - Exonic
1038165958 8:25085285-25085307 CTGTATTTGGGTGGGGGAGGGGG - Intergenic
1039434009 8:37547271-37547293 GTGTGTATGGGGTGGGGGGCGGG - Intergenic
1039546440 8:38414329-38414351 TTGTGCTGGGGGAGGGGAGGCGG - Intronic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1041406226 8:57502184-57502206 CTGTGTGTGGGGTTGGGGGCAGG + Intergenic
1041467120 8:58168001-58168023 CTGGGTGGGGGGTGGGGAGCTGG - Intronic
1042177829 8:66054872-66054894 CTGTGCTGGGGTAGGGGAGGTGG + Intronic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042591531 8:70402876-70402898 CCGTGGTGGGGGCGGGGAGCCGG - Intronic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1042868489 8:73376925-73376947 CTATAGCTGGGGAGGGGAGCTGG + Intergenic
1043401595 8:79890652-79890674 GTGTGTTTGGGGAGGTGGGGTGG - Intergenic
1043837654 8:85064677-85064699 CTGGGTGTGAGGAGGGGAGGTGG - Intergenic
1043958151 8:86386478-86386500 GTGTGTTTGGGTGGGGGGGCGGG + Intronic
1044499772 8:92939910-92939932 CTGTGGTTGGGCAAGGGTGCAGG - Intronic
1046276742 8:111971348-111971370 CAGTGTTGGAGGAGGGGACCTGG - Intergenic
1047690513 8:127348897-127348919 CTGGGTCTGGGGTGGGGACCAGG - Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048351161 8:133617844-133617866 GTGTGTATGGGGCGGGGAGGGGG + Intergenic
1048471354 8:134707053-134707075 CTGAGTTTGGGGAGGGGCATGGG - Intronic
1048744250 8:137595773-137595795 CTGTCTTTGGAGAAGGGAGGTGG + Intergenic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1049058738 8:140259204-140259226 CTGTATTTGGGAAAGTGAGCGGG - Intronic
1049299560 8:141862399-141862421 CTCTGTTTGGGGAGGGGAAGCGG - Intergenic
1049364997 8:142232852-142232874 TTGGGGTCGGGGAGGGGAGCTGG - Intronic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049503583 8:142982359-142982381 CTCTGTACGGGGTGGGGAGCTGG + Intergenic
1049659320 8:143812668-143812690 CTGTCCCTGGGGAGGGGAGGTGG - Intronic
1049884208 9:16937-16959 CTGGGTTCTGGGATGGGAGCTGG - Intergenic
1049987412 9:964664-964686 TTGTGCTTGGGGAAGGGAGTTGG - Intronic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1052947420 9:34179279-34179301 CGGAGTTGGGGGAGGGGGGCTGG + Intronic
1053141079 9:35683084-35683106 CTCTCTATGGGGAGGGGAGCAGG - Intronic
1053554014 9:39115801-39115823 CTGAGTTTGAGGAGGGGAATGGG - Intronic
1053793563 9:41704341-41704363 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1054151615 9:61610489-61610511 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1054181974 9:61916356-61916378 ATGTGTTCGGGGAGGGAACCGGG + Intergenic
1054832562 9:69643045-69643067 CTGTGTGTGGAGGGGGGAGGAGG - Intronic
1055037839 9:71837240-71837262 ATGTGTTTGGCCAGGGGAGGTGG - Intergenic
1055828240 9:80352375-80352397 CTGTCTTTGGAGAGGGGAACTGG + Intergenic
1056422691 9:86445066-86445088 ATTTGGTTGGGGAGGGGAGCGGG - Intergenic
1056498803 9:87188111-87188133 ATGTGGTGGGGGAGGGGGGCTGG - Intergenic
1057303439 9:93899474-93899496 CTCTGTATGAGGAGGGGAGCTGG - Intergenic
1057310672 9:93941037-93941059 CTGTGTCTGGGGGTGGGAGGAGG - Intergenic
1057491438 9:95522993-95523015 CTGTGTTTGGAGGGGGGCTCCGG + Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057869566 9:98708167-98708189 GTGTGTGTGGGGAGGGGTGGGGG - Intronic
1057995965 9:99821943-99821965 CTGTGTATGGGGAGCGGAGGAGG - Exonic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059446682 9:114342502-114342524 CTGTGGTTGGGGCGGGGGGTTGG - Intronic
1059560006 9:115325085-115325107 AAGTGTTTGGAAAGGGGAGCTGG + Intronic
1059580629 9:115544357-115544379 CAATGTTTGTAGAGGGGAGCTGG - Intergenic
1059614784 9:115937646-115937668 AAATGTTTGGGGAGGGGAGGAGG + Intergenic
1059705457 9:116819211-116819233 GTGTGTTTGGGGTGGGGTGGGGG - Intronic
1059907417 9:119003615-119003637 GTGTGTGTGGGCAGGGGAGGTGG - Intergenic
1060647024 9:125289597-125289619 CTTTTTGTGGGGAGGGAAGCAGG + Intronic
1060912445 9:127361871-127361893 GTGTGTTTGGGGTGGGGTGAGGG - Intronic
1061005659 9:127927473-127927495 CTGTGTTTAGGGGTGGGATCGGG - Intronic
1061162248 9:128902134-128902156 GTGTGTCTGGGGAGTGGAGGAGG - Intronic
