ID: 1097192320

View in Genome Browser
Species Human (GRCh38)
Location 12:57225424-57225446
Sequence CCCGGGCTTGGGGGCTCCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097192307_1097192320 8 Left 1097192307 12:57225393-57225415 CCCGCTGGGGATGGCAGCAGCAG 0: 1
1: 1
2: 9
3: 43
4: 372
Right 1097192320 12:57225424-57225446 CCCGGGCTTGGGGGCTCCCTCGG 0: 1
1: 0
2: 5
3: 29
4: 311
1097192301_1097192320 22 Left 1097192301 12:57225379-57225401 CCTGGGCTGGGGCCCCCGCTGGG 0: 1
1: 1
2: 2
3: 80
4: 655
Right 1097192320 12:57225424-57225446 CCCGGGCTTGGGGGCTCCCTCGG 0: 1
1: 0
2: 5
3: 29
4: 311
1097192306_1097192320 9 Left 1097192306 12:57225392-57225414 CCCCGCTGGGGATGGCAGCAGCA 0: 1
1: 0
2: 3
3: 20
4: 253
Right 1097192320 12:57225424-57225446 CCCGGGCTTGGGGGCTCCCTCGG 0: 1
1: 0
2: 5
3: 29
4: 311
1097192308_1097192320 7 Left 1097192308 12:57225394-57225416 CCGCTGGGGATGGCAGCAGCAGC 0: 1
1: 0
2: 7
3: 37
4: 367
Right 1097192320 12:57225424-57225446 CCCGGGCTTGGGGGCTCCCTCGG 0: 1
1: 0
2: 5
3: 29
4: 311
1097192305_1097192320 10 Left 1097192305 12:57225391-57225413 CCCCCGCTGGGGATGGCAGCAGC 0: 1
1: 0
2: 0
3: 22
4: 215
Right 1097192320 12:57225424-57225446 CCCGGGCTTGGGGGCTCCCTCGG 0: 1
1: 0
2: 5
3: 29
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097192320 Original CRISPR CCCGGGCTTGGGGGCTCCCT CGG Exonic