ID: 1097194423

View in Genome Browser
Species Human (GRCh38)
Location 12:57235810-57235832
Sequence CTGTGGAGCAGGAGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1287
Summary {0: 1, 1: 1, 2: 7, 3: 122, 4: 1156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097194411_1097194423 8 Left 1097194411 12:57235779-57235801 CCAGGGCTCCGGGTTGTTCTTTC 0: 1
1: 0
2: 2
3: 19
4: 135
Right 1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG 0: 1
1: 1
2: 7
3: 122
4: 1156
1097194412_1097194423 0 Left 1097194412 12:57235787-57235809 CCGGGTTGTTCTTTCTGTCCCAG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG 0: 1
1: 1
2: 7
3: 122
4: 1156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097194423 Original CRISPR CTGTGGAGCAGGAGGGGGGA GGG Intronic
900117068 1:1033457-1033479 CTGGGGAGCAGGAGCTGGGCCGG - Intronic
900145593 1:1157561-1157583 GTGTGGAGCAGGAAGGGGGAAGG + Intergenic
900159099 1:1215114-1215136 CTGGGGAGCAGGTGCGGGGCTGG + Intergenic
900183449 1:1322527-1322549 CTTTTGAGCAGGGGAGGGGAGGG + Intronic
900226292 1:1535031-1535053 CTGGGGGGCAGGTGGGGGCAGGG - Intergenic
900351897 1:2238946-2238968 GTGTGGACCTGGAGGGGGGTGGG + Intronic
900555775 1:3279666-3279688 CTGTGCTGCAGGAGGGCAGAGGG + Intronic
900719443 1:4165807-4165829 CTGAGAAGCAGGAAGGGGGCTGG - Intergenic
900931120 1:5738469-5738491 CTATGGAGAAGGGTGGGGGAGGG - Intergenic
900948248 1:5843366-5843388 CTATGGAGCAGGAGGGGTCAGGG + Intergenic
901411645 1:9088344-9088366 AGGTGGAGAAGGAGGAGGGAGGG - Intronic
901508386 1:9701005-9701027 CTGCGGAGAAGCAGGGAGGAAGG - Intronic
901630763 1:10647090-10647112 CTGGGGAGGAGGAGGGGGAGGGG + Intronic
901637537 1:10677272-10677294 CGCTGGAGCAGGAGGGGGCAGGG + Intronic
901798347 1:11692937-11692959 CTGTGGAGGAAGGGAGGGGAGGG + Intronic
902077628 1:13800504-13800526 ATGTGGAGGAAGAGGGGAGACGG + Intronic
902137951 1:14326902-14326924 CTATAAAGCAGGATGGGGGAGGG - Intergenic
902220833 1:14963777-14963799 CTGTTGGGCAGTAGGGGGCAAGG - Intronic
902280572 1:15371348-15371370 TAGTGGAGGAGGACGGGGGAGGG + Intronic
902404123 1:16173790-16173812 CTGGGGGGCAGGTGGGGGGCAGG + Intergenic
902661462 1:17906918-17906940 CTGTGGAGGAGGAGGGAGCTGGG + Intergenic
902700304 1:18167749-18167771 CTGTACAGCAGGAGTGGGGATGG - Intronic
902763426 1:18599267-18599289 CTGGGGAGCGGGAGTGGGGCTGG - Intergenic
902770437 1:18642728-18642750 GGGTGGAGCAGGGGGAGGGAGGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903294591 1:22335705-22335727 CTGAGCAGGAGGAGGGAGGAGGG - Intergenic
903333979 1:22612854-22612876 CCGTGGAGAGGGAGGGAGGAGGG - Intergenic
903380835 1:22895961-22895983 CTTAGGAGGAGGAGGGGGGAGGG + Intronic
903542957 1:24107181-24107203 CCGTGGAGCTGGAGGAGCGAGGG - Exonic
903576439 1:24342397-24342419 GGGTGGAGGAGGAGAGGGGAAGG - Intronic
903850351 1:26301926-26301948 CAGTGGAGAAGGATGGGGAAGGG + Intronic
904319812 1:29689505-29689527 CTGTAACGCCGGAGGGGGGAGGG - Intergenic
904424836 1:30416555-30416577 ATGGGGAGCAGGAGGGGACAGGG + Intergenic
904441403 1:30534367-30534389 CTGTGGGGCAGTAGGGGGGTGGG - Intergenic
904526306 1:31136395-31136417 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
904614409 1:31742246-31742268 CTGTTGAGCAGGATGTGTGAGGG + Intronic
905004009 1:34695879-34695901 CTGTGGAGCAGAATGGGAAATGG - Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905393198 1:37651153-37651175 TTGTGGAGCAGCAGGTGGAAGGG - Intergenic
905409086 1:37755965-37755987 CTGTGTGGCAGAAGAGGGGAGGG + Intronic
905792012 1:40794849-40794871 CTGTGGAGCCAGAAGAGGGAGGG + Intronic
906117008 1:43363760-43363782 CTGTAGAGCAGCTGTGGGGAGGG + Exonic
906138775 1:43520648-43520670 GTGGGGAGCTGGATGGGGGAGGG + Intergenic
906139372 1:43524636-43524658 CTGAGAAGCAGGAGTGGGTAGGG + Intergenic
906271442 1:44482335-44482357 CAGGGGAGCAGGAGGGGTGGAGG + Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
906939502 1:50244072-50244094 CTGTCGGGCAGGGGTGGGGAGGG - Intergenic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
908516465 1:64897490-64897512 GGGGGGAGGAGGAGGGGGGAGGG + Intronic
908534643 1:65066740-65066762 CGGAGGAGGAGGAGGAGGGAGGG - Intergenic
910476199 1:87609973-87609995 CTGTAGAGCAAGAGGTGAGAAGG - Intergenic
911253224 1:95604133-95604155 CTGAGGAGCAGGATGGCGGTGGG + Intergenic
911744503 1:101425622-101425644 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
912306072 1:108568806-108568828 CTGGGAAGGAGGAGAGGGGAAGG + Intronic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
912490026 1:110057669-110057691 CTGTGGAGGAGGCTGGGGCAGGG + Intronic
913088275 1:115458828-115458850 TATTGGAGCAGGAGGGTGGATGG - Intergenic
913099709 1:115551855-115551877 CTGTGGAGCAGAGAGGGTGAAGG - Intergenic
913565583 1:120069497-120069519 CTTTGAAGCAGGAGGAGGGGAGG - Exonic
913632547 1:120724056-120724078 CTTTGAAGCAGGAGGAGGGGAGG + Intergenic
914286180 1:146228872-146228894 CTTTGAAGCAGGAGGAGGGGAGG - Exonic
914451853 1:147799685-147799707 CGGTGGGGCAGGAGGGGGAGTGG + Intergenic
914547208 1:148679616-148679638 CTTTGAAGCAGGAGGAGGGGAGG - Intronic
914619295 1:149390730-149390752 CTTTGAAGCAGGAGGAGGGGAGG + Intergenic
914703609 1:150154219-150154241 CTCTGGAGAAGGAGGGGGAGAGG + Intronic
914718850 1:150272729-150272751 CTTTGGAGGAGGAGGGGAGGCGG + Intronic
914902258 1:151717002-151717024 CTGGGGAGTAAGATGGGGGAAGG - Intronic
915095624 1:153460255-153460277 CTGTGGAGCTGGAGCTGGGGAGG + Intronic
915117126 1:153608221-153608243 GTGTGGAGGAGGAGGAGGTATGG - Intronic
915341155 1:155177464-155177486 CTGGGCTGCAGGAGGGGGCAGGG + Intronic
915807752 1:158872433-158872455 CTGTTGTGCAGTGGGGGGGAGGG + Intergenic
916290865 1:163164972-163164994 CTGTTGGGCAGGAAGGGAGAGGG - Intronic
916332049 1:163628292-163628314 GAGGGGAGGAGGAGGGGGGAGGG - Intergenic
916817555 1:168368433-168368455 GTGTGGAGCAGGGGTTGGGAAGG + Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
916951576 1:169785489-169785511 ATGGGGAGCTGGAAGGGGGATGG + Intronic
917087576 1:171319196-171319218 CTGGGGAGCTGGAAAGGGGATGG + Intronic
917716048 1:177739144-177739166 CTGTGTAGAGGGAGCGGGGAAGG + Intergenic
917737624 1:177934967-177934989 GTGGGGAGCAGTAGGGAGGAGGG - Intronic
917790599 1:178496508-178496530 CTGTGGACCAGGGGGCGGCAAGG - Intergenic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918050377 1:180968164-180968186 CTGTGGTGCAGGGGTTGGGATGG - Intergenic
918060919 1:181060673-181060695 CTGTGGTGCAGGGGTTGGGATGG - Exonic
918958856 1:191244851-191244873 CTGTGGAGCAGGGCGGTGGGAGG - Intergenic
919207673 1:194437789-194437811 CTGGGGTGGAGGTGGGGGGAAGG - Intergenic
919299684 1:195744209-195744231 CTGTGGACCAGAATGGGGCAGGG + Intergenic
919451326 1:197775568-197775590 CTGTGGAGGAGGCGGGGGCCAGG + Intronic
919861233 1:201740475-201740497 CTGGGGACCAGGCGGGTGGAAGG + Intronic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
919977685 1:202623398-202623420 CTCTGGAGAAGGAGGTGGGAAGG - Intronic
920047299 1:203141520-203141542 CTTGGGGGCAGGAGAGGGGACGG + Intronic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920406833 1:205721104-205721126 CTGTGGCGAGGGAGGGGGCAGGG + Intronic
920655003 1:207868512-207868534 GTGTGGAGGAGGAGGCGGGAAGG - Intergenic
921498890 1:215875987-215876009 CTATGGAGGGGGCGGGGGGAAGG + Intronic
922083182 1:222318209-222318231 ATGTGGAGAAGGAGGGCGGGCGG - Intergenic
922184668 1:223263613-223263635 CTTTGGAGAAGGATGGGGGAAGG - Intronic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922471594 1:225880427-225880449 CTGAGGAGAAGGCAGGGGGAGGG + Intronic
922680447 1:227590872-227590894 CTGTATAGCAAGAGTGGGGAAGG - Intronic
922689440 1:227676663-227676685 GTGGGGAGGGGGAGGGGGGAGGG - Intronic
922690413 1:227684740-227684762 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
922724399 1:227915705-227915727 CTGGAGAGGAGGAGGGGGAAGGG - Intergenic
922740320 1:228010734-228010756 CTGTGGAGCAGGCCAGGGGCAGG - Intronic
922790054 1:228306357-228306379 CTGTGGGGCTGCAGGGGGCAGGG - Exonic
923529594 1:234803128-234803150 AAGGGGAGGAGGAGGGGGGAAGG - Intergenic
923887294 1:238173244-238173266 GGCTGGAGCAGGAGGTGGGAGGG - Intergenic
924129818 1:240895429-240895451 ATGGGGTGGAGGAGGGGGGAGGG - Intronic
924776007 1:247114768-247114790 CTGGGTAGCAGGCGGGGGGTGGG + Intergenic
924818681 1:247466293-247466315 TTGTGAAGCGGGAGTGGGGAAGG - Intergenic
1062769621 10:88452-88474 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1063309430 10:4938422-4938444 CTAGGGAGCAGGAGGGGGACTGG + Intronic
1063393055 10:5662523-5662545 CTGTCGAGAAGGGGGGGGGAGGG + Intronic
1063576518 10:7266526-7266548 GTGGGGAGCTGGAGGGGGCACGG + Intronic
1063906430 10:10784493-10784515 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064353414 10:14597563-14597585 CTGAGGAGCAGGTGGGGACAAGG + Intronic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1064723720 10:18256570-18256592 CTGTGGAGGAGGCGGGGGAGTGG - Intronic
1064729493 10:18315584-18315606 CTCTGGAGCCTGAGGTGGGAGGG + Intronic
1065200741 10:23310630-23310652 CAGAAGAGCAGGAGGGGTGATGG - Intronic
1066224131 10:33365811-33365833 CAGGGGAGAAGGAAGGGGGATGG - Intergenic
1067008688 10:42690543-42690565 CTTTGGAGCAGTAGGTAGGAGGG - Intergenic
1067031662 10:42882193-42882215 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1067448421 10:46367037-46367059 ATGTGGAGGGGGTGGGGGGAAGG + Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067588954 10:47493729-47493751 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1067590386 10:47503546-47503568 GTGTGGAACAGGAGGAGGAATGG + Intronic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067636080 10:48001820-48001842 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1067637508 10:48011648-48011670 GTGTGGAACAGGAGGAGGAATGG + Intergenic
1067875985 10:50008686-50008708 GTGTGGAACAGGAGGAGGAATGG - Intronic
1068390836 10:56394882-56394904 CTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1068568863 10:58606412-58606434 CTGGGGTGGGGGAGGGGGGAGGG + Intronic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1069333478 10:67321000-67321022 GGGTGGAGCAGGAGGGAGGATGG - Intronic
1070132639 10:73665827-73665849 ATGTGGAGGGGGTGGGGGGAAGG - Intergenic
1070399585 10:76041667-76041689 GTTTGGAGCATGAGGGAGGAGGG - Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070756409 10:78996163-78996185 CTGTGTAGCAGGAGGGGGGAGGG - Intergenic
1070923982 10:80205878-80205900 CGGTGGTGGTGGAGGGGGGAAGG + Intergenic
1071755154 10:88529139-88529161 CTGAGGAGTGGGAGGAGGGATGG - Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1072972031 10:100025696-100025718 ATGTGGAGCTGGAAAGGGGATGG + Intergenic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073062600 10:100741482-100741504 ATGGGGAGGAGGAGGGGGAAAGG + Intronic
1073098939 10:100997183-100997205 CGCTGGAGCAGGAGCGGGGCCGG + Intronic
1073137154 10:101226374-101226396 CTGTGGAGGAGGTGAGGTGAGGG + Exonic
1073152746 10:101323012-101323034 GAGAGGAGCAGGAGGAGGGAGGG + Intergenic
1073212739 10:101818155-101818177 CTGCGGAGAGGGAGGGGGAAGGG - Exonic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1073458841 10:103653911-103653933 CTGGGCAGCAGGAGGTGGGAGGG - Intronic