1061803704 9:133126917-133126939 CGGTGTCTGGGTATGGGAGCAGG - Intronic
1062051224 9:134448042-134448064 ATGGGGTGGGGGAGGGGAGCAGG + Intergenic
1062272026 9:135714151-135714173 CTGGGGACGGGGAGGGGAGCTGG + Intronic
1062344836 9:136109849-136109871 CTGGGCTGGGGGAGGGGCGCCGG + Intergenic
1062521111 9:136958395-136958417 CTGCCTTGGGGGAGGGAAGCTGG - Intergenic
1062598541 9:137309960-137309982 CTGGGATTGGAGAGGGCAGCTGG - Intronic
1062629223 9:137456200-137456222 GTGTGTGTGGGGGGGGGGGCTGG + Intronic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1185690024 X:2146963-2146985 CTTTTTTTGGGGGGGGGGGCGGG + Intergenic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186047440 X:5551917-5551939 CAGTGATATGGGAGGGGAGCAGG + Intergenic
1186368305 X:8919155-8919177 CTGAGTTTTGGAAGGGGTGCTGG + Intergenic
1186402947 X:9276443-9276465 CTATTTTTGGGGGGGGGAGGCGG - Intergenic
1186532219 X:10308901-10308923 ATGTGTGTGGTGAGGGGAGGGGG - Intergenic
1186612313 X:11149457-11149479 GTGTGTTGGGGGAGGGGGGCAGG + Intronic
1187133999 X:16529433-16529455 CTGTGTGGGAGGTGGGGAGCTGG - Intergenic
1187157876 X:16738031-16738053 CAGTGTTTAGGGAGGGGAAGAGG + Intronic
1187286742 X:17912570-17912592 CTTTGATGGGGCAGGGGAGCTGG - Intergenic
1187319665 X:18228122-18228144 CTGCGTTTGGGTGGGGGAACCGG + Intergenic
1187431605 X:19229909-19229931 CTGTCGATGGGGAGGGGCGCTGG - Intergenic
1187905502 X:24062081-24062103 CTTTTTTTGGGGCGGGGAGTGGG + Intronic
1188870390 X:35364669-35364691 TGGTGTTGGGGGATGGGAGCAGG - Intergenic
1189325060 X:40106857-40106879 CTGTGTTGGGGAGGGGGAGTGGG - Intronic
1189336150 X:40172015-40172037 CTGGGGTTGGCGAGGGCAGCTGG + Intronic
1189655129 X:43237092-43237114 CCATGTTTGGGGAAGGGAGAGGG - Intergenic
1189819176 X:44853624-44853646 CTGCCTTTGGGGAGGGGAACTGG - Intergenic
1189862397 X:45286914-45286936 CTGTGTTTGGGAAGGAGGGAAGG + Intergenic
1190263934 X:48816389-48816411 CTGTCTTAGGGGTGGGGACCAGG + Intronic
1190322785 X:49188324-49188346 CTGGGTTTGGGCAGTGGAGAGGG - Exonic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1190685089 X:52866388-52866410 ATGTCTATGGGGAGGGGAGGAGG - Intronic
1190765472 X:53472650-53472672 CTGTGTTGGGTGGGGGAAGCAGG + Intergenic
1191778952 X:64846622-64846644 CTGATTTTGGGGAGGAGAGAGGG - Intergenic
1192185504 X:68944265-68944287 CTGTGTGTGGGGATGAGTGCAGG + Intergenic
1192430322 X:71107378-71107400 CTGTCATGGGGGTGGGGAGCAGG - Intergenic
1192828936 X:74729922-74729944 GTGTGTTTGGGGTGGGGGGGAGG + Intergenic
1193515051 X:82452373-82452395 CTGTGTTGAGGGGAGGGAGCTGG - Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194084845 X:89513732-89513754 CTGTGTGTGGGGATAGGAACAGG - Intergenic
1195778990 X:108439907-108439929 CCGGCTTTGGGGAGGGGAGGGGG + Exonic
1195913828 X:109916087-109916109 TTCTGTTTGGGAAGAGGAGCTGG + Intergenic
1196157169 X:112443080-112443102 CAGAGTTTGGGAAGGGTAGCAGG - Intergenic
1196818253 X:119682446-119682468 ATGTAATTGGGGAGGGGAGTGGG - Intronic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1197160438 X:123317198-123317220 CTGTGTTGTGGGAGGGGCCCAGG - Intronic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198173936 X:134135963-134135985 CAGTGTTGGGGGAGGGGGCCTGG + Intergenic
1198341279 X:135715850-135715872 ATCTGTTGGGGGAGGGGGGCTGG - Intronic
1198574773 X:137998136-137998158 CTGGGTTTGGGGCAGGGGGCTGG - Intergenic
1198650672 X:138860599-138860621 CTATTTTTGGGTAGGGCAGCAGG - Intronic
1199255271 X:145712337-145712359 CTGGGGTTGGGGATGGGAACAGG - Intergenic
1199266216 X:145830283-145830305 CTGTGTCTGGTGAGGAGAGTGGG - Intergenic
1199586763 X:149423190-149423212 GTGTCCTTGGGGAGGGCAGCCGG + Intergenic
1199965731 X:152819103-152819125 GTGTGTTTGGGGGTGGGGGCTGG - Intergenic
1200144255 X:153918312-153918334 CTGTTTCTGGGGGTGGGAGCTGG + Intronic
1200401595 X:156023219-156023241 CTGGGTTCTGGGATGGGAGCTGG + Intergenic
1200775594 Y:7167482-7167504 ATGTGTGTGGCGAGGGGAGCAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1202033446 Y:20604499-20604521 CGGGGTTGGGGGAGGGGAGAGGG + Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic