ID: 1097191608

View in Genome Browser
Species Human (GRCh38)
Location 12:57222136-57222158
Sequence TAGGGGAGTTCAGACAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097191608_1097191623 24 Left 1097191608 12:57222136-57222158 CCCTCCCTGTCTGAACTCCCCTA 0: 1
1: 0
2: 1
3: 19
4: 282
Right 1097191623 12:57222183-57222205 CCAACTCTTCCTTTTTATCTTGG 0: 1
1: 0
2: 0
3: 36
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097191608 Original CRISPR TAGGGGAGTTCAGACAGGGA GGG (reversed) Intronic
900127695 1:1075735-1075757 TTTGGGTGCTCAGACAGGGAGGG + Intergenic
900400323 1:2470377-2470399 CAGGGAGGTCCAGACAGGGACGG + Intronic
901550085 1:9989578-9989600 AAGAGGAGTCCAGCCAGGGACGG + Intergenic
902082351 1:13829559-13829581 CAGAGCAGGTCAGACAGGGAGGG + Intergenic
902164716 1:14561012-14561034 GAGAGGAGCTTAGACAGGGAGGG - Intergenic
902689059 1:18098314-18098336 TAGGGGAGATGGGAGAGGGAGGG + Intergenic
903422302 1:23226713-23226735 TAGCGGACTTCAGCCAGGCATGG - Intergenic
905301220 1:36987409-36987431 GAGGGGAGGTGAGGCAGGGAAGG + Intronic
905395277 1:37662645-37662667 TAGGGCAGTGCAGTGAGGGAAGG + Intergenic
905526208 1:38641886-38641908 AAGGGGAGTTCAGTCAGGTTGGG - Intergenic
905927268 1:41760367-41760389 TAGAGAAGTTGAGAAAGGGAGGG - Intronic
908410774 1:63862468-63862490 TGGCGGAGATCAGACAGAGAAGG - Intronic
908517232 1:64905573-64905595 TAAGGGAGTGAAGACAGGGAGGG - Intronic
911048485 1:93649223-93649245 CAGGGGAGTTCACCCAGGGGTGG + Intronic
911546634 1:99225125-99225147 GAGAGGAGCTCAGCCAGGGAGGG - Intergenic
912500641 1:110119904-110119926 TTGGAGAGTTCACACAGAGAAGG - Intergenic
912727077 1:112068020-112068042 TATAGGATTTCAGAAAGGGAAGG - Intergenic
913338771 1:117735183-117735205 GAGAGGAATTCAAACAGGGAGGG + Intergenic
916495148 1:165339868-165339890 AAGGTGAGTTTAGCCAGGGAAGG - Intronic
918004319 1:180527335-180527357 TCCGGGAGTTCAGAGAGGGGAGG + Intergenic
918037228 1:180885831-180885853 TACTGGAGTTACGACAGGGATGG - Exonic
918375880 1:183908679-183908701 TAGAGGAGTCCAGACATGCAGGG + Intronic
919365105 1:196650185-196650207 GAGGGGAGTTTGGCCAGGGACGG + Intergenic
919986117 1:202676365-202676387 TAGAGGAGTTCAGAGAGGGTGGG - Intronic
920041391 1:203100013-203100035 AAGGGGAATGCAGACAGGCAGGG - Intronic
920061242 1:203228446-203228468 TTGGGGAGGTCTGGCAGGGAAGG + Intronic
922076865 1:222253756-222253778 GAGAGGAGTCCAGCCAGGGATGG + Intergenic
923286544 1:232501730-232501752 TAGGGGAGTGAAAACAGGGCTGG - Intronic
923486572 1:234437854-234437876 TACTGGATTGCAGACAGGGAGGG + Intronic
923975494 1:239257407-239257429 TAGAGGAGTTCGACCAGGGATGG - Intergenic
1063983943 10:11480998-11481020 AAGGGGAGTGCAGGAAGGGAGGG - Intronic
1064599724 10:16981267-16981289 GAGAGGAGTTCAGCCAAGGAAGG + Intronic
1064957291 10:20924931-20924953 TGGGGGAGAGGAGACAGGGAAGG - Intronic
1067386114 10:45818929-45818951 TAGTGGAATTCAGACAGTGGGGG - Intergenic
1068196738 10:53727022-53727044 AAGGGGAGTTCAGCCAGGGGCGG - Intergenic
1069910207 10:71754260-71754282 TAGGGGAGTTCTGAAAGCAAGGG + Intronic
1070381839 10:75887797-75887819 TAGCTGAGTTCTGATAGGGAAGG + Intronic
1071552864 10:86580637-86580659 AAGGGGAAATGAGACAGGGAAGG + Intergenic
1071736151 10:88303268-88303290 TAGTGAAGTACAGCCAGGGATGG + Intronic
1071812877 10:89202417-89202439 TAAGGGAGTTCAAAAAGAGATGG - Intergenic
1072249729 10:93572165-93572187 GTGGGGACTCCAGACAGGGAAGG + Intronic
1073530984 10:104232008-104232030 CAGGGGAGGTCACACGGGGAGGG + Intronic
1074532681 10:114307723-114307745 AAGGCGAGCTCAGACAGCGAAGG - Intronic
1075127689 10:119713730-119713752 TAGGAGATTTCATACTGGGAGGG - Intergenic
1075174029 10:120142989-120143011 CAGGGAAGATGAGACAGGGAAGG + Intergenic
1075259761 10:120953119-120953141 GTGGGGAGATCAGACAGAGATGG - Intergenic
1077490999 11:2860945-2860967 ATGGGGGGTTCAGACAGGGTGGG - Intergenic
1077815014 11:5678512-5678534 TTGGGGAGTTCTCACAAGGAGGG + Intronic
1078238591 11:9509242-9509264 TAGGGCAGTTCTGCCTGGGAAGG + Intronic
1078339575 11:10489193-10489215 GAGAGGAGTTCACACAGTGATGG - Intronic
1081059986 11:38462179-38462201 AAGGGGAGTTCAGCCAGGGACGG - Intergenic
1081584842 11:44377103-44377125 TGGGGGAAATGAGACAGGGATGG + Intergenic
1082180532 11:49112556-49112578 TAGGGAAGAAGAGACAGGGAAGG - Intergenic
1085328241 11:75625105-75625127 TAGGGATTTTCAGGCAGGGAAGG + Intronic
1085535663 11:77215730-77215752 GTGGGGGTTTCAGACAGGGAAGG + Intergenic
1085709228 11:78814064-78814086 TCGGGGAGGTCAGGAAGGGAGGG - Intronic
1086462862 11:87022897-87022919 TAGTGGAGCACAGCCAGGGATGG + Intergenic
1086684963 11:89722292-89722314 TAGGGAAGACGAGACAGGGAAGG + Intergenic
1086890952 11:92257629-92257651 TAGTGGAGTAAAGACAGGCAAGG + Intergenic
1087888570 11:103509431-103509453 TAGTGGAGGTGTGACAGGGAAGG + Intergenic
1091663177 12:2399522-2399544 GAGAGGAGTTCAGCCGGGGATGG - Intronic
1092161104 12:6315993-6316015 AGTGGGAATTCAGACAGGGATGG - Intronic
1094096088 12:26706507-26706529 AAAGGGCGTTCAGACAGTGAGGG - Intronic
1095245209 12:39911819-39911841 TAGGAGAGAACAGACAGGGTAGG + Intronic
1097191608 12:57222136-57222158 TAGGGGAGTTCAGACAGGGAGGG - Intronic
1097246237 12:57609272-57609294 GAAGGGAGTTCCGAGAGGGAGGG + Exonic
1098743445 12:74204135-74204157 TAAGGGAGTTTGCACAGGGAAGG + Intergenic
1098758345 12:74391757-74391779 CAGAGAAGTTCAGCCAGGGATGG - Intergenic
1100805035 12:98274293-98274315 TAGTGGAGTTCCAACGGGGAAGG + Intergenic
1100828087 12:98493393-98493415 TACGGGATTACAGAGAGGGAAGG - Intronic
1102245892 12:111355572-111355594 CAGGGGAGCTGAGAGAGGGATGG + Intergenic
1102704733 12:114871128-114871150 TAGAGGATTCCAGAGAGGGAGGG - Intergenic
1103571292 12:121846829-121846851 GAGAGGAATTCGGACAGGGAAGG + Intronic
1105005446 12:132718328-132718350 AAGGGTGGTGCAGACAGGGAGGG + Intronic
1105357099 13:19668708-19668730 TATGGGTGTTAAAACAGGGATGG - Intronic
1105451478 13:20503662-20503684 CAGGGGAGTGCAGACAGAGACGG + Intronic
1105500476 13:20967337-20967359 GAGGGGAGTGTAGAGAGGGAAGG - Intergenic
1106459635 13:29957657-29957679 TGGGAGAGTTCAGCCAGGAAGGG + Intergenic
1106627390 13:31434525-31434547 GAGAGGAGTTCAGCTAGGGATGG - Intergenic
1107828376 13:44351338-44351360 TAGGGGAATAAACACAGGGATGG + Intergenic
1108472659 13:50783233-50783255 TAGGGGAAGTGAGATAGGGAAGG - Intronic
1108574092 13:51776855-51776877 TGGGGGGGTTCAGAGAGGGCTGG + Intronic
1109311805 13:60703696-60703718 TAAGGGAGTTCAGCCAGGTAGGG + Intergenic
1109770556 13:66966122-66966144 TAGGGGTTTTAAGCCAGGGAAGG + Intronic
1112058821 13:95716688-95716710 GAGGGGAGTTCAGCCAGGAGTGG - Intronic
1113288314 13:108878359-108878381 GAGAGGAGTTCAGCTAGGGATGG + Intronic
1113388776 13:109875607-109875629 TAGGGGAGGAAAGATAGGGAAGG + Intergenic
1115379767 14:32722665-32722687 GAGAGGAGTTCAGCCAGGGATGG + Intronic
1115830272 14:37330825-37330847 GAGGAGAGATCAGAGAGGGATGG + Intronic
1117500248 14:56344207-56344229 TGGGGGTGTTCAGAAAGGCAAGG + Intergenic
1118839693 14:69501077-69501099 TAGGGGAGAGCAGACAGGCCAGG + Intronic
1120173133 14:81266444-81266466 AAAGGGAGTGCAGACAAGGAGGG - Intronic
1120493386 14:85204582-85204604 AAGGGGAGCTAAAACAGGGATGG - Intergenic
1121097591 14:91228631-91228653 TAGGGGAGTTCCCACAGGCAGGG + Intergenic
1122189256 14:100026989-100027011 TAGAGCAGGTAAGACAGGGATGG + Intronic
1122697387 14:103562700-103562722 TAGGGGTGTTCGGCCAGGGGCGG - Intronic
1122740660 14:103869993-103870015 CAGGGCAGTTCAGACATTGAAGG - Intergenic
1125531188 15:40414619-40414641 CAAGGGAGTCCAGAGAGGGAAGG + Intronic
1125972795 15:43925726-43925748 TTGGGGAGTTCAGAACGGAAAGG - Intronic
1126111483 15:45177651-45177673 TAGGGGAGATCAGAGAGGACAGG - Intronic
1126464794 15:48951787-48951809 TATGGGAGTTCAGAGAAGAAAGG - Intronic
1127478307 15:59355291-59355313 TGGAGGAGTTGAGACAGGCAAGG - Intronic
1128390961 15:67182075-67182097 TAGAGGATTTCAGCCAGGCACGG - Intronic
1128606856 15:69042992-69043014 TGGGGGACATCAGACTGGGAAGG - Intronic
1128909641 15:71501468-71501490 TAGAGGAGAACAGAAAGGGAGGG - Intronic
1130525174 15:84699632-84699654 CTGGGGAGTTCAGCCAGGCACGG + Intronic
1131020095 15:89090139-89090161 TAGGGGAGTCCAGAGAGGTTAGG + Intronic
1131826417 15:96325338-96325360 TTGGGGAGTAGAGAAAGGGAGGG + Intergenic
1131864091 15:96688347-96688369 TCGGGGAGAGTAGACAGGGAGGG + Intergenic
1132845354 16:1998696-1998718 CAGGGGAGTTCAGACAGGTCAGG - Exonic
1133929816 16:10223022-10223044 TAGGGGAGACCAGACTGGGATGG - Intergenic
1135223606 16:20636563-20636585 CAGGTGGGTTCAGACAGGAAAGG + Intronic
1135500480 16:22991702-22991724 TAAAGGAGTGCAGAGAGGGAAGG - Intergenic
1135972653 16:27083916-27083938 CATTGGAGTTCAGAGAGGGATGG - Intergenic
1137399302 16:48140498-48140520 CAGAGGAGTTCAGAGAGGGAGGG - Intronic
1137964137 16:52914223-52914245 GAGGGGAGTTCAGCTAGGGGAGG + Intergenic
1138494839 16:57401890-57401912 TTGGGGAGTGAAGACAGAGAAGG - Intergenic
1138647843 16:58438249-58438271 TGGGGAAGTGCAGACAGGGGTGG - Intergenic
1140430594 16:74899532-74899554 TGGGGGAGTTCAGACACCAAGGG - Intronic
1141097046 16:81170342-81170364 TAGGGGGTGTGAGACAGGGAAGG + Intergenic
1141625016 16:85256640-85256662 TGGGTGTGTTCAGGCAGGGATGG - Intergenic
1143129218 17:4665567-4665589 TAGGGGGGTTCAGAGATGGGTGG - Intergenic
1143281951 17:5761370-5761392 CAGGGGAGGTGACACAGGGAAGG + Intergenic
1143345010 17:6242981-6243003 TCGGGGAGGTGGGACAGGGAGGG - Intergenic
1143381005 17:6496359-6496381 TGGCTGAGTTCAGAGAGGGAGGG - Intronic
1143686831 17:8524077-8524099 TAGGGGAGACCAGAAAGAGATGG + Intronic
1144398681 17:14872386-14872408 AAGGTGAGTTCAGCCAAGGAAGG - Intergenic
1144830314 17:18127430-18127452 AAGGGGAGTCCACATAGGGAAGG + Intronic
1145279512 17:21457597-21457619 TAGGGCAGTCCAGGCAGGGGGGG - Intergenic
1146526662 17:33572572-33572594 TAGGGGAGTTCTGAAACTGAAGG + Intronic
1147307888 17:39576269-39576291 TAGGGCAGGCCAGCCAGGGATGG - Intergenic
1148245910 17:46030756-46030778 CATGGGAGAGCAGACAGGGAAGG + Exonic
1149206438 17:54253585-54253607 GAGGGGAGTTCAGCTGGGGACGG - Intergenic
1149862213 17:60128404-60128426 GAAGGGAGCCCAGACAGGGAAGG + Intergenic
1151017991 17:70579000-70579022 TAAGAGAGTTCAAAGAGGGAGGG + Intergenic
1151107041 17:71627002-71627024 TAGCAGAGTTCACACAGGGCTGG + Intergenic
1151653732 17:75485848-75485870 CTGGGAAGTTCGGACAGGGAGGG - Intronic
1151996969 17:77615876-77615898 CATGAGGGTTCAGACAGGGAAGG - Intergenic
1153378758 18:4412008-4412030 CAGGGGAGTTAAAGCAGGGAAGG + Intronic
1155450640 18:25959367-25959389 TGGGGGAGTACAGGGAGGGAAGG + Intergenic
1156205020 18:34875904-34875926 TAGAGGAGTACAAAGAGGGATGG + Intronic
1157724687 18:49954872-49954894 TAGGTGAGTTTAGGGAGGGAAGG - Intronic
1161200011 19:3009433-3009455 CAAGGGAGTGCAGAAAGGGAAGG - Intronic
1162324947 19:9993448-9993470 GAGGGGAGTTCAGAGTGGAAGGG + Intronic
1162856139 19:13469944-13469966 TAGTTGAGTTCATGCAGGGATGG - Intronic
1163631121 19:18418403-18418425 CAGGGGTGTTCAGAGAGGGTGGG - Intergenic
1163817588 19:19476223-19476245 GAGAAGAGTTCAGACAGAGAAGG - Intronic
1165556976 19:36642527-36642549 TGGGGAAGTGCAGGCAGGGAGGG + Intronic
1166686355 19:44798847-44798869 TAGGGGAGATCAGAGAGGTGGGG - Intronic
1167038483 19:47008313-47008335 TTGGTGAGATCAGACAGGGCTGG - Intergenic
1168414615 19:56160324-56160346 TTGGGAAGTTCAGACAAGGGAGG - Exonic
1168694266 19:58396050-58396072 GAGAGGAGGTCAGGCAGGGAAGG - Intergenic
925333235 2:3074864-3074886 GAGGGGAGTTCAGCCAGAGGTGG - Intergenic
926275422 2:11399886-11399908 AAGGGGGGTCCAGGCAGGGAGGG - Intergenic
928373926 2:30760030-30760052 TAGGGTAGGGCAGACAGGGGTGG - Intronic
928934341 2:36659344-36659366 GAGGGGAGGACAGAAAGGGAGGG + Intergenic
930259444 2:49127675-49127697 TAGGGGAATTCAGACAAGACAGG - Intronic
933524014 2:83412587-83412609 TAAGGATGTTCAGAGAGGGATGG + Intergenic
934099622 2:88640775-88640797 TAGTGGAGTACAGCTAGGGACGG + Intergenic
936643309 2:114340938-114340960 GAGGGCTGTTCAGACATGGACGG - Intergenic
937343113 2:121104598-121104620 CAGAGGAGTTCAGTCAGGGGAGG + Intergenic
939382535 2:141454430-141454452 TAGGGCAGTGCACGCAGGGAAGG - Intronic
940329080 2:152455147-152455169 AAGGGGAGGTCAGGCAGGGAGGG + Intronic
941262065 2:163309815-163309837 TAGGGGAGCTCACACATGGAAGG + Intergenic
943180447 2:184534267-184534289 TAAGGGAATTAACACAGGGACGG + Intergenic
943321251 2:186445721-186445743 TATGGGAGTTAGGTCAGGGAGGG + Intergenic
944948859 2:204723707-204723729 AAGGGGAGTTGAGGCAGTGAGGG + Intronic
945456422 2:210057009-210057031 TAGGGGCATACACACAGGGATGG - Intronic
945491142 2:210456726-210456748 TAGGAGAGTTCAGGCAGCAATGG - Intronic
946133004 2:217622115-217622137 TAGGGGACTGCAGAGAGGGGAGG - Intronic
947863135 2:233376898-233376920 CAGGGTAGATGAGACAGGGAAGG - Intronic
948665770 2:239533940-239533962 TATGGTACTACAGACAGGGAAGG - Intergenic
1169383478 20:5127855-5127877 TAGGGGAGTTAAGGAAGGTAGGG + Intronic
1169395773 20:5227776-5227798 TAGAGAAGAACAGACAGGGAAGG + Intergenic
1169901761 20:10560242-10560264 CAGGGGACTGTAGACAGGGATGG - Intronic
1172044616 20:32071531-32071553 CAGGGGAGTTAAGACCGGGAAGG + Intronic
1172286668 20:33745476-33745498 TAGGGGATGCCAGACGGGGATGG + Intronic
1172331702 20:34080105-34080127 CTGGGCAGTGCAGACAGGGAGGG - Exonic
1172846754 20:37934242-37934264 CAGGGGAGTTCAGGGAGTGACGG + Intronic
1173473285 20:43339770-43339792 TAGGGGAAGTGAGACAGAGAAGG - Intergenic
1175285895 20:57836518-57836540 TAGGGAGGTTTAGTCAGGGAAGG - Intergenic
1175767429 20:61601207-61601229 TAGGGGAGCACAGAGGGGGAAGG + Intronic
1178042109 21:28650527-28650549 TATAGGAGTTGAGAGAGGGAAGG + Intergenic
1181020877 22:20101670-20101692 TGGGGGTGTTTAGACAGGGGTGG + Intronic
1182154298 22:28054636-28054658 GAGGGGAGCCCACACAGGGAGGG - Intronic
1182335457 22:29580803-29580825 TGGGGGAGGTGAGAAAGGGATGG - Intronic
1183961509 22:41414190-41414212 TAGGGGAGCCCAGACTGCGAAGG + Intergenic
1183978473 22:41526529-41526551 TAGGGGAGTGGAAACTGGGAAGG + Exonic
1184244722 22:43230252-43230274 GAGGGGAGTTCAGATGGGGCTGG - Intronic
1184688400 22:46106640-46106662 TTGGGGAAGCCAGACAGGGAGGG + Intronic
949841160 3:8321546-8321568 TAAGGGAGTACAGAGAGAGAGGG - Intergenic
951859994 3:27241631-27241653 TAGGGGAAGTGAGACAGGGTAGG - Intronic
952109760 3:30109037-30109059 GAGAGGAGTTCGGCCAGGGACGG + Intergenic
953095255 3:39768432-39768454 GTGGGGAGGTGAGACAGGGAAGG - Intergenic
953179631 3:40583665-40583687 TAGGAGGGTTCAGAAAAGGAAGG + Intergenic
953932468 3:47012544-47012566 GTTGGGAGTCCAGACAGGGAAGG - Intergenic
954092292 3:48294808-48294830 AAGGGGAGATAAGACAGAGAAGG + Intronic
954271041 3:49509405-49509427 TAGGGGAGTGGGGACAGAGAAGG - Intronic
954420498 3:50416538-50416560 GAGGGGAGGGCAGACAGGAATGG + Intronic
954442536 3:50529765-50529787 GGGTGGAGTTCAGGCAGGGATGG - Intergenic
956982435 3:74654473-74654495 AAGGGGAATTCAGCCAGGGGTGG + Intergenic
961082157 3:124035502-124035524 AAGTGGAGTCCAGAAAGGGAAGG - Intergenic
962048144 3:131783323-131783345 AAGGGGAGCTCAGACATGGATGG - Intronic
966936519 3:184713076-184713098 GAGGGCATTTCTGACAGGGAAGG - Intergenic
967269696 3:187722840-187722862 TTGTGGAGTTAAGGCAGGGAAGG - Intronic
968951176 4:3693095-3693117 TGGGGGAGGACGGACAGGGAAGG - Intergenic
969230347 4:5826362-5826384 GTGGGGAGCTGAGACAGGGAGGG + Intronic
971200774 4:24507615-24507637 TAGGGAAGTGTGGACAGGGAAGG + Intergenic
972876735 4:43371506-43371528 GAGGGAAGATCAGAGAGGGAAGG + Intergenic
973881340 4:55274196-55274218 TAGGGAGGATGAGACAGGGAAGG - Intergenic
975218037 4:71779848-71779870 TAGGGCTGTTTTGACAGGGAAGG + Intronic
976782346 4:88775109-88775131 TATGGGAGCTTAGCCAGGGAAGG + Intronic
979043699 4:115834639-115834661 CAGGGAAGTTCAGACTGGGTGGG + Intergenic
980603541 4:135058990-135059012 GAGAAGAGTTCAGCCAGGGATGG + Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
981592235 4:146376537-146376559 GAGAAGAGTTCAGACAGGGATGG + Intronic
982774426 4:159427480-159427502 TAGAGGAGTTCAGATAGAGGTGG + Intergenic
982789704 4:159576641-159576663 AAGGGAAGTTCAGTTAGGGAAGG + Intergenic
984632095 4:182072053-182072075 TATGGGTGATCAGACAGTGATGG - Intergenic
984922574 4:184778548-184778570 TATGGGAGCTCAGTCAAGGAGGG - Intronic
985293168 4:188406938-188406960 GAGAGGAGTTCAGCTAGGGATGG + Intergenic
986163205 5:5249966-5249988 GAAAGGAGTTCAGCCAGGGATGG - Intronic
987821308 5:22970228-22970250 TAGGAGTGGTCAGCCAGGGATGG + Intergenic
989261780 5:39426382-39426404 TAGGGGTGTGGAGGCAGGGAGGG + Intronic
990297633 5:54419649-54419671 TAGGGGATTTCTGCCAGGGATGG - Intergenic
990463138 5:56047885-56047907 GAGGGGAGTTTGGCCAGGGATGG + Intergenic
991637010 5:68716371-68716393 TATGGGAATTGAGACAAGGAAGG - Intergenic
994781431 5:104095128-104095150 TATGGGATTTCAGACTTGGATGG - Intergenic
995011930 5:107265905-107265927 TAGGTGAGGCCAGACAAGGAAGG - Intergenic
995634203 5:114166879-114166901 TAGTGGAGGGCAGACAGAGATGG - Intergenic
997338275 5:133122892-133122914 TGGGGGAGAAGAGACAGGGAAGG - Intergenic
998064922 5:139150393-139150415 TAGGGGATAGAAGACAGGGAAGG - Intronic
998109839 5:139492651-139492673 GAGAGGAAGTCAGACAGGGAGGG + Intergenic
999171339 5:149597806-149597828 TCAGGGAGTCCGGACAGGGAAGG + Exonic
1000332655 5:160218215-160218237 TAAGTGAGTTCAGCCAGGGGTGG - Intronic
1000867941 5:166538348-166538370 GAGGGGAGTTCAGCAGGGGACGG + Intergenic
1001977234 5:176010011-176010033 GAGGGGAGTTCAGCCGCGGATGG + Intronic
1002240191 5:177833769-177833791 GAGGGGAGTTCAGCCGCGGATGG - Intergenic
1004750441 6:18557036-18557058 TTGGGGAATTCTGAGAGGGAGGG - Intergenic
1006167011 6:32071006-32071028 CCGGGGAGCTCAGGCAGGGAAGG + Intronic
1006488131 6:34361844-34361866 TAGGGGTGAGCAGAGAGGGAGGG + Intronic
1007615956 6:43179986-43180008 AAGGGGAGTTTGGGCAGGGAGGG - Exonic
1013018168 6:106180197-106180219 TACTGGAGTTAACACAGGGATGG + Intergenic
1013246905 6:108295283-108295305 TGGGGTAGATCGGACAGGGAGGG - Intronic
1014074440 6:117220202-117220224 AAGGGGAGTTAAGTCAGGGCAGG + Intergenic
1015254591 6:131163818-131163840 TAGGTGAGCTCAGATATGGAGGG + Intronic
1015504261 6:133965509-133965531 GAGGGGAGTGGGGACAGGGAAGG - Intronic
1015851906 6:137582928-137582950 AAGGTGAGAACAGACAGGGAAGG + Intergenic
1016533998 6:145090705-145090727 TAGAGGAGTTCAGCTGGGGATGG - Intergenic
1018526050 6:164710721-164710743 AAGCGGAGTTCAGCCAGGGGTGG - Intergenic
1019715332 7:2536205-2536227 TGGGGGAACTCAGAGAGGGAGGG - Intergenic
1019741486 7:2676935-2676957 TGGGGGAACTCAGAGAGGGAGGG + Intergenic
1019932802 7:4234790-4234812 CTGGGGGGTTCAGAGAGGGATGG + Intronic
1020079061 7:5276757-5276779 CAGTGGAGATCAGACAGAGATGG - Intronic
1020251696 7:6474352-6474374 GCAGGGAGTGCAGACAGGGAAGG + Intronic
1024986731 7:55200623-55200645 GAGGAGAGTTCAGACGGGGAGGG - Intronic
1025199837 7:56955421-56955443 CAGTGGAGATCAGACAGAGATGG + Intergenic
1025672108 7:63621511-63621533 CAGTGGAGATCAGACAGAGATGG - Intergenic
1026141887 7:67713504-67713526 TAGGGGAGCTGATGCAGGGATGG - Intergenic
1027186825 7:75977224-75977246 GAAGGGATTTCACACAGGGAAGG + Intronic
1027238672 7:76313336-76313358 TAGTGGAGCTGAGTCAGGGAGGG - Intergenic
1029149526 7:98470272-98470294 GAGGGGAGGGGAGACAGGGAAGG + Intergenic
1032175965 7:129626108-129626130 TAAGGCAATTCAGCCAGGGATGG - Intronic
1032406000 7:131655951-131655973 TAGGAGAGTGGAGACAGGGCAGG + Intergenic
1033527700 7:142232681-142232703 TAGGGGAGTTCAGCTGGGGGCGG - Intergenic
1033642188 7:143272191-143272213 TAGGGAAGTACAGGGAGGGAGGG - Intergenic
1034553644 7:151836562-151836584 GAGGGGAATTCACACTGGGAAGG - Intronic
1035824431 8:2629268-2629290 GAGTGGAGTTCAGCCAGAGACGG - Intergenic
1035850610 8:2915723-2915745 TGGGGGAGTCCAGAGAGAGATGG - Intergenic
1035912951 8:3588463-3588485 CAGGGGAGTTCAAACAGAAAGGG + Intronic
1039050072 8:33484808-33484830 GAGGGGAGGCCCGACAGGGAGGG + Exonic
1039290456 8:36088947-36088969 GAGAGGAGTTCAGCCAGGAAAGG - Intergenic
1045512205 8:102820769-102820791 TATAGGAGGTCAGTCAGGGAAGG - Intergenic
1048439591 8:134450251-134450273 GAGAGGAGTCCAGCCAGGGATGG + Intergenic
1048648711 8:136451026-136451048 AAGGGGAGTTCAACCAGGGGCGG - Intergenic
1048670367 8:136712509-136712531 TAAGGGATTTTAGAAAGGGAGGG - Intergenic
1050461069 9:5877840-5877862 TAGAGGAATTCATACAGGAAAGG + Intergenic
1051116315 9:13698112-13698134 TAGTGGAGCACAGCCAGGGAAGG - Intergenic
1051491840 9:17674996-17675018 AAGGGGTGTGCATACAGGGATGG + Intronic
1052438721 9:28465328-28465350 GAGAGGAGTTCAGCCGGGGATGG - Intronic
1056159662 9:83875914-83875936 AAGGGGAGGTAAGAAAGGGATGG + Intronic
1056580734 9:87886805-87886827 TAGGGGAGATCAAAGAGGGCTGG + Exonic
1060587895 9:124797955-124797977 AAGGGGAGATGAGGCAGGGAAGG + Intronic
1061342284 9:129992097-129992119 CAGGAGAGTACAGACTGGGAAGG + Intronic
1061774059 9:132948856-132948878 GAGGGGAGCCCAGACAGAGAAGG - Intronic
1061874984 9:133539181-133539203 TAGGGCAGTGCAGCCAGGGTTGG + Intronic
1185778095 X:2822308-2822330 TTGAGGTGGTCAGACAGGGAGGG - Intergenic
1185876098 X:3703557-3703579 TAAAGGTGTTCAGACAGGGTAGG + Intronic
1187046785 X:15655165-15655187 GAGGGGAGCACAGGCAGGGAGGG - Intronic
1187053014 X:15713360-15713382 GAGGGGAGCACAGGCAGGGAGGG - Intronic
1187597966 X:20795942-20795964 GTGGGGAGGTAAGACAGGGAAGG + Intergenic
1189175836 X:38956321-38956343 GAGGGGAATTGACACAGGGAAGG - Intergenic
1189248926 X:39585016-39585038 TAGGAGAGTGCAGAGAGGGATGG - Intergenic
1189391874 X:40583297-40583319 TAGTGGAGTTCCTAGAGGGAAGG + Intronic
1189481289 X:41394184-41394206 CAGGGGAGGTGAGACAGGGCAGG - Intergenic
1196243471 X:113370389-113370411 GAGGGGAGTTCAGGCAGGACTGG - Intergenic
1196468102 X:115993397-115993419 TAGTGGAGTATAGCCAGGGATGG + Intergenic
1197771510 X:130092348-130092370 TCAGGGAGTGCAGAGAGGGAAGG + Intronic
1198244093 X:134812635-134812657 TAGGGGAATTCAAAGAAGGAAGG + Intronic
1199575699 X:149311829-149311851 GAGAGGAGTTCAGTCAGGGATGG - Intergenic
1199938120 X:152597649-152597671 TAGGGGAGTTAAGAAAAGTAAGG - Intergenic
1200789485 Y:7286865-7286887 TAAAGGTGTTCAGACAGGGTAGG - Intergenic
1201583793 Y:15538194-15538216 TAGGGGAGAACAGAGAGGGTTGG + Intergenic