ID: 1097200234

View in Genome Browser
Species Human (GRCh38)
Location 12:57272293-57272315
Sequence GAGTATAGTTCAGCCTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097200234 Original CRISPR GAGTATAGTTCAGCCTGTGC TGG Intronic
900136261 1:1118346-1118368 GAGCACAGTTCAGCAGGTGCTGG - Intergenic
913561349 1:120023514-120023536 TAGTATGGTTCAGCCTGCACTGG - Intronic
913636778 1:120770088-120770110 TAGTATGGTTCAGCCTGCACTGG + Intergenic
914281933 1:146182923-146182945 TAGTATGGTTCAGCCTGCACTGG - Intronic
914542962 1:148633630-148633652 TAGTATGGTTCAGCCTGCACTGG - Intronic
914623659 1:149437382-149437404 TAGTATGGTTCAGCCTGCACTGG + Intergenic
916148452 1:161762678-161762700 GAGTGTAGTTCAGGCTGAACAGG + Intergenic
916893748 1:169139405-169139427 GTCTCTGGTTCAGCCTGTGCTGG + Intronic
923527324 1:234782610-234782632 CTGTGTAGTTCAGCCTGTGAAGG - Intergenic
1064458597 10:15511504-15511526 CAGTATAAATCAGCCTGTGTGGG - Intergenic
1067465140 10:46491987-46492009 GAGTATTGTACTGCCTGAGCTGG - Intergenic
1067622048 10:47892614-47892636 GAGTATTGTACTGCCTGAGCTGG + Intergenic
1070563856 10:77588966-77588988 GTGAATACTTCAGACTGTGCAGG + Intronic
1075199858 10:120393674-120393696 GAGTATTGTACAGGCTATGCAGG + Intergenic
1076623969 10:131810460-131810482 GAGCAAAATTCAGCCTGAGCAGG + Intergenic
1083083143 11:60114317-60114339 AAGTCTAGTTCAGGCTGTGATGG - Intergenic
1085025705 11:73235297-73235319 CAGAACACTTCAGCCTGTGCAGG + Exonic
1091888531 12:4033854-4033876 GAGTTTAGTTCTGCTTGGGCAGG + Intergenic
1094713560 12:32988692-32988714 GAATATAATGCAGACTGTGCAGG + Intergenic
1097200234 12:57272293-57272315 GAGTATAGTTCAGCCTGTGCTGG + Intronic
1098658650 12:73066632-73066654 GAGTCTATTTCAGCTTTTGCTGG + Intergenic
1101924542 12:108960134-108960156 GTGAATAGTTCAGGCTTTGCAGG + Intronic
1102731966 12:115119386-115119408 AAGAACAGCTCAGCCTGTGCTGG + Intergenic
1104512910 12:129397805-129397827 GAGTTCAGTGCAGCCAGTGCAGG - Intronic
1110805697 13:79751766-79751788 CAGTTTAGTTCAGCCTGTTTTGG + Intergenic
1117288262 14:54308135-54308157 TAAGATAGTTCAGCATGTGCAGG + Intergenic
1137463565 16:48687694-48687716 AAATATAGTTAAGCCTGTGAAGG - Intergenic
1137562608 16:49512566-49512588 CAGTAGAATTCAGGCTGTGCTGG + Intronic
1139085381 16:63578561-63578583 CAGGATAGTTAAGCCTTTGCAGG - Intergenic
1139561004 16:67742241-67742263 GTGTATAGTTGAGCTTGTCCTGG - Intronic
1151671019 17:75571752-75571774 GAGAATGGATGAGCCTGTGCGGG + Exonic
1153710075 18:7789724-7789746 AAGTATAGTTGTGCTTGTGCAGG + Intronic
1158266746 18:55667219-55667241 GAGTATTGATCAGTTTGTGCAGG + Intergenic
1160471929 18:79144038-79144060 AAGTATATTTCAGTGTGTGCAGG + Intronic
1162380655 19:10329778-10329800 GGGTGCAGTGCAGCCTGTGCGGG + Intronic
1165320689 19:35083579-35083601 GAGTCTGGGTCAGCCTGTCCTGG + Intergenic
926550763 2:14298478-14298500 GAGAATAGTTGAGACTTTGCAGG - Intergenic
929868944 2:45741732-45741754 AAGGCTAGTACAGCCTGTGCTGG + Intronic
932530076 2:72520879-72520901 CTGTACAGTTCATCCTGTGCTGG - Intronic