1073747199 10:106482556-106482578 CTGTGGAGGAGATGGGGCGAAGG - Intergenic
1074135287 10:110620222-110620244 CAGTGGAGGAGGTGGGGGAAGGG + Intergenic
1074162656 10:110846893-110846915 ATGTGGAGCTGGAAGGAGGAAGG - Intergenic
1074501586 10:114029852-114029874 CGGTGGAGGAAGAGGTGGGAGGG - Intergenic
1074710049 10:116169681-116169703 ATGTGGAGCTGGAAAGGGGATGG - Intronic
1075013177 10:118892066-118892088 CTATGGACCAGGATGGGGGTGGG + Intergenic
1075073694 10:119336246-119336268 CTGTGGAGCCGTGGGGAGGAAGG - Intronic
1075375615 10:121975576-121975598 CTGTGGAGCAGGATGAGCGCGGG + Intergenic
1075549085 10:123378982-123379004 ATGCTGAGCAGGAGGGGGCATGG + Intergenic
1075551965 10:123399641-123399663 CTGTGCATCAGGAAGGGCGAAGG - Intergenic
1075586865 10:123664974-123664996 CTGTGGGGAAGGGGTGGGGATGG - Intergenic
1075614297 10:123880401-123880423 CAGGGGAGCAGAAGGGGAGATGG - Intronic
1075704933 10:124494842-124494864 CTGTGGAGCAGGCTGGGGCTGGG + Intronic
1075724818 10:124605838-124605860 CAGTGGAGGGGGAGGGGGAAGGG + Intronic
1076131644 10:128017822-128017844 CTGTGGTACAGGAGGTGGGTAGG + Intronic
1076312539 10:129518561-129518583 CTGGGGAGGGGGAGGGGGAAGGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077026446 11:442021-442043 CGCTGGAGGAGGAGGAGGGAGGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077048986 11:558311-558333 CAGTGGCGAAGGAGGGGAGAAGG + Intronic
1077142688 11:1031356-1031378 CAGATGAGCAGGTGGGGGGATGG - Intronic
1077239496 11:1503127-1503149 CTGTGGAGAAGGGATGGGGAGGG + Intergenic
1077323242 11:1951840-1951862 CTGTGGAGCAGGCCAGGGGTTGG + Intronic
1077327852 11:1971425-1971447 CTGTGGAGCAGGACGCTGGAGGG - Intronic
1077367206 11:2166059-2166081 CTGTGGAGCAGGGAGGATGAAGG + Intronic
1077394999 11:2316338-2316360 CTGAGGGGCAGGAGGTGGGAAGG - Intronic
1077517505 11:3010715-3010737 CAGTGGAGCAGGAGGCAGGAGGG - Intronic
1077602235 11:3581677-3581699 CTGTGGACCAGGCGTGGTGATGG + Intergenic
1077914434 11:6602102-6602124 CTGAGGAGGAGGAGGAGGAAAGG - Exonic
1078412824 11:11141695-11141717 CTGTGGAGCAGGAGGCAATAAGG - Intergenic
1078599157 11:12715389-12715411 CTGGGGAGGAGGAGAGGGTATGG + Intronic
1078660648 11:13282863-13282885 TTGTGGAGGAGGAGATGGGATGG + Intronic
1078807608 11:14721768-14721790 CTGTGGTGCGGGTGGGGGCAGGG + Intronic
1079064299 11:17276447-17276469 CTGTGGAGCAGGACTCGGGCGGG - Intronic
1079135394 11:17773551-17773573 CTGGGGGCCGGGAGGGGGGAGGG + Intronic
1081312586 11:41592129-41592151 ATGAGGAGCTGGAAGGGGGATGG + Intergenic
1081525986 11:43928147-43928169 ATGTTGAGCTGGAGGGGAGACGG + Intronic
1081628133 11:44667658-44667680 CTGTGGAGCAGGAGAGTGCGTGG - Intergenic
1081751368 11:45513536-45513558 CTCTGGAGCAGGGAGGGGTAGGG + Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083079627 11:60077160-60077182 CTGGGGAGCAGGGGACGGGAGGG + Intergenic
1083090201 11:60191695-60191717 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1083296056 11:61716205-61716227 CTGTTGAGCTGGGGTGGGGATGG + Intronic
1083396411 11:62395671-62395693 CAGAGGAGCAGGTGGGGGGCGGG - Intergenic
1083594080 11:63910823-63910845 CCATAGGGCAGGAGGGGGGAAGG - Exonic
1083620524 11:64047187-64047209 CTCTGGGGCAGGGGAGGGGAGGG - Intronic
1083652472 11:64211373-64211395 CGCTGGAGCAGGAGGGGGTCGGG - Exonic
1083903328 11:65654480-65654502 CAGTGGAGCAGGAGCTGGGTCGG + Exonic
1083921207 11:65782027-65782049 ATCTGGAGCAGGATGGGGTAGGG - Intergenic
1084150500 11:67285885-67285907 CTGTGGAGCAGGACAGTGCAGGG - Exonic
1084238203 11:67801665-67801687 TGGTGCAGCAGGAGTGGGGATGG + Intergenic
1084258135 11:67956228-67956250 CTGTGGACCAGGCGTGGTGATGG + Intergenic
1084278305 11:68068214-68068236 GTGTGGTGCAGAAGGGGGAAGGG + Intronic
1084462381 11:69303080-69303102 CTGTGGAGCAGTAGGGAGGCTGG + Intronic
1084480040 11:69414864-69414886 CTGTGGAGCTGTTGGGGAGAAGG + Intergenic
1084642589 11:70434682-70434704 CTGTGGAGGGGGTGGGGAGATGG - Intronic
1084705780 11:70815315-70815337 CTGTGGGGGAGGATGGGGGCAGG + Intronic
1084724767 11:70934366-70934388 CTGAGAAGCAGGAGGGAGGCCGG - Intronic
1084953014 11:72677054-72677076 CTGGGGAACTGGAGGTGGGATGG + Intergenic
1084972509 11:72779657-72779679 CTGAGGAGCAGGGATGGGGAAGG - Intronic
1085013838 11:73159604-73159626 CTATGGGGTAGGAGGGTGGATGG - Intergenic
1085040095 11:73321964-73321986 CTGTGGAGCAGGAAGCGGGGAGG + Intronic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085279614 11:75321279-75321301 CTGAGGAAGAGGTGGGGGGATGG - Intronic
1085310039 11:75510752-75510774 CGGAGGAGGAGGAGGGGGGAGGG - Intronic
1085459739 11:76686395-76686417 AAGTGGAGCAGGGAGGGGGAAGG + Intergenic
1085515541 11:77109753-77109775 CGGTGAAGCAGGAGGGGAAATGG + Intronic
1086231164 11:84571544-84571566 CTGGTGAGCAGGAGGAGGGGAGG - Intronic
1086685359 11:89727900-89727922 CTGGGAAGCGGGAAGGGGGATGG + Intergenic
1087125568 11:94622565-94622587 TTGTGAAGCATGAGGGTGGAGGG + Intergenic
1087629285 11:100631564-100631586 CTGTGGAGCAGAAGACAGGAAGG + Intergenic
1087684836 11:101250807-101250829 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1087896261 11:103589981-103590003 ATGAGGAGCTGGAGAGGGGATGG - Intergenic
1087926884 11:103929221-103929243 CTATGGAGCAAAAGGGGGAAAGG - Intronic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088638655 11:111849625-111849647 CTGTGGAGGGGGCGGAGGGAGGG - Intronic
1089086087 11:115818026-115818048 CTCTGGAGCAGGGGAAGGGAAGG + Intergenic
1089347766 11:117802005-117802027 CTGGGGAGCAGTGGGGTGGAAGG + Intronic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1089640359 11:119843786-119843808 TTGGGGAGGAGGAGGGGGAAAGG + Intergenic
1089678314 11:120105385-120105407 CTGTGGGGCAGGGGGCTGGAAGG + Intergenic
1089781128 11:120874033-120874055 CCGGGGAGCAGGCGGAGGGAGGG - Intronic
1089866178 11:121634173-121634195 CTGTGGAACTGGGTGGGGGAGGG + Intergenic
1090242576 11:125194459-125194481 CTGTGAAGCAGGGTGGGGGTGGG - Intronic
1090600188 11:128362040-128362062 ATGCAGAGCAGGAGGGGTGATGG - Intergenic
1090855583 11:130607323-130607345 CTGAGGAGGAGGTGGAGGGAGGG + Intergenic
1091075180 11:132608857-132608879 CAGTGGAGCAGGAGGAAGCAAGG - Intronic
1091237974 11:134034299-134034321 CTGCAGAGCTGGAGGAGGGAGGG + Intergenic
1091305344 11:134532685-134532707 CTGAGGGGCAGGACGGGAGATGG + Intergenic
1091305722 11:134535012-134535034 CTGAGGAGCAGGACGGGAGATGG + Intergenic
1202806228 11_KI270721v1_random:7035-7057 CTGTGGAGCAGGCCAGGGGTTGG + Intergenic
1202810832 11_KI270721v1_random:26605-26627 CTGTGGAGCAGGACGCTGGAGGG - Intergenic
1091391810 12:130532-130554 CTGTGGAGCATGAGGAGGGCAGG + Intronic
1091447200 12:550892-550914 CAGTGGAGGAGGAGGAGTGAGGG - Intronic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1091632660 12:2173687-2173709 TGGTGGAGCAGGTGGGGGTAGGG - Intronic
1091671701 12:2456746-2456768 CTGAGGAGGAGGAGCGGGGAGGG - Intronic
1091691065 12:2597874-2597896 GTATGAAGCAGGAGGAGGGAAGG - Intronic
1091827697 12:3525335-3525357 CTGAAGAGCAGGAGGGGGCTGGG + Intronic
1092149034 12:6234270-6234292 ATGTTCAGCAGGAAGGGGGAAGG + Intronic
1092204813 12:6608205-6608227 CTGTGGAGCTAGAAGAGGGAAGG - Intergenic
1092408882 12:8239295-8239317 TGGTGCAGCAGGAGGGGGGACGG + Intergenic
1092428378 12:8391030-8391052 CTGTGGACCAGGCGTGGTGATGG + Intergenic
1092429459 12:8397181-8397203 CTGTGGACCAGGCGTGGTGATGG + Intergenic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092583790 12:9876209-9876231 CCGTGGAGCAGGGGGTGGGCCGG + Intergenic
1092658223 12:10710088-10710110 CTGGGGAGGAGGAGGAGGAAGGG - Exonic
1092802742 12:12186833-12186855 GTGAGGATCAGGAGGAGGGAGGG - Intronic
1092875284 12:12842385-12842407 CTGAGGAGCAGGCCTGGGGAAGG - Intergenic
1092944696 12:13441816-13441838 CTATGCAGCAGGCGGGTGGATGG - Intergenic
1093376084 12:18429590-18429612 CTGTGGACTAAGAGGGGGAAGGG - Intronic
1093473246 12:19527720-19527742 GTGTGGAGCAGGTTTGGGGAGGG + Intronic
1093711367 12:22333797-22333819 CTGGGGATCAGGGGTGGGGAAGG + Intronic
1095485607 12:42681257-42681279 CTGAGGAACAGGACTGGGGAAGG - Intergenic
1095802597 12:46283908-46283930 CTGTGAAGCAGCAGGCTGGAGGG + Intergenic
1095919260 12:47513043-47513065 TTGTGGAGGGGGAGGGGAGAGGG + Intergenic
1095921092 12:47532317-47532339 CTGTGAACCAGGTGGGTGGATGG + Intergenic
1096135746 12:49198964-49198986 CTTTGGAGAAGGAAGGGGGCAGG - Intronic
1096139147 12:49227784-49227806 CTGTGGACTAGGATGGCGGAGGG + Intronic
1096754749 12:53789847-53789869 CTCTGGAGAAGGAAGGGGGAGGG + Intergenic
1096886159 12:54721350-54721372 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096886182 12:54721434-54721456 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096918978 12:55063623-55063645 CTGAGAAGCAGGGGTGGGGATGG + Intergenic
1096957081 12:55536993-55537015 TTGTGGGGGGGGAGGGGGGAGGG + Intergenic
1097050716 12:56221642-56221664 CTGGGGTTCAGGAGGAGGGATGG - Intronic
1097102312 12:56598421-56598443 TTGAGGAGCAAGAGGAGGGAAGG + Exonic
1097173041 12:57128189-57128211 CTCTGGAGCACCAGGGAGGAGGG + Intronic
1097194423 12:57235810-57235832 CTGTGGAGCAGGAGGGGGGAGGG + Intronic
1097259688 12:57711121-57711143 CTGTGGGGCTGGAGCAGGGATGG - Intronic
1097453330 12:59764473-59764495 TGGTGGAGGGGGAGGGGGGAGGG - Intronic
1097971914 12:65642190-65642212 CAGCGCAGCAGGAAGGGGGAAGG + Intergenic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098248711 12:68546469-68546491 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1098314879 12:69182519-69182541 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1098744093 12:74213579-74213601 ACGGGGAGCAGGAAGGGGGATGG + Intergenic
1098996377 12:77125477-77125499 CTGGGGAGCAGGAGGGAGCCTGG + Intergenic
1099025469 12:77459688-77459710 CTGTGGACGAGGCTGGGGGAGGG + Intergenic
1099293132 12:80797268-80797290 TTGTGGAGCAGGTGAGGGTAAGG + Exonic
1099348809 12:81538704-81538726 TTGTGGAACAGGATGGGGGCTGG + Intronic
1099394580 12:82121627-82121649 TTGTGGAGCAGGAGTGGACAGGG - Intergenic
1100387012 12:94112949-94112971 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1100698930 12:97125332-97125354 CTGTGGAGGAGGAGGATGTAAGG + Intergenic
1100837570 12:98581210-98581232 CTGTGGGGCAGGAGAGTGGTGGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101611605 12:106297891-106297913 CTTTGGGGCAGGAAGTGGGAGGG - Intronic
1101690725 12:107077826-107077848 GTGTGTAGCAGGTGAGGGGAGGG - Intronic
1101903692 12:108810072-108810094 CTGTGGGACAGGAGGTGGCAGGG - Intronic
1102082473 12:110109620-110109642 CTGGAGAGCAGGAAGGGGCAGGG + Intergenic
1102461534 12:113102776-113102798 CTGGGGAGCAGAAGTGGGGCTGG - Intronic
1102462228 12:113107008-113107030 CTGAGGAGCTGGAGGGGGAAAGG + Intronic
1102533886 12:113566925-113566947 CCCTGGAGCAGGAGGTGGGAAGG + Intergenic
1102600484 12:114026018-114026040 CTGGGGAGCAGCAGGGGCCAGGG + Intergenic
1102835402 12:116053620-116053642 CTTTGAAGCAGAAGGGAGGAAGG + Intronic
1103037381 12:117667415-117667437 CTGGGGAGAAGGAGGTGGCATGG + Intronic
1103325383 12:120116785-120116807 CTGAGGAGGAGGAGGGGGAGCGG - Exonic
1103483875 12:121269484-121269506 CTGTGGATAAGGATGGGGGCAGG + Intronic
1103620803 12:122186056-122186078 CCGGGGAGCAGGGGGTGGGAAGG + Intronic
1104015625 12:124959935-124959957 CCCTGGAGCAGGGGGAGGGAGGG + Intronic
1104096813 12:125565602-125565624 GTGGGGAGCTGGAAGGGGGATGG + Intronic
1104198782 12:126567309-126567331 CTGTGGGGCAGGGGGTGGGTGGG - Intergenic
1104585486 12:130045075-130045097 CCGGAGAGCAGGAGTGGGGAGGG - Intergenic
1104617811 12:130285014-130285036 CTGAGGTGGAGGTGGGGGGATGG + Intergenic
1104754109 12:131258311-131258333 CTGGGGAGCTGGTGGGGGGGGGG + Intergenic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104984126 12:132587120-132587142 CAGTGCAGCTGGAGGGTGGACGG + Intergenic
1104984177 12:132587341-132587363 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1104984188 12:132587387-132587409 CAGTGCAGCTGGAGGGAGGACGG + Intergenic
1105012187 12:132763019-132763041 CTCTGGAGCGTGAGGGGTGATGG + Intergenic
1105418176 13:20231381-20231403 CTGGGGAGCAGGAAGGGTCAGGG - Exonic
1105493446 13:20909355-20909377 CTGGGGAGCAGCAGGGGTGCTGG + Intergenic
1105546615 13:21355449-21355471 CTGGGGAGGGGGAGGAGGGAAGG + Intergenic
1105763160 13:23531728-23531750 CCGTGGAGCAGGGGGGGTTAGGG - Intergenic
1105767049 13:23570568-23570590 CTGTGGACTAGGAGGTGGGAGGG + Intronic
1105943151 13:25169472-25169494 CTCTGGAGCAGGGCGGGGGACGG + Exonic
1105972984 13:25447827-25447849 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1106121770 13:26865666-26865688 CACTGGAGCAGGAGGGAGCAAGG - Intergenic
1106357135 13:28994043-28994065 GTGGGTGGCAGGAGGGGGGAGGG - Intronic
1106818883 13:33441005-33441027 AGGTGGAGGAGGAGGTGGGAGGG - Intergenic
1107415657 13:40197834-40197856 CTTTGGAGCGGGAGTTGGGATGG - Intergenic
1107937873 13:45360612-45360634 CTCTCGAGCAGGAGAGGTGAGGG - Intergenic
1108192775 13:47959472-47959494 GGGCGGAGGAGGAGGGGGGAAGG + Intronic
1108254640 13:48598550-48598572 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1108397737 13:50006581-50006603 GTGTGGAGCAGGACTGGGGTTGG + Intronic
1108543497 13:51467117-51467139 CTCTGGAGCAGGAGAGGACAGGG + Intergenic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1108846139 13:54679887-54679909 ATGTGGAGCTGGACAGGGGATGG - Intergenic
1109215751 13:59587894-59587916 CTTTGAAGCAGGAGGTAGGATGG - Intergenic
1109597086 13:64570436-64570458 CTCTGTAGCAGATGGGGGGATGG + Intergenic
1110730921 13:78877442-78877464 CTGTGGAGCTGGTGGGGGCCGGG - Intergenic
1110734799 13:78923974-78923996 GTGGGGTGCGGGAGGGGGGAGGG - Intergenic
1110749285 13:79093877-79093899 CTGTTGAGCGTGGGGGGGGAGGG + Intergenic
1111973905 13:94945866-94945888 CAGTGGAGGCGGAGGGGGGTTGG - Intergenic
1112253477 13:97805857-97805879 TTGTGGGGCAGGGGCGGGGAGGG + Intergenic
1112327197 13:98449798-98449820 GTGTGGGGGGGGAGGGGGGAAGG + Intronic
1112928803 13:104710726-104710748 ATGTGGGGCAGGTGGGAGGAGGG + Intergenic
1113074601 13:106455331-106455353 CTGTGGGGCAGGAGGAGGTCTGG + Intergenic
1113425744 13:110207098-110207120 CTGGGGGGCAGGAGGGGGGCAGG - Intronic
1113530464 13:111020724-111020746 CTGGGGGACAGGAGGAGGGAGGG - Intergenic
1113680835 13:112243757-112243779 CTGTGGAGAAGGAGCAGGGCAGG + Intergenic
1113924334 13:113931950-113931972 CAGAGGAGCAGGAGGGTGGAGGG - Intergenic
1113973776 13:114211302-114211324 CTGGGGAGCATGAAGTGGGAGGG - Intergenic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1114581959 14:23769314-23769336 CTGGGGAGGCGGCGGGGGGATGG + Intergenic
1114623772 14:24115254-24115276 CTGGGGAGCGGGAGGGGTGTTGG - Exonic
1114664967 14:24372354-24372376 CTGTGAGGGAGGAGGGGGTATGG - Intronic
1114771116 14:25429627-25429649 TTGTTGGGCAGGTGGGGGGAGGG + Intergenic
1114777333 14:25498659-25498681 CTGGGGTGGGGGAGGGGGGATGG + Intergenic
1115094540 14:29618971-29618993 ATGAGGAGGAGGAAGGGGGAGGG + Intronic
1115778204 14:36739765-36739787 CTGAGGAGCAAGTGGGGTGAGGG - Intronic
1115850937 14:37589470-37589492 CTCTGGAGGAGGTGGGAGGAGGG - Intergenic
1116665125 14:47764851-47764873 CTGAGGAGGAGGAGGAGGAAGGG + Intergenic
1116966581 14:51021557-51021579 CAGGGGAGCAGGAGGAGGCAGGG - Intronic
1117029121 14:51651533-51651555 CTGTGGAGACGGAGGTGCGAGGG - Intronic
1117403070 14:55375428-55375450 CTGTGGAGGCTGAGGTGGGAGGG - Intronic
1117871457 14:60205209-60205231 CTGGGGATCAGGAAGGGAGAGGG + Intergenic
1118317895 14:64736927-64736949 CGGGGGAGGAGGAGGGAGGAGGG + Intronic
1118758526 14:68863326-68863348 CTGGGAAGAAGCAGGGGGGAAGG + Intergenic
1119178904 14:72590867-72590889 CTGAGGATCAGGACTGGGGAAGG + Intergenic
1119470950 14:74898812-74898834 CTGTGGAGCTGGGGGAGGGGAGG - Intronic
1119566897 14:75636476-75636498 CTCTGCGGCAGGAGGAGGGAGGG + Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1119687002 14:76640909-76640931 TTATGGAGCAGGAGAGGAGAAGG - Intergenic
1120068285 14:80072054-80072076 CTTTGGAGAAAGAGGGGCGATGG - Intergenic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1121360169 14:93249838-93249860 CTGTAGGGCTGGAGAGGGGATGG + Intronic
1121489668 14:94348868-94348890 ATGTGGAGCAGAAGCAGGGAGGG - Intergenic
1121666519 14:95676626-95676648 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122265982 14:100547082-100547104 CTGTGGAGGAGCAGGAGTGAGGG - Intronic
1122283278 14:100636754-100636776 CAGTGGAGCAGGGCAGGGGAAGG - Intergenic
1122407718 14:101510058-101510080 CTGGCGAGCAGCATGGGGGATGG + Intergenic
1122549051 14:102540092-102540114 CTCTGGAGGAGGAGGCCGGATGG - Intergenic
1122615724 14:103016466-103016488 CGGTGAAGCAGGTGAGGGGAGGG + Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1123067832 14:105627198-105627220 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123071850 14:105645923-105645945 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123072642 14:105649219-105649241 CTGTGGTGCAGGTGAGGGGAAGG + Intergenic
1123091514 14:105744199-105744221 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123092668 14:105748745-105748767 CTGTGGTGCAGGTGAGGGGAAGG + Intergenic
1123097282 14:105772540-105772562 CTGTGGTGCAGGTGAGGGGAAGG - Intergenic
1123098228 14:105776446-105776468 CTGTGGTGCAGGTGAGGGGAAGG + Intergenic
1123683523 15:22781243-22781265 CTGTCAAGCAGGAGAGGAGATGG + Intronic
1123987807 15:25660173-25660195 CTGTGGAGCAAGCCGGGGCAGGG - Intergenic
1124186132 15:27531108-27531130 TTGTGGAGGAGGAGGAGGGTGGG + Intronic
1124239754 15:28019640-28019662 CTGTGGAGGAGGCTGGGTGAAGG - Intronic
1124483471 15:30097375-30097397 CTGTGGACCAGGCGAGGGCACGG + Intergenic
1124489922 15:30149437-30149459 CTGTGGACCAGGCGAGGGCACGG + Intergenic
1124493333 15:30171762-30171784 CTCTGGAGAAGGAGGTGGGAAGG - Intergenic
1124520107 15:30399851-30399873 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1124538548 15:30566373-30566395 CTGTGGACCAGGCGAGGGCACGG + Intergenic
1124750201 15:32366563-32366585 CTCTGGAGAAGGAGGTGGGAAGG + Intergenic
1124753610 15:32388890-32388912 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1124760103 15:32441209-32441231 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1124975351 15:34524592-34524614 CTGTGGACCAGGCGAGGGCACGG - Intergenic
1125722936 15:41853752-41853774 CTATGGAGAAGGAGGTGGCACGG - Exonic
1125759173 15:42085270-42085292 CTTTGCAGGAGGAGAGGGGAGGG + Intronic
1125803261 15:42469479-42469501 CCTTGGAGCAGGATGGGAGAAGG - Intronic
1126322929 15:47444986-47445008 ATGGGGAGCTGGAAGGGGGATGG + Intronic
1126821687 15:52510726-52510748 CTGGGGAGCAGGTGTGGCGATGG - Intronic
1126855465 15:52834664-52834686 GGGTGGAGGAGGAGGAGGGAAGG + Intergenic
1126951241 15:53884199-53884221 CTGTGGAGCAGGAAGACGAAGGG + Intergenic
1127335459 15:57979502-57979524 CTGTGGAGGAGAAGGGGTCAAGG - Intronic
1127752671 15:62060833-62060855 CTGTGGATCAGGTGGGGGAAAGG + Intergenic
1127856174 15:62955473-62955495 CTGAGGAGGAGGAAGGGGGATGG + Intergenic
1128063054 15:64747400-64747422 CTGGGGAGCAGGAGGGGATGAGG - Intronic
1128096332 15:64959178-64959200 CTGAGGGGCAGGAGGGGGAGGGG + Intergenic
1128254039 15:66184368-66184390 CTGTGGAAGAGGGAGGGGGATGG - Intronic
1128375873 15:67075428-67075450 CTGGGGAGCAGGAGAGGGGGAGG + Intronic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128566073 15:68700986-68701008 CTGAGGAGCTGGGGGCGGGATGG + Intronic
1128589325 15:68880740-68880762 CTGATGAGAAGGAGGGGGGCAGG + Intronic
1128675220 15:69603413-69603435 GTGTGGAGAAAGAGGAGGGAGGG + Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1128992890 15:72275180-72275202 CTGTGAAGCAGAATGGGGGATGG - Intronic
1129039061 15:72670290-72670312 CTGTAGAGCAGGTGAGGGCACGG + Intergenic
1129399573 15:75274140-75274162 CTGTAGAGCAGGTGAGGGCACGG + Intronic
1129442492 15:75591880-75591902 CTGTGCAGCAGCAGAGAGGAGGG + Intergenic
1129674244 15:77623684-77623706 CTGAGGAGGAGGAGGGGAAAGGG - Intronic
1129739332 15:77982484-77982506 CTGAGGAGCATGGGGGGAGACGG - Intergenic
1130118320 15:81024735-81024757 CTGTGGTGGAGGCAGGGGGAAGG + Intronic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130559209 15:84945398-84945420 TGGGGGAGCAGGAAGGGGGATGG - Exonic
1130841046 15:87701506-87701528 TTCTGGAACAGGAGGGGAGAGGG - Intergenic
1131090672 15:89622695-89622717 CTGGGGAGGTGGAGCGGGGAGGG - Intronic
1131115435 15:89792351-89792373 GTGTGGAACAGCAGCGGGGAGGG + Intronic
1131229166 15:90647470-90647492 GTGTGGAGGAGGAGGGGTGAGGG - Intergenic
1131258473 15:90876411-90876433 GGGTGGAGCAGGAGGCGAGAGGG - Intronic
1131499909 15:92952321-92952343 CTGGGGAGGAGGGAGGGGGATGG + Intronic
1131620742 15:94065622-94065644 ATGTGGAGCAGGTTGGGGAAGGG + Intergenic
1131764792 15:95663844-95663866 ATGTGTTGGAGGAGGGGGGAGGG + Intergenic
1132185003 15:99796674-99796696 CTGTGGACCAGGTGAGGGCACGG + Intergenic
1132431985 15:101767880-101767902 CTGTGGACCAGGTGAGGGCACGG - Intergenic
1132458753 16:38998-39020 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1132525749 16:413701-413723 CTGAGCAGCAGGAGGCTGGAGGG + Intergenic
1132595368 16:746662-746684 CTGGGCAGCAGGAGGGGAGGTGG + Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132829003 16:1918484-1918506 CGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132891239 16:2205794-2205816 CTGCGGAGGTGGGGGGGGGACGG + Intronic
1132933156 16:2468849-2468871 CTGAGTTGCAGGTGGGGGGAGGG + Intergenic
1133027991 16:2996964-2996986 CTATGGACCAGGAAGGGGCAGGG + Intergenic
1133049050 16:3106457-3106479 GTGAGGAGCAGGCGGGGCGAGGG - Intergenic
1133349849 16:5094112-5094134 TGGTGCAGCAGGAGTGGGGACGG + Intronic
1133369839 16:5239338-5239360 CTGTGGACCAGGCGTGGTGATGG - Intergenic
1133710100 16:8393132-8393154 CTGTGGAGCAGAAGAGGGGCAGG - Intergenic
1134327021 16:13216680-13216702 CTGGGGAGCAGTGGGGGAGATGG + Intronic
1134365981 16:13579560-13579582 CAGGGGAGCTGGAGAGGGGACGG + Intergenic
1134479279 16:14603533-14603555 TGGTGGAGGAGGAAGGGGGAAGG - Intronic
1134640306 16:15824689-15824711 CTGTGGTCCAGGAGGGAGGGAGG + Intronic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1135023881 16:18984259-18984281 CTGGGGAACAGCAGGTGGGAAGG + Intronic
1135818782 16:25660455-25660477 TTGTGGAGTAGGAGGTTGGAAGG - Intergenic
1136139758 16:28281282-28281304 GGGTGGAGCAGGAGGGGGCTGGG - Intergenic
1136498516 16:30658452-30658474 CTGAGGAGGAAGAGGGAGGAGGG + Exonic
1136922380 16:34343824-34343846 CTGAGGAGCAGCAGATGGGAAGG - Intergenic
1136982193 16:35067982-35068004 CTGAGGAGCAGCAGATGGGAAGG + Intergenic
1137252964 16:46753261-46753283 GTGTGGGGCAGGAGGAGGGATGG - Intronic
1137330804 16:47493215-47493237 ACCAGGAGCAGGAGGGGGGAAGG + Intronic
1137539243 16:49350621-49350643 CTGGGGAGTCGGAGGAGGGAAGG - Intergenic
1137639699 16:50017817-50017839 CTGGGGAGGTGGTGGGGGGATGG - Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138066420 16:53946066-53946088 TGGTGGAGGAGGATGGGGGAAGG + Intronic
1138519105 16:57560660-57560682 GTGTGGAGCAGGATTGGGGATGG + Intronic
1138678267 16:58667190-58667212 CTGGGGAGCAGGAAGGGGACTGG + Exonic
1139325528 16:66150046-66150068 CTATGGAGCATGGGGTGGGATGG - Intergenic
1139328051 16:66167103-66167125 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1139431323 16:66912429-66912451 ATCTGGAGGAGGAGGAGGGATGG + Exonic
1139561267 16:67743891-67743913 CTGTGGAGCAGCAGTGAGGGTGG - Intronic
1139582552 16:67881978-67882000 CTGAGGGGCAGCAGCGGGGAGGG + Exonic
1139645525 16:68326836-68326858 CTGAGGAGAAGGAGGTGTGAAGG + Intronic
1140626925 16:76805033-76805055 AGGTGGGGCAGGATGGGGGAGGG + Intergenic
1141053914 16:80798412-80798434 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1141496640 16:84414854-84414876 GTTTGGAGCAGGAGGGGGTTGGG + Intronic
1141515251 16:84539763-84539785 CAGTGGAGAATGAGGGGTGAGGG + Intronic
1141638467 16:85328212-85328234 CTGTGGAGGAGGAGCGGAAAGGG - Intergenic
1141821534 16:86449533-86449555 CTGTGGCCAAGGAGGAGGGACGG + Intergenic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1141997000 16:87641976-87641998 CTGTGGAGGAGGGGTGGGGCTGG + Intronic
1142014947 16:87740427-87740449 CTCTGGAGCAGGAGGGGAGGCGG - Intronic
1142234577 16:88915630-88915652 GTGTGGAGGAGGAGCGTGGAGGG + Intronic
1142237145 16:88927703-88927725 CTGGGGAGGAGGAGGCGGAAGGG - Intronic
1142249932 16:88986564-88986586 CTGTGGGGCTGTAGGGGGGCAGG - Intergenic
1142269368 16:89081205-89081227 CTGTGGAGGAGCAGGTGGGAGGG + Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1142716316 17:1748804-1748826 CTGTGGAGCAGGCACAGGGATGG + Intronic
1142759481 17:2034658-2034680 ATGGGGAGCAGGGGAGGGGAGGG - Intronic
1142787205 17:2233647-2233669 GGGTGGAGAAGGAGGGGGGTTGG - Intronic
1142891773 17:2948509-2948531 CTGTGGACCAGGGGGAGGCAGGG + Intronic
1142891804 17:2948647-2948669 CTGTGGACCAGGGGGAGGCAGGG + Intronic
1142891834 17:2948785-2948807 CTGTGGACCAGGGGGAGGCAGGG + Intronic
1143542598 17:7578537-7578559 AGGAGCAGCAGGAGGGGGGAGGG + Exonic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144455001 17:15411695-15411717 CTTTGGAGCAGGAGGAGAGAAGG + Intergenic
1144703917 17:17355162-17355184 CTGTGGGGAAAGAAGGGGGAAGG + Intergenic
1144754745 17:17672347-17672369 CGGGGGATCAGGAGGGTGGAGGG + Intergenic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146456793 17:33015047-33015069 CTGTGGAACGGAAGTGGGGAAGG - Intronic
1146764477 17:35506865-35506887 CTGTATAGCAAGAGTGGGGAAGG + Intronic
1146824667 17:36012199-36012221 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
1146844757 17:36175588-36175610 CTGTTGAGCAGGAGGGTGTTGGG + Intronic
1146857063 17:36263523-36263545 CTGTTGAGCAGGAGGGTGTTGGG + Intronic
1146863554 17:36324852-36324874 CTGTTGAGCAGGAGGGTGTTGGG - Intronic
1146872973 17:36387433-36387455 CTGTTGAGCAGGAGGGTGTTGGG + Intronic
1146880331 17:36438519-36438541 CTGTTGAGCAGGAGGGTGTTGGG + Intronic
1146935657 17:36811176-36811198 GTGGGGAGCAGGAGGGAGGGAGG - Intergenic
1147066414 17:37925440-37925462 CTGTTGAGCAGGAGGGTGTTGGG - Intronic
1147075857 17:37988058-37988080 CTGTTGAGCAGGAGGGTGTTGGG + Intronic
1147077946 17:38005001-38005023 CTGTTGAGCAGGAGGGTGTTGGG - Intronic
1147087382 17:38067604-38067626 CTGTTGAGCAGGAGGGTGTTGGG + Intronic
1147093882 17:38128936-38128958 CTGTTGAGCAGGAGGGTGTTGGG - Intergenic
1147103326 17:38191567-38191589 CTGTTGAGCAGGAGGGTGTTGGG + Intergenic
1147192496 17:38746310-38746332 GTGTGGCGCAGGGTGGGGGAGGG - Intronic
1147259234 17:39198747-39198769 CTGTGGAGCAGGAGAAGGGGTGG - Intergenic
1147322044 17:39652505-39652527 ATTTGGAGCAGGAGGGTGGGAGG + Intronic
1147333152 17:39710627-39710649 CTGTGGAGCAGGTGGCAGTAAGG + Intronic
1147363692 17:39946671-39946693 CTGGGGAGCAGAAGGGGAGATGG - Intergenic
1147451393 17:40507007-40507029 CTGTTGTGTAGGAGGGGTGAGGG + Intergenic
1147559285 17:41499128-41499150 CAGGGGAGCAGCAGAGGGGAGGG + Intergenic
1147587010 17:41658598-41658620 CGGTGGAGCAGGTGAGGGGGTGG - Intergenic
1147683089 17:42266651-42266673 GTGTGGAGGTGGAGGTGGGAGGG + Intronic
1147702109 17:42402779-42402801 GTAAGGAGCAGGTGGGGGGAAGG + Exonic
1147760833 17:42796459-42796481 CCTGGGAGCAGGATGGGGGAAGG - Exonic
1148053837 17:44781921-44781943 CTGGGGTGCTGGAGGCGGGAAGG + Intergenic
1148289475 17:46431591-46431613 CTGTGGAGGAGGAGAGTGCAGGG + Intergenic
1148311644 17:46649163-46649185 CTGTGGAGGAGGAGAGTGCAGGG + Intronic
1148461217 17:47840092-47840114 CTGTGAACCAGGCTGGGGGAGGG + Intronic
1148485529 17:47988356-47988378 CTGTGGAGGCTGAGGTGGGAGGG + Intergenic
1148495942 17:48053682-48053704 CAGGGGAGCAGCAGTGGGGAGGG + Intronic
1148537768 17:48455162-48455184 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1148562442 17:48613675-48613697 CGGCGGAGGAGGAGGGGCGAGGG + Intronic
1148674684 17:49438558-49438580 TTGAGGAGCTGGATGGGGGAGGG + Intronic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148861382 17:50606049-50606071 CTGTGGTGAAGGAGGCTGGAGGG + Intronic
1149575369 17:57708089-57708111 CTGTGGAGGAGGCGGGGAGCAGG - Intergenic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1149847899 17:60018036-60018058 CTGTTGAGCAGGAGGGTGTTCGG + Intergenic
1150086255 17:62274653-62274675 CTGTTGAGCAGGAGGGTGTTCGG + Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150229667 17:63543259-63543281 CTGAGGAGGGGGAGAGGGGATGG - Intronic
1150248774 17:63694657-63694679 CACTGGAGCAGAAGGGGAGATGG + Exonic
1150249834 17:63699504-63699526 CTGGGGAGCAGGGGTGGGGGAGG - Intronic
1150286202 17:63955688-63955710 CTTTGGGGCAGGATTGGGGATGG - Intronic
1150605697 17:66688764-66688786 CTGTTGTGCAGGCTGGGGGACGG - Intronic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151314152 17:73311632-73311654 GTGTGGAGGAGGAGGTGGCAGGG - Intronic
1151347565 17:73511535-73511557 CTGGGGAGGAGGAGAGGGAAGGG + Intronic
1151361708 17:73593096-73593118 GTGGGGAGGAGGAGGAGGGACGG - Intronic
1151520977 17:74629318-74629340 GTGGGGAGGGGGAGGGGGGAGGG + Intergenic
1151579788 17:74971581-74971603 CTGGAGAGCAGGAGGTGGGGGGG + Intronic
1151629767 17:75302475-75302497 CTATGGAAGAAGAGGGGGGAAGG + Intergenic
1151701234 17:75743646-75743668 CAGGAGAGCAGGAGGTGGGAAGG + Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151829438 17:76540918-76540940 CAGAGGAGGAGGAGGGGGAAGGG - Intronic
1151891374 17:76952588-76952610 TTGTCCAGCAGGAGGGGGGTAGG + Intergenic
1152253943 17:79226565-79226587 CTGTGGAGCAGGAGGAGCCTGGG + Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152533318 17:80934464-80934486 CTGGGGAGGAAGAGGTGGGAGGG - Intronic
1152535658 17:80949119-80949141 CCCTGGAGCTGGAGGGAGGAAGG + Intronic
1152577989 17:81151315-81151337 ATGTGGGGGAGGAGGGGTGAGGG - Intronic
1152677230 17:81647940-81647962 CGATGCAGCAGGAGGCGGGAAGG - Exonic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1152962686 18:89242-89264 CTGTGGTCAAGGATGGGGGAAGG - Intergenic
1152993379 18:383663-383685 GTGTGGAGAAGGAGTGGGTAGGG - Intronic
1153342286 18:3987941-3987963 CTATGGACCAGGGCGGGGGATGG + Intronic
1153970994 18:10226975-10226997 CTATGGAGCAGCTGGGGAGAGGG + Intergenic
1154041430 18:10859858-10859880 CTGTGCTGGAGGAGAGGGGAGGG + Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155248385 18:23932978-23933000 GATTGGAGCAGGAGGTGGGAGGG + Intronic
1155401564 18:25445557-25445579 GTGTGGAGCAGGAAGGCAGAGGG + Intergenic
1155710735 18:28875519-28875541 GTGTGGGTCAGGAAGGGGGAAGG - Intergenic
1156111418 18:33731843-33731865 GTGAGGAGGAGGAAGGGGGAAGG - Intronic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156227904 18:35127342-35127364 CTGAGGAGCAGGGGAGGGGAAGG - Intronic
1156401550 18:36744614-36744636 GTGGGGAGCAGGAGCCGGGAGGG - Intronic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1156818332 18:41339825-41339847 CTCTGAAGCATGAGGTGGGATGG - Intergenic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1157307564 18:46528309-46528331 CTGAGGAGCAAGGGCGGGGAGGG + Intronic
1157583089 18:48784576-48784598 CTCTGCAGCAGGATGGAGGAGGG + Intronic
1158536035 18:58309177-58309199 CCGTGGGGCAGTGGGGGGGAGGG - Intronic
1158677540 18:59534854-59534876 CTCTTGAGCATGAGGAGGGAAGG + Intronic
1159056933 18:63475571-63475593 CAGTGGAGCAAGTGGAGGGAAGG - Intergenic
1159918839 18:74209406-74209428 ATGTAGAGCAGAAGGAGGGAAGG - Intergenic
1159922107 18:74235956-74235978 CTTTGCAGCAGGAGGAGTGAGGG + Intergenic
1159995780 18:74962563-74962585 CTGAGGCGCAGGATGTGGGAAGG - Intronic
1160255966 18:77249558-77249580 CTGGGGAGGAGGAGGAGGAAAGG + Intergenic
1160342657 18:78102597-78102619 TTGTGGAGCGTGAAGGGGGAGGG + Intergenic
1160394018 18:78559015-78559037 CTGGGGAGGAGGGGGTGGGAGGG - Intergenic
1160582870 18:79897624-79897646 ATGTGGAGGAGGAGGAGGGAAGG - Intronic
1160715737 19:575817-575839 ATGAGCAGCAGGAGGAGGGACGG - Intronic
1160789939 19:918674-918696 CTCCGGAGCAGGAGGGGAGAGGG + Intronic
1160790023 19:918924-918946 CTCTGGAGCAGGAGGGGAGGAGG + Intronic
1160938437 19:1608915-1608937 CTTCGGAGCAGGAAGGGGCAGGG + Intergenic
1160970709 19:1766595-1766617 GTGAGGAGGAGGAGAGGGGATGG + Intronic
1161206161 19:3042270-3042292 CTGTGGAGGGGCAGGGAGGAAGG + Intronic
1161443726 19:4306356-4306378 CTGTTGAGTAGGAGGGGCGGGGG - Intronic
1161560935 19:4972090-4972112 CCCTGGGGCAGGAAGGGGGAGGG - Intronic
1161821562 19:6533606-6533628 CTTTGGAGGGGGAGGGGGAAGGG - Intronic
1161821623 19:6533748-6533770 CTCTGGAGGGGGAGGGGGAAGGG - Intronic
1162135427 19:8552201-8552223 CTGGGGTGCAGGTGGGGGAAGGG + Intronic
1162317009 19:9945654-9945676 CTCTGGGGGAGGAGGAGGGAAGG + Intergenic
1162375070 19:10300028-10300050 CTGTTGGGGATGAGGGGGGAAGG - Intergenic
1162519731 19:11172760-11172782 CTGTCCAGCAGGATGTGGGATGG + Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162875247 19:13616598-13616620 CGGTAGAGGAGGAGGGGGAAGGG + Intronic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163029850 19:14537086-14537108 CTGAGGAGGAGGAGGGGGCAGGG + Intronic
1163197578 19:15733889-15733911 CAGTGGCCCAGGAGAGGGGATGG + Intergenic
1163298689 19:16429661-16429683 CTGAGGAGCAGGGTGGGGCAGGG - Intronic
1163350000 19:16770607-16770629 CTGTGGGGCAGGGGGAGGGATGG - Intronic
1163444713 19:17339563-17339585 CCGTGGAGCAGGAGGGCGTGCGG + Exonic
1163779650 19:19239708-19239730 GGGAGGAGCAGGAGGGAGGAGGG - Intronic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1164188312 19:22892760-22892782 AAGAGGAGGAGGAGGGGGGAGGG - Intergenic
1164249665 19:23465922-23465944 CAGAGGAGGAGGAGAGGGGAAGG - Intergenic
1164324718 19:24181190-24181212 CTGTGGAGGAGGAGGAGGAGAGG + Intergenic
1164694207 19:30231504-30231526 CTGTGGAGGAGTTGGAGGGAAGG + Intronic
1164714986 19:30384636-30384658 CTGTGGAGCATGAGGGTCAAAGG + Intronic
1164846722 19:31438786-31438808 TTGTGGAGCAGCAGGTGGTAGGG - Intergenic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165427300 19:35753240-35753262 CTGAGGATGAGGAGGTGGGATGG + Exonic
1165707819 19:37988876-37988898 GTGTGGAGTGGGAGGGAGGACGG - Intronic
1165829038 19:38721475-38721497 CTGTGGGGCAGGAGTCTGGAGGG - Intronic
1166046273 19:40232854-40232876 CTGGGGAGAGGGAGGGGTGAGGG + Exonic
1166176375 19:41074476-41074498 CTCAGGGGCGGGAGGGGGGATGG - Intergenic
1166219907 19:41357661-41357683 GGGTGGAGCAGGAGGTGGGAAGG - Intronic
1166672446 19:44719008-44719030 AGGTGGAGGAGGAGGAGGGATGG + Intergenic
1166679429 19:44758004-44758026 CGGGGGAGCTGGAGGGGGGAAGG - Intronic
1166735564 19:45082203-45082225 GTGTGGAGGAGGTGGGGGCAGGG - Intronic
1166840695 19:45695378-45695400 CTGGGGAGGAGGTGGGGAGAAGG - Intronic
1166852153 19:45766181-45766203 CTGTGCAGCTGGAGGGCGGGCGG + Intronic
1166975896 19:46604891-46604913 CTATGGGGCAGGAGCGGGGCTGG - Intronic
1167087455 19:47320114-47320136 ATGTTGAGCAGGATGAGGGAGGG - Exonic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1167619580 19:50553291-50553313 CTGTGGAGCAGAGGCGGGGCAGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168274460 19:55269429-55269451 CTGTGCAGCAGTTGGGGGCAGGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925667985 2:6282015-6282037 CTGGAGAGCAGGTGGTGGGAGGG + Intergenic
926115388 2:10209981-10210003 CTGGGCAGCAGGAGCAGGGATGG - Intronic
926125242 2:10267871-10267893 CTGAGGAGCAGGTGGAGGGCAGG - Intergenic
926234721 2:11031244-11031266 CTTTGGAGGAGGATGGGGGTGGG - Intergenic
926311163 2:11677280-11677302 CTGAGGAGCTGGAGTGGGGAGGG + Intergenic
927153303 2:20207962-20207984 CGGTGCAGCAGGAGAGGGCAGGG - Intronic
927307531 2:21590638-21590660 CTGGGGAGCAGAAGAGAGGAAGG - Intergenic
927471275 2:23379438-23379460 CTGTGGGGCGGGGGGGGGGGGGG + Intergenic
927982826 2:27385237-27385259 CTGTGGAGGAGGAGGAGCTAGGG - Intronic
928359912 2:30654731-30654753 CTGAAGAGGAGGAGAGGGGAGGG - Intergenic
929095853 2:38262723-38262745 ATGTGGAGGGGGAGGGGGCAGGG - Intergenic
929433346 2:41907384-41907406 CTGTGGAGCAGGACATGAGATGG + Intergenic
929461136 2:42102643-42102665 CTGTGGAGAATGAGGCGGGGTGG - Intergenic
929948585 2:46389094-46389116 GTGAGGAGCAGGAGGCTGGAAGG - Intergenic
930035636 2:47083602-47083624 CTGGAGAGCAGGAGGGGCCAAGG - Intronic
930057834 2:47265519-47265541 GTGTGGAGGAGGAGGGGAGAGGG - Intergenic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
931183476 2:59927055-59927077 GTGAGAAGCAGGAGGGGGTAGGG + Intergenic
931686495 2:64798478-64798500 TTGAGGGGCAGGATGGGGGATGG - Intergenic
932083912 2:68740433-68740455 GTGTGCAGCAGGAGAAGGGAAGG - Intronic
932408767 2:71532494-71532516 GGGTGGAACAGGATGGGGGAAGG + Intronic
932420771 2:71599999-71600021 CTTCGGAGCAGGAGGGAGGCAGG + Intronic
933737333 2:85505680-85505702 CTGGAGAGCAGGAGGTGGAAGGG - Intergenic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
934054543 2:88240839-88240861 TTGTGGAGAAGGAAGAGGGAAGG - Intergenic
934650032 2:96085419-96085441 CTGAGGGGCAGGGGTGGGGATGG + Intergenic
934666459 2:96174703-96174725 ATGTTGAGCAGCAGGGGGCAGGG - Intergenic
934934094 2:98452114-98452136 CTGTCCAGCAGGAGCAGGGAAGG + Intronic
934951898 2:98581192-98581214 CTGTGCAGCATGTGGGGGCATGG + Intronic
935096512 2:99949398-99949420 CTGGAGAGCAGGGGGGAGGATGG + Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935721169 2:105980578-105980600 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
935738215 2:106123579-106123601 CTGTAGGGCAGGTGGAGGGACGG + Intronic
936506835 2:113114890-113114912 CAGTGGAGCAGGGGAGGGAAGGG + Intronic
937111037 2:119367299-119367321 CTGTGTAGCGGGAGAGGGGTGGG + Intronic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
937208412 2:120252127-120252149 CTGTGGAGGAGGAGGTGGTTAGG + Intronic
937365425 2:121257506-121257528 CTGAAGAGCAGCAGGGGGCAGGG + Intronic
937469726 2:122164836-122164858 CTCTGGAGCAGGAAGCAGGAAGG + Intergenic
938160307 2:128979456-128979478 CTGTTGAGCAGGAGTGGGCATGG + Intergenic
938218194 2:129541051-129541073 GTGGGGGGGAGGAGGGGGGAGGG + Intergenic
938232429 2:129672702-129672724 GTATGGAGCAGCAGGGCGGAAGG + Intergenic
938292469 2:130157399-130157421 GGGTGGAGAAGGAGGGGTGAGGG + Intronic
938337310 2:130511363-130511385 CTGAGGAGCAGCAGGGAGGGAGG - Intergenic
938352528 2:130609372-130609394 CTGAGGAGCAGCAGGGAGGGAGG + Intergenic
938464085 2:131515577-131515599 GGGTGGAGAAGGAGGGGTGAGGG - Intergenic
938548942 2:132361711-132361733 CTCAGGCGCAGGAGGGAGGACGG - Intergenic
938875955 2:135531649-135531671 CCGGGGAGCTGGACGGGGGAGGG - Intronic
938952730 2:136270348-136270370 CTGGAGGGCAGGAGGAGGGAGGG + Intergenic
938965928 2:136388583-136388605 CTGTGGGGCAGGGTGGGGGGGGG - Intergenic
939397913 2:141655100-141655122 CTGGGGAGGAGGAAGAGGGACGG + Intronic
939570279 2:143832483-143832505 CTGGGGTGAAGGAGGAGGGAAGG + Intergenic
939948083 2:148434606-148434628 CTGTGGTCCAGGAGTGGGGTTGG + Intronic
940191668 2:151047117-151047139 CTGTGGAGCAGCAGGTGGGATGG - Intronic
940640007 2:156334690-156334712 CTGGGGAGAAGGAAGGGGGTGGG + Intronic
941221982 2:162793300-162793322 GTGTGGTGTAGGAGGAGGGAGGG + Intronic
941373987 2:164705078-164705100 CTGTGAAGCAGGAAGAGTGAGGG - Exonic
941629249 2:167865968-167865990 ATGGGGAGGAGGATGGGGGAGGG - Intergenic
941659555 2:168181832-168181854 CTGGGGAGCAGGAAGTGGTAGGG + Intronic
941773989 2:169371932-169371954 GTGGGGGGCAGGAGGAGGGAGGG + Intergenic
941979170 2:171435635-171435657 CTGTCCAACATGAGGGGGGAAGG + Intronic
942089101 2:172471351-172471373 CTTCTGAGCAGGAGGGAGGACGG - Intronic
942454895 2:176130686-176130708 ATGCGGAGGAGGAGGGGGGGCGG - Exonic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
942803204 2:179899541-179899563 TTGTGAAGCAGGAGGGTGGTTGG + Intergenic
944606811 2:201359086-201359108 CTGAGGAGCAGCAGTGGGGATGG + Intergenic
944648967 2:201809770-201809792 CATTGAAGCAGGAGAGGGGAAGG - Intronic
944971877 2:205002649-205002671 CTGTGGAGCAGGCAGGGTGGAGG - Intronic
946246964 2:218393309-218393331 CTGGGGGGTGGGAGGGGGGAAGG - Intronic
946247757 2:218397131-218397153 TTGTGGGGCAGGACGGGGGACGG + Intergenic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946353396 2:219169898-219169920 CTGGGGAGCAGGTGGAGGCAAGG + Exonic
947242833 2:228015067-228015089 CTGTTGTGGGGGAGGGGGGAGGG - Intronic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947722875 2:232380117-232380139 CTGTGCATGAGGAGGGGGCACGG + Intronic
947849686 2:233275635-233275657 CTTTGGAGGAGGAGTTGGGATGG + Intronic
948206000 2:236163289-236163311 CCGAGGAGCAGGAGGGAGGGCGG + Intergenic
948584734 2:239012297-239012319 CTGGGCAGCAGGAGGGGAGTCGG + Intergenic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948669241 2:239556589-239556611 CTGTTGGGGAGGTGGGGGGAGGG - Intergenic
948787938 2:240362825-240362847 TTGCAGAGCAGGAGGGGGCAGGG - Intergenic
948800202 2:240430022-240430044 CTGGGGAGGGGGATGGGGGAAGG - Intergenic
948860378 2:240750017-240750039 CTCTGCAGCAGGCTGGGGGAGGG + Intronic
948893185 2:240916760-240916782 CTGCTGAGCAGGCGGAGGGAGGG + Intergenic
948999625 2:241605541-241605563 GTGGGGAGCAGGTGGTGGGAAGG + Intronic
949057205 2:241934618-241934640 CTGTGAAGTTGGCGGGGGGATGG + Intergenic
1169013502 20:2271956-2271978 CTGGGGCGCAGGAGAGGGGAGGG + Intergenic
1169186870 20:3625690-3625712 CTTGGGGGCAGGAGGTGGGAAGG - Intronic
1169198336 20:3695078-3695100 GTGGGGAGCAGGAGGGGCCAAGG - Intronic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1170232703 20:14068266-14068288 CTGTGGAGCACAGGGGGGGTGGG - Intronic
1170407101 20:16049940-16049962 CTGTGGAGGAGGGTGGGGGTGGG + Exonic
1170675426 20:18475627-18475649 CTCTGGAGCAGGGGTGGGGCAGG - Intronic
1170756782 20:19212436-19212458 CAGAGGAGGAGGAGCGGGGAAGG - Intergenic
1171295359 20:24012402-24012424 CAGTTGAGCAGGAAGCGGGAGGG + Intergenic
1171429156 20:25069611-25069633 CTGAGGAGTGGGAGAGGGGATGG + Intergenic
1171486389 20:25489456-25489478 GTAAGGAGAAGGAGGGGGGATGG - Intronic
1172029982 20:31975043-31975065 CTGGGGAGTGGGAGGGCGGAGGG + Intronic
1172033378 20:31996362-31996384 CTGTGGATCAGCAGGGGTGTGGG - Intronic
1172038260 20:32025692-32025714 TTGAGGATCAGGAGAGGGGAGGG + Intronic
1172113937 20:32562925-32562947 GAGTGGAGAAGGAGGGTGGAGGG + Intronic
1172169008 20:32917591-32917613 CTGGGAAGCAGGAGGGATGATGG + Intronic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1173001995 20:39111497-39111519 CAGTGGAGCAGGAGGAAGAAGGG + Intergenic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1173438846 20:43057305-43057327 GAATGGAGGAGGAGGGGGGAAGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174209153 20:48863442-48863464 TTGTGGAGAAGGAGCGGGGAGGG - Intergenic
1174246713 20:49187779-49187801 CTGGGGCGCAGGCGGGGGGGGGG - Intronic
1174404581 20:50294965-50294987 ATGGGGGGCAGGAGGGCGGAGGG + Intergenic
1174730259 20:52909198-52909220 CTCTGGAGGATGAGGTGGGAAGG + Intergenic
1175200465 20:57273338-57273360 CTGGGGAGCTGGAGAGGGCATGG + Intergenic
1175223801 20:57433289-57433311 CTGTGGAGCTGCAGAGGGGGAGG - Intergenic
1175224908 20:57439293-57439315 CAGTGCAGGAGGAGGGGGGGTGG - Intergenic
1175289803 20:57868169-57868191 CTGGGGAGCAGGAGTGAGGGGGG - Intergenic
1175345796 20:58273869-58273891 CAATGGAGCAGGCGGGGGGCAGG + Intergenic
1175390748 20:58625842-58625864 CGGTGGAGCAGGCAGAGGGAGGG - Intergenic
1175400191 20:58695926-58695948 CTGGGGAGCAGCGGGAGGGAGGG - Intronic
1175407074 20:58741806-58741828 CTCTGCAGCAGAAGGGTGGAAGG + Intergenic
1175430828 20:58901843-58901865 CAGTGGAGCAGCAGGGGTGGGGG - Intronic
1175606533 20:60316097-60316119 CTGTGGGGCAGTTTGGGGGAGGG - Intergenic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1175950432 20:62580691-62580713 CTGTGGAGCAGGGAGGTGGGAGG + Intergenic
1176087489 20:63304608-63304630 CTGCGCAGCTGGAGGGAGGAAGG - Intronic
1176108407 20:63400092-63400114 CTGTGGACCGGGTGTGGGGACGG - Intergenic
1176554026 21:8245313-8245335 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176572948 21:8428337-8428359 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1178044976 21:28682896-28682918 CTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1178295837 21:31409469-31409491 GTGGGGAGCAGGAGGTGGGGTGG - Intronic
1178303142 21:31469260-31469282 CTGGGAAGCAGCAGGGGGGTTGG + Intronic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178533345 21:33393055-33393077 CCGTGGAGGAGGGGTGGGGATGG + Intergenic
1178687717 21:34724271-34724293 GTGTGGAGAAGGGGTGGGGAAGG + Intergenic
1178914482 21:36699047-36699069 GGGGGGAGCGGGAGGGGGGAGGG - Intergenic
1178969678 21:37161613-37161635 GTGGGGAGCAGAAAGGGGGATGG + Intronic
1179026532 21:37683446-37683468 CAGAGGAGGAGGAGGGGAGAAGG - Intronic
1179029677 21:37709849-37709871 CTGTGGTGAAGGATGGGTGATGG + Intronic
1179405287 21:41120769-41120791 CTGAGGAGCATGCGGGGAGAAGG + Intergenic
1179502659 21:41819886-41819908 CTGAGGACCTGGAGGGGTGAGGG + Intronic
1180589894 22:16928442-16928464 GTGTGGAGCAGTGGGGGTGAAGG + Intergenic
1180705724 22:17808638-17808660 CTGTGGAGCAGGATGGGCCTGGG + Intronic
1180840215 22:18955561-18955583 CTGGTGAGCAGGTGTGGGGACGG - Intergenic
1180917228 22:19497693-19497715 CTGAGCAGCAGGAGTGGGGAAGG - Intronic
1180974715 22:19842023-19842045 CTGATGAGCAGGAGGTGGGAGGG - Intronic
1181061662 22:20284805-20284827 CTGGTGAGCAGGTGTGGGGAAGG + Intergenic
1181088330 22:20455268-20455290 CTGTGGAGCTGGAGGGAGATGGG - Intronic
1181119724 22:20657802-20657824 GTGACAAGCAGGAGGGGGGAAGG + Intergenic
1181458366 22:23071894-23071916 CTGGGGAGTAGGAGGAGGTATGG + Intronic
1182096585 22:27630233-27630255 CTGTGGATTAGGAGAGGGGGTGG - Intergenic
1182466209 22:30518190-30518212 CTGTAGAGTTGGTGGGGGGAGGG + Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182776938 22:32838245-32838267 TTGAGGAGAAGGAGGGGGGGTGG + Intronic
1182848627 22:33452311-33452333 CTATGCAGCAGAAAGGGGGAGGG + Intronic
1183319071 22:37154151-37154173 GTGGGGAGCAGAATGGGGGATGG + Intronic
1183381247 22:37491592-37491614 AGGGGGAGAAGGAGGGGGGAGGG + Intronic
1183403968 22:37620852-37620874 CCGTGGAGGAGGAAGGGGAAAGG - Exonic
1183416807 22:37687260-37687282 CTGTGGGGCGGGTGGGGGGGGGG - Intronic
1183510585 22:38232462-38232484 GTGTGGAGAAGGCGGGGGAAGGG + Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1184017016 22:41793968-41793990 GGCTGGAGCAGGAGGGTGGAAGG - Intronic
1184092507 22:42299902-42299924 GGGTGGAGGAGGAGGGGGAAAGG + Intronic
1184321235 22:43743734-43743756 CTGTGGAGGGTGAGGGGTGAAGG - Intronic
1184488074 22:44793257-44793279 GTGTGAAGCAGGGTGGGGGATGG + Intronic
1184595247 22:45509877-45509899 CTGTGGGGCAGGTGGGGTGGGGG + Intronic
1185281469 22:49971766-49971788 CCCTGGGGCAGGAGGAGGGAGGG + Intergenic
1185313534 22:50169613-50169635 CTGTGGAACAGGGGACGGGATGG + Intergenic
1203259031 22_KI270733v1_random:162351-162373 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
949396110 3:3616080-3616102 ATGTGGAGAAAGAGGAGGGAGGG + Intergenic
949437982 3:4049896-4049918 ATGGGGAGCTGGAAGGGGGATGG + Intronic
949475514 3:4441464-4441486 ATGTGGGGCAGGGGAGGGGATGG - Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949723008 3:7012544-7012566 CAGGGGAGAAGGATGGGGGAAGG - Intronic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
949906734 3:8864220-8864242 CTGTGGAGAGAGAGGGGGAAGGG - Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950120382 3:10478558-10478580 CAGGGGAGCAGGAGGTTGGATGG - Intronic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
952107551 3:30087617-30087639 AGGTGGAGGGGGAGGGGGGAGGG - Intergenic
952210185 3:31222471-31222493 CTGTGGTGCAGAAGGAGGGAGGG - Intergenic
952537113 3:34322681-34322703 CTGTGGAGCAGGAAAAGAGAGGG + Intergenic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
953000002 3:38923798-38923820 CGGGGGAGCAGGAGTGGGCAGGG + Intronic
953203356 3:40797843-40797865 CTGAGTAGCAGGAGGGTGGATGG + Intergenic
953234803 3:41096799-41096821 CTGTGGAGCAGTAAGGTGGAGGG - Intergenic
953319750 3:41961557-41961579 CTGGGGAGCGGGGGGGGGGGGGG - Intronic
953936494 3:47048690-47048712 CTGGCGAGGAGGAGGGAGGAGGG - Intronic
954222805 3:49164974-49164996 GTGTGGAGCTGGAGTGGGGTGGG + Intronic
954899068 3:54003439-54003461 CTGTGGAGCAGCAGGGCACATGG + Intergenic
955148543 3:56344313-56344335 ATGAGGAGGAGGAGGAGGGAAGG - Intronic
955360156 3:58267283-58267305 CCGTGGAGCATGAGGATGGAGGG - Exonic
955589048 3:60514487-60514509 CTGTCGAGGAGGTGGGGAGAAGG + Intronic
956065821 3:65396078-65396100 CTTAGGAGCAGGAGGATGGAGGG + Intronic
956072726 3:65471643-65471665 ATGTGGACCTGGAGTGGGGAGGG - Intronic
956166003 3:66398704-66398726 CTGCGCAGCAGGAGGGGGGAGGG + Intronic
957054151 3:75431462-75431484 TGGTGTAGCAGGAGTGGGGATGG + Intergenic
957073082 3:75580741-75580763 CTGTGGACCAGGAGTGGTGATGG + Intergenic
957580567 3:82067309-82067331 CTGTGGAGTAGAAGGGCTGAGGG + Intergenic
957670272 3:83292240-83292262 TTGTGGGGTAGGAGAGGGGAGGG + Intergenic
957715584 3:83926388-83926410 CTGCGGAGGAGGAGAGGGGGTGG - Intergenic
959027305 3:101254962-101254984 TGGTGGAGCAGGAGGGAGGTAGG - Intronic
959476449 3:106818106-106818128 CTGTAGAGAAGTAGGGGAGAAGG + Intergenic
960884729 3:122382977-122382999 CTCTGTAGGAGGAGGGAGGAGGG - Intronic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
961204299 3:125068618-125068640 CAGTGGGGCAAGAGGGGTGAAGG + Intergenic
961281004 3:125766036-125766058 CTGTGGACCAGGCGTGGTGATGG - Intergenic
961300688 3:125920251-125920273 TGGTGCAGCAGGAGTGGGGACGG - Intergenic
961329001 3:126128018-126128040 CAGTGGGGCATGAGGGTGGAGGG + Intronic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961381103 3:126497091-126497113 CTGTGGAGGAGGAGGCGGGCAGG - Intronic
961455912 3:127023834-127023856 CTGAAGACCAGGCGGGGGGAGGG + Intronic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961636688 3:128337434-128337456 ATGGGGAGGAGGAGGGGGAAGGG + Intronic
961887812 3:130107837-130107859 TGGTGCAGCAGGAGTGGGGACGG + Intronic
962096441 3:132297506-132297528 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
962316525 3:134362851-134362873 CTGGAGAGCAGGTGGGGGGCAGG + Intronic
962760093 3:138503698-138503720 CTGAGGAGGAGGAGGAGGCAAGG - Intronic
963020686 3:140870159-140870181 CTCTGGAGAAAGAGGGGGAAGGG + Intergenic
963498210 3:146095897-146095919 CTGTGGAGGGAGAGGGGGGAGGG - Intronic
963762202 3:149295276-149295298 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
963808772 3:149753638-149753660 GTGTGGAGGAAGAGAGGGGAAGG + Intergenic
963828075 3:149977058-149977080 TTGTGGAGCAGGAGGGGAAAGGG + Intronic
964411775 3:156405291-156405313 CTGGAGAGCAGGAGGTGGGAAGG - Intronic
964694165 3:159488196-159488218 TGGTGGGGCAGGAGTGGGGATGG + Intronic
964718985 3:159753052-159753074 ATGAGGAGCAGAAGTGGGGAAGG - Intronic
966931349 3:184677786-184677808 CTGTGGAGGGGCAGGAGGGAAGG - Intronic
967052995 3:185802007-185802029 CTGTCAAGCAGTAGGGGGCAAGG + Intronic
967425686 3:189324642-189324664 TTGTGGGGCAGGAGAGGGGGAGG + Exonic
967849436 3:194071057-194071079 CCGCGGAGCAGGCGGCGGGAGGG - Intergenic
968133175 3:196204012-196204034 ATGTGGAGCAGGAGTGGTGAGGG - Intronic
968332700 3:197885175-197885197 CTGAGGAGCAGCAGGAGGGCGGG - Intronic
968382363 4:107667-107689 GGGAGGAGCAGGAGGAGGGAAGG - Intergenic
968485667 4:859903-859925 CTGAGGAGCAGCATGGGGCATGG - Intronic
968592414 4:1465678-1465700 CTGAGGAGGAGGAGGCGGGGAGG + Intergenic
968615442 4:1575614-1575636 CTGTCCAGCAGGGGGAGGGAGGG + Intergenic
968709297 4:2101562-2101584 CCCTGGAGCAGGACTGGGGAGGG - Intronic
968828104 4:2914547-2914569 CTGTGGAGCAGAAGGGGAAGAGG - Intronic
968996949 4:3951769-3951791 TGGTGCAGCAGGAGTGGGGACGG + Intergenic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969354855 4:6619455-6619477 CTGTGGAGCAGGAGGGCTGGGGG - Intronic
969737275 4:9000277-9000299 CTGTGGACCAGGCGTGGTGATGG - Intergenic
969757055 4:9156911-9156933 TTGTGCAGCAGGAGGGGGGACGG - Intergenic
969817014 4:9694486-9694508 TTGTGCAGCAGGAGGGGGGACGG - Intergenic
970046641 4:11861847-11861869 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
972662613 4:41130757-41130779 ATGGGGAGCAGAAGTGGGGAGGG - Intronic
972738389 4:41866903-41866925 ATGTGGAGCGGGAGGGGCGCAGG - Intergenic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
972836747 4:42880292-42880314 CTGTGGAACGTGAGGGGGCATGG - Intergenic
972931191 4:44072731-44072753 CTGTGGAGCTGGAGGGAGCCAGG - Intergenic
973146972 4:46839382-46839404 CTGTGGAGAAGGAGGGGCTGGGG - Intronic
973903159 4:55498703-55498725 CTGTGGAGTGGCAGGGGAGATGG + Intronic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
977360206 4:95994389-95994411 CTGTGGGGCAGAATGGGGGCAGG - Intergenic
978269922 4:106876665-106876687 CAGTGGAGCAGGAGAGGGAGAGG - Intergenic
979562775 4:122119161-122119183 CTGTGGAGTAAGAGTGGAGAAGG + Intergenic
980006148 4:127544562-127544584 ATGTGGAGCTGGAAAGGGGATGG - Intergenic
980135800 4:128857499-128857521 GTGGGGAGCAGGATGAGGGAAGG + Intronic
981510322 4:145549478-145549500 GTGTGCAGCAGCAGTGGGGAAGG + Intronic
981815859 4:148829867-148829889 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
982039777 4:151385255-151385277 CTGGGGTGGAGGTGGGGGGATGG + Intergenic
982727204 4:158918262-158918284 CTGTAGAGCAGGTGGGGTGAAGG - Intronic
983781428 4:171674671-171674693 ATGTGGAGCCGGAAGGGGGCTGG - Intergenic
984827591 4:183940496-183940518 GTGTGGAGCAGGAAGAGGGGTGG - Intronic
985147033 4:186903787-186903809 CTTAGGAGCAGGAGTCGGGAAGG + Intergenic
985543744 5:499031-499053 CTGGGGACCAAGAGAGGGGAAGG + Intronic
985695602 5:1338393-1338415 CTGTGGCGCAGGAGTTGGGGGGG + Intronic
985792560 5:1938156-1938178 CCGTGGGGCAGGAGGGGTGGTGG + Intergenic
986028206 5:3870955-3870977 GTGTGGAACAGGATGGGGGCGGG + Intergenic
986167091 5:5283462-5283484 CTGGGGGGGAGGTGGGGGGAGGG - Intronic
986759581 5:10868108-10868130 ATGTGGAGCAGGTGCGGAGAGGG + Intergenic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
987183017 5:15386248-15386270 CTCTGGGGAAGGAGGAGGGATGG - Intergenic
987230824 5:15892012-15892034 CTGGTGAGCAGGAGGAGGCAGGG - Intronic
987251755 5:16107906-16107928 ATGGGGAGCTGGAAGGGGGATGG - Intronic
987558358 5:19484651-19484673 CAGTAGTGCAGGAAGGGGGATGG - Intronic
987626413 5:20406427-20406449 CTGTTGTGGGGGAGGGGGGAGGG + Intronic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988934299 5:36066953-36066975 CAATGGAGCACGAGGGAGGAGGG - Intronic
989690354 5:44136168-44136190 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
989719123 5:44504014-44504036 TTGGGGAGCTGGAAGGGGGATGG - Intergenic
990269167 5:54116152-54116174 CTGGGGAGCAGGAGGGGGTTGGG + Intronic
990467827 5:56086477-56086499 CTCTGGAGAATGAGGGGGAAAGG - Intergenic
990499023 5:56376539-56376561 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
991180247 5:63742645-63742667 ATGTGCAGCAAGAGGGAGGATGG - Intergenic
991198194 5:63960284-63960306 CCGTGGAGCAGGAAGTGGGGAGG + Intergenic
991293971 5:65061662-65061684 CTGTGGAGTGTGAGGGGGAAGGG - Intergenic
992474011 5:77084741-77084763 CTGTGGGGCATGGGAGGGGAAGG - Intronic
992652412 5:78872665-78872687 GTGGGGAGGGGGAGGGGGGAGGG + Intronic
993467778 5:88269141-88269163 GTGGGGAGCGGGAGGGGAGAGGG + Intronic
994157280 5:96518265-96518287 CTGTAGAGGAGGAAGAGGGAAGG - Intergenic
994414624 5:99454079-99454101 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
994626796 5:102230190-102230212 GGGTGGAGCAGGAGGGTGGAAGG + Intergenic
995362670 5:111316196-111316218 CTGTGGAGCAGGAATGGCCAAGG - Intronic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995494484 5:112726336-112726358 ATGGGGAGCTGGAAGGGGGATGG + Intronic
996404349 5:123090845-123090867 CTGTGAAGCAGGTGAGGAGAGGG - Intronic
997077128 5:130692428-130692450 CTGGGAAGCAGGATGAGGGAAGG + Intergenic
997381159 5:133439553-133439575 CTCTGAAGCAGGAGGGATGAAGG - Intronic
997384090 5:133458886-133458908 CTCTGGAGCAGCAGGGGGTAGGG + Intronic
997498932 5:134355967-134355989 CTATGGACCAGGCTGGGGGATGG + Intronic
998136262 5:139676201-139676223 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998136273 5:139676237-139676259 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998162262 5:139820232-139820254 CTGGGGAGTAGGAGTTGGGATGG + Intronic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
998658083 5:144204984-144205006 CCGTGAACGAGGAGGGGGGAGGG + Intronic
998977283 5:147662318-147662340 TTGTGGGGCAGGAAGGGAGAAGG - Intronic
999194916 5:149775236-149775258 CTGTGGATCTGGAGAGGGCAGGG + Intronic
999322252 5:150622779-150622801 CTGTGGAGCAGGGGAGTGGAGGG - Intronic
999388652 5:151174036-151174058 ATCTGGAGGAGGAGGGGCGAAGG + Intergenic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999550383 5:152680158-152680180 CTGTGGTGCTGGGGAGGGGAGGG - Intergenic
999737929 5:154526652-154526674 CGGTGGGGCAGGAGGGGGCCAGG - Intergenic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000168342 5:158677301-158677323 CCTTGGGGCAGGAGGGAGGAAGG - Intergenic
1000846918 5:166293140-166293162 CTGTGGGGAAGGCAGGGGGAGGG - Intergenic
1000951209 5:167485565-167485587 ATTTGGGGCAGGAGGGGGGCAGG + Intronic
1001023825 5:168206528-168206550 CTGGGGTGGAGGAGGGGGCATGG + Intronic
1001663050 5:173411025-173411047 CTCTGGAGCTGGAGGGCGGCTGG - Intergenic
1001673122 5:173490927-173490949 CAGTGGAGCAGGTGGGGAGTGGG + Intergenic
1001690792 5:173631272-173631294 ATGAGGAGGAGGAGGGGGGTAGG - Intergenic
1001690809 5:173631322-173631344 ATGAGGAGGAGGAGGGGGGTAGG - Intergenic
1001690842 5:173631422-173631444 ATGAGGAGGAGGAGGGGGGTAGG - Intergenic
1001860210 5:175047763-175047785 CTCTGGGGCAGGAGGGTGGCAGG + Intergenic
1001939926 5:175733145-175733167 CCGTGGAGGAGGAAGGTGGAGGG + Intergenic
1002606059 5:180383437-180383459 CGGTGGAGCAGGAAGGTAGAAGG - Intergenic
1002682786 5:180981421-180981443 CGGTGGAGAAGGAGGAGGGCGGG + Intergenic
1002888926 6:1317285-1317307 GAGAGGAGCAGGCGGGGGGAGGG - Intergenic
1002895775 6:1379302-1379324 TTCTGGAGCAGGAGGGAGGGTGG + Intergenic
1002928390 6:1618236-1618258 CTCTGGACCAGGAGGGGGCCCGG - Intergenic
1002998799 6:2311887-2311909 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1003004312 6:2366970-2366992 CTGTGGAAAAGCAGGGGGCAGGG - Intergenic
1003098720 6:3160876-3160898 CTCTGAAGCAGCAGGCGGGAAGG - Intergenic
1003485203 6:6569591-6569613 CTGGGGAGCAAGAGGAGGAATGG + Intergenic
1003493399 6:6642859-6642881 CTCCGGAGGAGGAGGAGGGAGGG - Intronic
1003593136 6:7452714-7452736 ATGGGGAGCTGGAGGGGGAATGG - Intergenic
1004073937 6:12328156-12328178 GTGTGAAGCAGGAAGGGAGAAGG + Intergenic
1004075459 6:12340410-12340432 CTGTTGAGCAGGACGGGGTGAGG + Intergenic
1004167564 6:13270389-13270411 CTGGGAAGCAGGAGGGTGGGGGG - Intronic
1005222077 6:23598233-23598255 CTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1005311427 6:24563099-24563121 CTGGGGAACAGCAGGGGAGACGG - Intronic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005925758 6:30444221-30444243 CAGTGGAGCAGGAGGAGGAAGGG - Intergenic
1005958165 6:30679104-30679126 CTGTGGTCCAGGAGAGAGGAGGG - Intronic
1006004096 6:30988780-30988802 GTGTGGGGGGGGAGGGGGGAGGG + Exonic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006474531 6:34245779-34245801 GGGAGGAGCAGGAGGGGGGTTGG - Exonic
1006516626 6:34549195-34549217 CTCTGGAGCAGGAGGGAGCCAGG - Intronic
1006520527 6:34568597-34568619 TTGTGGAGTAGGAGGGGCAAAGG + Intergenic
1006718100 6:36132730-36132752 CTGGGGAGCAAGGTGGGGGAGGG + Intronic
1006787162 6:36676294-36676316 CGGTGGAGCAGCATGGGGTAGGG - Intergenic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006839787 6:37021489-37021511 CTGGGGTGCAGGGAGGGGGAGGG - Intronic
1006983623 6:38163909-38163931 CTGCTGAGCAGGTGCGGGGAAGG + Intergenic
1007262007 6:40570536-40570558 ATGTGGGGCAGGAATGGGGAAGG - Intronic
1007303273 6:40884733-40884755 TTGGGGAGCTGGAGAGGGGATGG + Intergenic
1007400940 6:41601873-41601895 TTGGGGAGCAGGGGAGGGGAGGG + Exonic
1007558055 6:42782970-42782992 CTGGGGAGGGGGAGGGGAGAGGG + Intronic
1007780109 6:44247748-44247770 CGGTGGAGGAGGGGCGGGGAGGG + Intronic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1011155238 6:84323096-84323118 GTGTGCAGCAGGAGAGGGAAGGG - Intergenic
1011253100 6:85393711-85393733 CTAGGGAGCAGGGGAGGGGAAGG - Intergenic
1011625739 6:89282184-89282206 GTGTGGTGGAGGAGGGGGGCTGG - Intronic
1012042978 6:94234048-94234070 ATGGGGAGCAGGAAGGGGGATGG - Intergenic
1012711584 6:102613708-102613730 CTGTGATGCAGAAAGGGGGAGGG - Intergenic
1012718118 6:102702185-102702207 CTGTGGAGCTGGTGGGGGCCAGG - Intergenic
1013869784 6:114743156-114743178 GTGTGGAGGGGGAGTGGGGAGGG - Intergenic
1014041996 6:116838750-116838772 CTGGGGTGGAGGAGGGGGGAGGG + Intergenic
1014101918 6:117520472-117520494 CTAGGGAGGAGGATGGGGGAGGG - Intronic
1014214388 6:118738726-118738748 GAGTGGAGGAGGAGGGGGAAAGG - Intergenic
1014353152 6:120368840-120368862 CTGTTGGGGAGGAGGGGGTAAGG + Intergenic
1014561485 6:122896240-122896262 TTGTGGGGCTGGAGTGGGGAAGG + Intergenic
1015018159 6:128439195-128439217 ATGTGAAGCAGGAAGGGGAAGGG - Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015201141 6:130582745-130582767 CTGAGGAGCAGGAGGGAGCTAGG + Intergenic
1015238176 6:130994384-130994406 CTGTGCAACAGGAGAGGGCAGGG + Intronic
1015414264 6:132930885-132930907 CTGAGCAGCAGGAGGGAGGGTGG + Intergenic
1015888599 6:137946296-137946318 CTGTGGAGCTTGAGGTGGAAGGG + Intergenic
1016073083 6:139764043-139764065 CTGTGGAGGAGTAGGCTGGAAGG - Intergenic
1016269390 6:142271155-142271177 GTGTGGTGCTGGAGGGGGGAAGG - Intergenic
1016532797 6:145076540-145076562 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1016737357 6:147493886-147493908 CTGAGGAGCGGGAGGAGGGGAGG - Intergenic
1016841924 6:148533517-148533539 CTGCAGGGCAGGAGGGTGGAGGG + Intronic
1017024816 6:150172460-150172482 CTGTGGTGCAGGTGGGGAGGCGG + Intronic
1017477294 6:154810721-154810743 TTTTGGAGCAGGTGTGGGGAGGG + Intronic
1017602679 6:156100677-156100699 CTTTGGAGTAGGAGTGGGCAAGG - Intergenic
1017964859 6:159255316-159255338 CTGTGTGGTAGGAGGTGGGATGG - Intronic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019049135 6:169169966-169169988 CTGTGGGGTAGGAGGGGTGGGGG - Intergenic
1019343862 7:520360-520382 CTTTGGGGAAGGAGGGGGGCGGG + Intergenic
1019352693 7:562365-562387 CTGTGGAGCTGGAGGCGACAGGG - Intronic
1019707827 7:2504920-2504942 CTGTGGAGCCGGGGGGGGGGGGG - Intergenic
1020116338 7:5478456-5478478 ACGTGGAGCAGGAGGCGGGGCGG + Intronic
1020339947 7:7099545-7099567 CTGTGGGGTGGGAGTGGGGATGG - Intergenic
1020389881 7:7646671-7646693 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1021196464 7:17679713-17679735 TTGGGGCGCAGGAGGGAGGAGGG + Intergenic
1021785864 7:24152075-24152097 CTGGGGAGAAGGAGAAGGGATGG - Intergenic
1022540328 7:31128957-31128979 CTGTGGAGAAAAAGGGAGGAGGG - Intergenic
1022747904 7:33191137-33191159 CTGAGAAGCAGGACTGGGGAGGG + Intronic
1022959232 7:35410426-35410448 CTGTGTCGCAGGAGGATGGATGG - Intergenic
1023196923 7:37651258-37651280 CTGTGGGGTTGGAGCGGGGAGGG - Intergenic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023869531 7:44255585-44255607 CAGTGGAGCAGGCGGGGGGATGG - Intronic
1024019183 7:45349481-45349503 CTGTGGAGGAGGAGGTTTGAAGG + Intergenic
1024262140 7:47581234-47581256 CTGACAAGCAGGAGGAGGGAGGG - Intronic
1024353973 7:48395605-48395627 CTGAGGAGGAGGAGGAGGAAGGG - Intronic
1024616338 7:51117074-51117096 TTGTGCAGGGGGAGGGGGGAGGG - Intronic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1024810673 7:53207678-53207700 CTGTTGAGCAGGAGAAGGCAAGG + Intergenic
1025605771 7:63038942-63038964 CAGTGGAGTAGGAGGAGGAAAGG + Intergenic
1026414955 7:70170037-70170059 CTGGGAATCAGGAGAGGGGAGGG + Intronic
1026557782 7:71422892-71422914 ATGGGGAGCAGGAAGGGGGATGG + Intronic
1026638636 7:72105773-72105795 AGGAGGAGGAGGAGGGGGGAGGG + Intronic
1026776035 7:73231638-73231660 GGATGGAGCAGGAGGGTGGAGGG + Intergenic
1026800650 7:73397871-73397893 GTGAGGAGGAGGCGGGGGGAGGG + Intergenic
1026865604 7:73822386-73822408 CTGGGGAGCAGGAGGCAGGGTGG - Intronic
1026915125 7:74115534-74115556 CTGGGGAGCAGGTGGGGAGGGGG + Intronic
1027016892 7:74785009-74785031 GGATGGAGCAGGAGGGTGGAGGG + Intronic
1027071135 7:75160927-75160949 GGATGGAGCAGGAGGGTGGAGGG - Intergenic
1027706143 7:81535912-81535934 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1027900666 7:84110261-84110283 CTAGGGAGCAGGAGGAAGGAAGG - Intronic
1028534781 7:91880537-91880559 CTTTGGAGGAGGAAGAGGGATGG - Intronic
1028984237 7:96997381-96997403 ATGGGGAGCAGGAGGGAGGGGGG + Intergenic
1029282456 7:99444879-99444901 CCGGGGAGAAGGAGGTGGGAGGG - Intronic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1029657171 7:101934935-101934957 GTGAGGAGCAGGAGGAGGAAGGG + Intronic
1030093316 7:105876629-105876651 CGGCGGAGGAGGAGGGGAGAGGG + Intergenic
1030871789 7:114764790-114764812 CTCTGGAGGTGGAGGTGGGAGGG + Intergenic
1031339423 7:120580429-120580451 TTGTGGAGCAGAAGGTGGAAGGG - Intronic
1031995528 7:128227899-128227921 CAGAAGAGCAGGAAGGGGGAGGG + Intergenic
1032056496 7:128688784-128688806 GTGGGGAGAGGGAGGGGGGAGGG - Intergenic
1032095236 7:128935001-128935023 GTGGGGAGCAGGGGGGAGGAGGG - Intergenic
1032448111 7:132002049-132002071 GTGTGGAGCAGGTGAGGGGATGG + Intergenic
1032845144 7:135745732-135745754 TTTTGGAGCAGGAGGGTGGGAGG + Intronic
1033281531 7:140009726-140009748 GTGTGGAGCAGGTGTGGGGTGGG - Intronic
1033281635 7:140010052-140010074 GTGTGGAGCAGGTGTGGGGCGGG - Intronic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1033453552 7:141482546-141482568 TTGTGGAGGTGGATGGGGGAAGG - Intergenic
1034445594 7:151112550-151112572 CTCTGGAGACGGAGAGGGGATGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035095724 7:156353377-156353399 AACTGGAGCAGGAGTGGGGATGG - Intergenic
1035370346 7:158375868-158375890 ATGGGGAGCTGGAGAGGGGATGG - Intronic
1035382426 7:158448390-158448412 CTGGGGAGGAGGAGGGAGGTTGG + Intronic
1035732058 8:1860318-1860340 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1035732080 8:1860385-1860407 GAGAGGAGGAGGAGGGGGGAAGG - Intronic
1036135853 8:6160976-6160998 GAGGGGAGCAGGAGGTGGGAGGG - Intergenic
1036242369 8:7091540-7091562 CTGTGGACCAGGCGTGGTGATGG - Intergenic
1036308202 8:7617036-7617058 CTGTGGACCAGGTGTGGTGATGG - Intergenic
1036359059 8:8065037-8065059 CTGTGGACCAGGTGTGGTGATGG - Intergenic
1036380284 8:8232226-8232248 TGGTGCAGCAGGAGGGGGGACGG - Intergenic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1036830366 8:12015590-12015612 CTGTGGACCAGGCGTGGTGATGG + Intergenic
1036849274 8:12190434-12190456 TGGTGCAGCAGGAGTGGGGACGG + Intronic
1036870634 8:12432708-12432730 TGGTGCAGCAGGAGTGGGGACGG + Intronic
1036891899 8:12601915-12601937 CTGTGGACCAGGTGTGGTGATGG + Intergenic
1036899446 8:12659890-12659912 CTGTGGACCAGGTGTGGTGATGG + Intergenic
1036900513 8:12666037-12666059 CTGTGGACCAGGCGTGGTGATGG + Intergenic
1037540924 8:19870276-19870298 CTGGAGAGCAGGAGATGGGAAGG + Intergenic
1037568863 8:20141622-20141644 GGGAGGAGGAGGAGGGGGGAGGG + Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037797934 8:22011706-22011728 CTCTGGAGGCTGAGGGGGGAGGG + Intergenic
1037813590 8:22100573-22100595 ATCTGGAGCAGGAAGGGGGTCGG - Exonic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037881374 8:22575032-22575054 CGCTGGAGCAGGATGGGGGTGGG - Exonic
1037917048 8:22779042-22779064 CTGGGGAGTAGGTGGTGGGAAGG + Intronic
1038332042 8:26616735-26616757 CCGTGGAGCAGGAGGGAAGAGGG - Intronic
1038626548 8:29198920-29198942 AGGGGGAGCAGGAGGGGTGAAGG + Intronic
1038900841 8:31841990-31842012 ATGGGGAGGAGGAGGAGGGAAGG - Intronic
1039088035 8:33799395-33799417 ACGTGGAGCAGGAGCGGTGAGGG + Intergenic
1039103977 8:33970609-33970631 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1039799158 8:40939228-40939250 CTGAGGAGCAGGAAAGGTGACGG - Intergenic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1040850726 8:51898732-51898754 CTGCGGGGCAGGTTGGGGGAAGG - Intronic
1041012753 8:53559990-53560012 TTGGGGAGCAGGAGGGTTGAGGG - Intergenic
1041169769 8:55129628-55129650 CTGAGGACCAGAAGAGGGGATGG + Intronic
1041205904 8:55497945-55497967 GTGTGGAACAGCAGCGGGGATGG - Intronic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1042180075 8:66078852-66078874 CTATGAAGCAGGAGTGGGGCAGG + Intronic
1042188145 8:66157220-66157242 AGGTGGAGCAGGTGTGGGGAGGG + Intronic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042843422 8:73147416-73147438 CTGTCAGGCAGGAGGGGGTAGGG - Intergenic
1042965542 8:74348007-74348029 CTCTGAAGCAGGATGGAGGATGG + Intronic
1042984371 8:74566688-74566710 ATGGGGAGCTGGAAGGGGGATGG - Intergenic
1043999786 8:86865442-86865464 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1044840509 8:96333050-96333072 GTGTGGAGCAGGTGAAGGGATGG + Intronic
1045146200 8:99347261-99347283 CTGTGGTGGAGAAGGAGGGATGG - Intronic
1047084801 8:121504935-121504957 AGGAGGAGCAGGAGTGGGGATGG - Intergenic
1047113788 8:121818524-121818546 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1047177233 8:122553446-122553468 CTATGGACCAGGGTGGGGGAAGG + Intergenic
1047292423 8:123541603-123541625 CTCGGGGGCAGGAGGGGGGCTGG - Intergenic
1047327185 8:123851131-123851153 CGGGGGAGCAGGAGGGGAGAGGG + Intergenic
1047521816 8:125600758-125600780 TTGGGGAGCAGAAGGGAGGAGGG + Intergenic
1047594521 8:126365049-126365071 CTGTGGGGAAGAAGGGGGAAAGG + Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1047920279 8:129628320-129628342 CTGTGGTGGAGAAGGTGGGAGGG - Intergenic
1048774616 8:137932088-137932110 ATGTGGAGAAGGCGGGGGGTTGG + Intergenic
1049046669 8:140157410-140157432 CTGTGGACCAGGTGGAGGGGAGG + Intronic
1049188487 8:141272395-141272417 ATGTGGAGGAGAAGGTGGGAGGG - Intronic
1049267331 8:141675527-141675549 CTGTTGTGCAGGAGTGGAGAAGG + Intergenic
1049306578 8:141907211-141907233 GCGTGGAGGAGGAGAGGGGAGGG + Intergenic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049436234 8:142587447-142587469 CTGTGGAGCGGGAGGGAGTGGGG + Intergenic
1049436244 8:142587472-142587494 CTGTGGAGCGGGAGGGAGTGGGG + Intergenic
1049530234 8:143150917-143150939 GCGTGGAGCAGGAAGGGGCAAGG - Intergenic
1049640171 8:143711791-143711813 CTGGGGGGCAGGAGGGAGGCTGG - Intronic
1049805765 8:144538101-144538123 CTGGGGAGCAGGAGGAGAGCAGG + Intronic
1051263471 9:15288534-15288556 ATGGGGAGCTGGAAGGGGGATGG - Intronic
1051414588 9:16825612-16825634 CTGGGGAGGAGGAGGAGGGGAGG + Intronic
1051840458 9:21391952-21391974 CTGCGAAGCAGGAGGAGGAAGGG + Intergenic
1052508395 9:29383178-29383200 CTGTATAGCAAGAGTGGGGAAGG + Intergenic
1053350801 9:37412153-37412175 GTGGGAAGCAGGAGAGGGGAGGG - Intergenic
1053596499 9:39566998-39567020 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053751956 9:41266199-41266221 CTCAGGCGCAGGAGGGAGGACGG + Intergenic
1053854464 9:42323638-42323660 CTGTGGAGCAGCAGGAAGGAAGG - Intergenic
1053885926 9:42645213-42645235 CTGAGCAGTAGGAGGGGGGCTGG + Intergenic
1054224944 9:62452662-62452684 CTGAGCAGTAGGAGGGGGGCTGG + Intergenic
1054257479 9:62830529-62830551 CTCAGGCGCAGGAGGGAGGACGG + Intergenic
1054569760 9:66798020-66798042 CTGTGGAGCAGCAGGAAGGAAGG + Intergenic
1054918705 9:70520460-70520482 CTGTGGAGGAGGATGGGCGAGGG + Intergenic
1055150933 9:72998746-72998768 CTGTGGAGAAAGAGGGTGTATGG - Intronic
1055436712 9:76298930-76298952 CTGGGGAGCAGCATGGGTGAAGG - Intronic
1055514535 9:77022170-77022192 CTGGGGCTCAAGAGGGGGGAAGG - Intergenic
1055859661 9:80732901-80732923 CTGTGGGGTGGGAGGCGGGAAGG - Intergenic
1056485077 9:87047737-87047759 CTGTTGTGGGGGAGGGGGGAAGG + Intergenic
1057038701 9:91832080-91832102 CTGTAGAGCAGGATGAGGAATGG + Intronic
1057140515 9:92724121-92724143 CTTTGGAGCAGGGGTGGTGATGG - Intronic
1057152757 9:92809103-92809125 CTTTGGAGGAGGAGCGGGGCGGG + Intergenic
1057211808 9:93204588-93204610 CTGAGGGGCAGGGGTGGGGAAGG + Intronic
1057300744 9:93880232-93880254 CCGTGGAGCAGGGTGGGGGGGGG - Intergenic
1057815337 9:98290096-98290118 CTCTGGGGGAGGAGGTGGGAAGG - Exonic
1057875162 9:98747998-98748020 CTTTGGAGAAAGAGGGGGAACGG - Intronic
1058207442 9:102126538-102126560 CTGTTGTGAAGGGGGGGGGAAGG - Intergenic
1058227454 9:102383094-102383116 GGGTGGGGGAGGAGGGGGGAGGG - Intergenic
1058618839 9:106862707-106862729 CTGGGGTTCAGCAGGGGGGAGGG + Intergenic
1058910072 9:109512895-109512917 CTTAGGGGCAGGAGGAGGGAGGG - Intergenic
1059257631 9:112945614-112945636 CCGAGGAGCATGGGGGGGGAAGG - Intergenic
1059268613 9:113059147-113059169 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059269665 9:113063930-113063952 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059270799 9:113069378-113069400 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059271933 9:113074825-113074847 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059273067 9:113080272-113080294 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059274203 9:113085714-113085736 CTTTGGAGAAGGAGGTGGAAGGG - Intergenic
1059455058 9:114395097-114395119 CTGGGGTGCAGGAGGGAGGGAGG + Intergenic
1059925663 9:119206702-119206724 TTGTAGAGCAGGAGTGGGGAGGG - Intronic
1060050857 9:120377134-120377156 GAGTGGAGAAGGAGGGGAGAAGG + Intergenic
1060110393 9:120902582-120902604 CTGTGTGGCAGGATGGGGGAGGG - Exonic
1060124034 9:121024294-121024316 GAGGGGAGCGGGAGGGGGGAGGG + Intronic
1060124067 9:121024349-121024371 GAGGGGAGCGGGAGGGGGGAGGG + Intronic
1060198154 9:121636427-121636449 TTCAGGAGCAGGAGGGAGGAGGG + Intronic
1060317577 9:122526897-122526919 CTGTGGAGTAGCAGAGGGGGTGG + Exonic
1060351600 9:122866371-122866393 GTGGGGAGAGGGAGGGGGGAGGG - Intronic
1060571274 9:124642698-124642720 CTGTGGGGCAGGGTGGTGGAGGG + Intronic
1060712495 9:125882120-125882142 CTATGGAGGATGAGGTGGGAGGG + Intronic
1060819341 9:126652284-126652306 CTGAGGAGGAGAAGGGGGGGGGG + Intronic
1060920642 9:127418118-127418140 CTCTGGGGCAGGAGCTGGGATGG - Intergenic
1061282874 9:129607543-129607565 CTGTTGAGCAGGCAGAGGGAAGG - Intergenic
1062024098 9:134332514-134332536 CTGTGGAGGAGGGGTGGGGGAGG + Intronic
1062031337 9:134363365-134363387 CTGAGCAGCGGGAGGTGGGAAGG + Intronic
1062196362 9:135276398-135276420 CTGTGTGGCAGGAGGTTGGAGGG - Intergenic
1062356861 9:136169201-136169223 CTGTGGCCAAGGAGGGGGCAAGG + Intergenic
1062363709 9:136199162-136199184 CTGTGGGGCGGGATGGGGGTGGG - Intronic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062678340 9:137761940-137761962 CTGTTGAGCAGCAGGGGCGGGGG - Intronic
1062719027 9:138025228-138025250 CTGTGGAGCAGGAGGGAATGGGG - Intronic
1062735454 9:138134875-138134897 CTGTGGCCAAGGATGGGGGAAGG + Intergenic
1203475222 Un_GL000220v1:144360-144382 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1185836926 X:3353236-3353258 CCGTAGAGCAGGATGGGGGTGGG + Intergenic
1186056473 X:5654707-5654729 ATGGGGAGCTGGAGAGGGGATGG + Intergenic
1186581406 X:10823317-10823339 CTGTTGGGGAGGTGGGGGGATGG + Intronic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1186693701 X:12006649-12006671 CTGTGGAGAAGGAGGGAGTCTGG - Intergenic
1186833290 X:13412415-13412437 CGGGGGAGTTGGAGGGGGGAAGG + Intergenic
1187065341 X:15830246-15830268 TTGTGGGGCAGGAGGAGGAAAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187319334 X:18226280-18226302 CAGGGGAGCTGGAGGAGGGAAGG + Intergenic
1187344360 X:18449491-18449513 CTGGGGGGCGGCAGGGGGGAAGG - Intronic
1187464581 X:19515563-19515585 CGGCGGGGCAGGAGCGGGGAGGG + Intergenic
1187586749 X:20671361-20671383 GTGGGGAGCAGCAGGGGAGATGG - Intergenic
1189338759 X:40188004-40188026 CTCTGGAGGATGAGGTGGGAGGG - Intergenic
1189450303 X:41122804-41122826 ATGGGGAGCTGGAGAGGGGATGG + Intronic
1189880876 X:45491080-45491102 CAGTGGAGCTGGTGGGGGGAAGG - Intergenic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1190198082 X:48336732-48336754 CGGTGGAGCAGCATGGAGGAGGG + Intergenic
1190569375 X:51766173-51766195 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
1190733761 X:53241752-53241774 CTGTGGGGGAGGAGATGGGAGGG - Intronic
1190771555 X:53518958-53518980 CTGTACAGCAAGAGTGGGGAAGG + Intergenic
1191047187 X:56151049-56151071 ATATGGAGCAGGAGGGAGTATGG + Intergenic
1191054984 X:56232309-56232331 CTGAGAAGGAGGAGGGAGGAAGG - Intergenic
1191724328 X:64263183-64263205 TTGTGGAGAAGGAGGTGGGAAGG - Intergenic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192142390 X:68656857-68656879 GTGGGGTGGAGGAGGGGGGAGGG + Intronic
1192180754 X:68914345-68914367 GAGGGGAGCGGGAGGGGGGATGG - Intergenic
1192525325 X:71838073-71838095 TTGTGGGGTGGGAGGGGGGAGGG - Intergenic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1194558549 X:95393105-95393127 CTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194763076 X:97816994-97817016 ATGGGGAGCTGGAAGGGGGATGG + Intergenic
1195010299 X:100727045-100727067 CAGTGCAGCAGGAGGAGAGAAGG - Intronic
1195423283 X:104699162-104699184 CTGTGGACTTGGTGGGGGGATGG + Intronic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195753370 X:108178442-108178464 CCATGGAGGAGGCGGGGGGAGGG + Intronic
1196108998 X:111926117-111926139 CAGTGGAGCAGGGGGAGGCAGGG + Intronic
1196201094 X:112886928-112886950 GTGGGGAGCAGGTGTGGGGAAGG - Intergenic
1196459747 X:115917916-115917938 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1196768936 X:119273784-119273806 CTTTGCAGCAGGAGAGGGGCGGG - Intergenic
1196852355 X:119949501-119949523 CTGTGGAGGTGGAGTGGGGCAGG - Intergenic
1197708349 X:129649616-129649638 CTGTGCACCAGGAGGGGGGTGGG + Intronic
1197742153 X:129903465-129903487 CTGTGGAGCATAAGGGGGAGGGG + Intergenic
1198267289 X:135021749-135021771 CTGGTGAGGAGGAGGGGGGTTGG + Exonic
1198638688 X:138730185-138730207 GTGGGGTGGAGGAGGGGGGAAGG + Intronic
1198806713 X:140501625-140501647 CTGTGCAGCATGGGGTGGGAGGG - Intergenic
1199074174 X:143510859-143510881 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199093168 X:143714120-143714142 AGGTGGAGAAGGAAGGGGGATGG - Intronic
1199215167 X:145254040-145254062 AGGTGGAGAAGGAAGGGGGATGG + Intronic
1200071422 X:153531257-153531279 CTGGGGAGCAGGTGGGGAGAGGG - Intronic
1200097998 X:153673199-153673221 GTGTGGACCTGGACGGGGGAGGG - Intronic
1200397671 X:156000723-156000745 CTGTGGTCAAGGATGGGGGAAGG + Intronic
1201239648 Y:11946501-11946523 CCATGGAGCAGGATGGGGGTGGG - Intergenic
1201259836 Y:12148176-12148198 CTGTATAGCAAGAGTGGGGAAGG - Intergenic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1201789638 Y:17825408-17825430 GTGTGGAGCGGGTGGGGGGGGGG - Intergenic
1201811916 Y:18080581-18080603 GTGTGGAGCGGGTGGGGGGGGGG + Intergenic
1202351289 Y:23995158-23995180 GTGTGGAGCGGGTGGGGGGGGGG - Intergenic
1202519490 Y:25674961-25674983 GTGTGGAGCGGGTGGGGGGGGGG + Intergenic