933216842 2:79640336-79640358 AAGTATAGTTCAAGCTGTGCAGG - Intronic
946695562 2:222354947-222354969 GAGTCTAGGTGAGGCTGTGCAGG - Intergenic
1173223078 20:41145377-41145399 GAGTAGAGTGCTGCCTGTGTGGG + Intronic
1182798076 22:33005938-33005960 GAGTATAGTTCAGAGCCTGCTGG - Intronic
1183978289 22:41525635-41525657 GAGTACAGCTCAGGCTGGGCTGG + Intronic
1184929321 22:47669277-47669299 GAGAATAATTCAGCCAGTGGTGG + Intergenic
952599042 3:35056459-35056481 AAGTTTATTTTAGCCTGTGCAGG - Intergenic
958867970 3:99523426-99523448 GAGGATAATTGAGTCTGTGCTGG - Intergenic
962986599 3:140541824-140541846 GCGTATAGATCAGCCTTTGGGGG - Intronic
964523600 3:157593560-157593582 GAGTGGACTTCAACCTGTGCAGG + Intronic
971363499 4:25957762-25957784 GAGAATGTTTCAGCATGTGCTGG - Intergenic
977413076 4:96692987-96693009 GACTATACTTCATCCTGTACTGG + Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
983136884 4:164095184-164095206 GAGTATAATCCAGGCTGTTCTGG - Intronic
992189735 5:74280120-74280142 GAGTTTAGTTCTTCCTGTGTTGG + Intergenic
993554600 5:89320310-89320332 GAGTTTAGTTCAACCTCTGCTGG + Intergenic
997718162 5:136057478-136057500 GAGTATCTTGCAGCCTGTGTTGG + Intronic
997798287 5:136833803-136833825 GAGTAAAGTTGACCCTGTGAGGG + Intergenic
998171541 5:139874800-139874822 CAGTATATTTCAGACTATGCTGG + Intronic
998431047 5:142070202-142070224 GAGGAAACTTCAGCCTGTGCAGG + Intergenic
1012859888 6:104546312-104546334 GACTATGGTTCATCCTCTGCTGG + Intergenic
1013170115 6:107629363-107629385 GAGTAAAGTTCAGCCTTTAATGG - Intronic
1017257899 6:152354817-152354839 GAGTCTCGGACAGCCTGTGCTGG + Exonic
1024842893 7:53607777-53607799 GAGTATTGTCCAGCCTGTTTAGG + Intergenic
1029955097 7:104630404-104630426 GAATATAGGTCACCTTGTGCAGG + Intronic
1031018327 7:116599068-116599090 GAGTATTGTTCATTCTGGGCTGG + Intergenic
1033982814 7:147187142-147187164 GAGTATAGTTAAGCCACTGCAGG + Intronic
1040751542 8:50714772-50714794 GATTGTGGTTGAGCCTGTGCTGG - Intronic
1043353012 8:79383680-79383702 GAGCATAGTTCAGCCACTCCTGG - Intergenic
1047453655 8:124989487-124989509 GGGTATTGATCAGCCTGAGCAGG + Intergenic
1048421512 8:134282890-134282912 GAGTATATTTCAGATTGTTCTGG - Intergenic
1054946659 9:70803476-70803498 GAGTCTCGCTCAGCCTGGGCTGG + Intronic
1057630647 9:96716463-96716485 CAGTACAGTTCAGCCACTGCTGG + Intergenic
1188108516 X:26170009-26170031 GAGTATTCTTCAGACTTTGCTGG + Intergenic
1190848385 X:54215238-54215260 CAGTACAGTCCAGCCTGGGCTGG - Intronic
1193543694 X:82801562-82801584 GAGTATAGTTGAGCCTGAATTGG - Intergenic
1194280965 X:91953984-91954006 GAGTATATTGCAGGATGTGCAGG + Intronic
1195773569 X:108378170-108378192 GAGTAGAGTCCAGGCAGTGCTGG - Intronic
1200795453 Y:7337385-7337407 GTGCACAGTTCAGCCAGTGCAGG + Intergenic
1200982753 Y:9277164-9277186 GAATATATTACAGCCTGTGATGG - Intergenic
1201610043 Y:15831166-15831188 AAGGATAGTTGAGCCTGTGGTGG + Intergenic
1202127631 Y:21582513-21582535 GAATATATTACAGCCTGTGATGG + Intergenic
1202151636 Y:21848969-21848991 GAATATATTACAGCCTGTGATGG - Intergenic