ID: 1097200859

View in Genome Browser
Species Human (GRCh38)
Location 12:57277370-57277392
Sequence TCAGTACTGTTCCCAGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097200856_1097200859 7 Left 1097200856 12:57277340-57277362 CCTGCCAGGAAGGGAAAGATCAT 0: 1
1: 0
2: 1
3: 10
4: 185
Right 1097200859 12:57277370-57277392 TCAGTACTGTTCCCAGACCTGGG 0: 1
1: 0
2: 0
3: 33
4: 181
1097200857_1097200859 3 Left 1097200857 12:57277344-57277366 CCAGGAAGGGAAAGATCATAGTT 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1097200859 12:57277370-57277392 TCAGTACTGTTCCCAGACCTGGG 0: 1
1: 0
2: 0
3: 33
4: 181
1097200851_1097200859 26 Left 1097200851 12:57277321-57277343 CCTGCTTGGACAGAGGAGCCCTG 0: 1
1: 0
2: 1
3: 28
4: 220
Right 1097200859 12:57277370-57277392 TCAGTACTGTTCCCAGACCTGGG 0: 1
1: 0
2: 0
3: 33
4: 181
1097200855_1097200859 8 Left 1097200855 12:57277339-57277361 CCCTGCCAGGAAGGGAAAGATCA 0: 1
1: 0
2: 1
3: 30
4: 257
Right 1097200859 12:57277370-57277392 TCAGTACTGTTCCCAGACCTGGG 0: 1
1: 0
2: 0
3: 33
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097200859 Original CRISPR TCAGTACTGTTCCCAGACCT GGG Intronic
900612109 1:3548614-3548636 TCAGGACAGGTCCCAGAGCTTGG - Intronic
900703833 1:4063685-4063707 TCAGTGGTGGTCCCTGACCTGGG + Intergenic
901639561 1:10686482-10686504 TTAGAACTGTCCCCAGCCCTTGG - Intronic
903951324 1:26997601-26997623 TCAGTCCTGTCCCCAGAGCTGGG - Intronic
907485815 1:54777383-54777405 GCATGGCTGTTCCCAGACCTTGG - Intergenic
912026097 1:105175499-105175521 TCACTACTCTTCCCAGACACTGG + Intergenic
912072567 1:105830445-105830467 TCAGTACTTTTCGGAGAACTAGG + Intergenic
912432293 1:109635071-109635093 TCAGGACAGGTCCCAAACCTTGG - Intergenic
915900043 1:159840356-159840378 GCAGTCCTGCTCCCAGACCAGGG + Intronic
917372521 1:174311052-174311074 TCACTACTATTCCCAGCCCCTGG + Intronic
919120421 1:193333794-193333816 TCTGTACTGTTCCCAAAGCCTGG + Intergenic
919841339 1:201611434-201611456 GCAGTCCTGTCCCCAGCCCTGGG + Intergenic
920381845 1:205539298-205539320 TCAGTACTGTTTCCTGCCTTGGG + Intergenic
921826504 1:219678077-219678099 TCACTACTATTTCCAGAACTTGG - Intergenic
922075304 1:222237760-222237782 TCAGGACTTTTCCCAAATCTGGG - Intergenic
924249187 1:242114522-242114544 CCAGTACTGGTCCCTGGCCTGGG - Intronic
1066534889 10:36380867-36380889 ACAGAATTGTTCCCAGACCACGG + Intergenic
1066973102 10:42335347-42335369 TAATTACTGTTCAAAGACCTTGG - Intergenic
1067524710 10:47031314-47031336 TCAGGCCTGCTCCCCGACCTGGG - Intergenic
1069873179 10:71545606-71545628 TAAGCACTGTTCCCAGAGCTGGG + Intronic
1071487432 10:86111888-86111910 TCTGTAGTATTCCCAGACCATGG - Intronic
1072520979 10:96229901-96229923 CCAGTCCTGTGCCCAGCCCTGGG - Intronic
1073095979 10:100980000-100980022 TCAGCACTGGCCCCAGGCCTGGG - Intronic
1076196854 10:128524878-128524900 TCATTTCTGGTCCTAGACCTGGG - Intergenic
1085034378 11:73291336-73291358 TCAGAGCTGTTCCCATTCCTGGG + Intronic
1085205262 11:74727950-74727972 CCAGTACTGGTCCCAGCCCCAGG - Intronic
1087205395 11:95388687-95388709 TCAGTACTCTTCCCTGACAATGG + Intergenic
1089609108 11:119659648-119659670 TCAGTCCTTTCCCCAGGCCTTGG - Intronic
1091902549 12:4156213-4156235 TCAGAACTGCTCCAAGAGCTAGG - Intergenic
1091999454 12:5020395-5020417 CCAGGACTGTACCCAGAGCTGGG - Intergenic
1094436634 12:30427727-30427749 TCAGTGCCGTTTCCAGACCCAGG - Intergenic
1096203689 12:49704986-49705008 TCAGTACTGTTCCCAAAGCATGG + Intronic
1096785320 12:54014089-54014111 TCAATGATTTTCCCAGACCTAGG + Intronic
1097200859 12:57277370-57277392 TCAGTACTGTTCCCAGACCTGGG + Intronic
1097625330 12:61993137-61993159 TCATTACTGTTCCCTAAACTGGG + Intronic
1097876174 12:64645888-64645910 TCAGTAATCTCCCCAGCCCTTGG + Intronic
1098292515 12:68970219-68970241 TCAGTACAGTGGCCAGCCCTTGG + Intronic
1101159253 12:101956566-101956588 CCAGTACTGGTCCGTGACCTGGG + Intronic
1102415875 12:112762226-112762248 TCAGTATTGTGCCCAGACTTTGG - Intronic
1103272893 12:119688238-119688260 TGAAGACTGGTCCCAGACCTAGG + Exonic
1105318310 13:19289435-19289457 TCAGTACTGGTCCTTGGCCTGGG + Intergenic
1105644789 13:22304993-22305015 TGAGGAGTGTTCCCAGATCTTGG - Intergenic
1105800923 13:23902950-23902972 TCAGTGCTTCTCCCTGACCTTGG + Intergenic
1105847971 13:24309136-24309158 TCAGTGCTTCTCCCTGACCTTGG - Intronic
1106315529 13:28590066-28590088 TCAGTGCTGTTCCCACCCCAGGG - Intergenic
1107617149 13:42181535-42181557 TCTGGAGTGTTCCCAGAACTAGG - Intronic
1108672517 13:52706243-52706265 TCATTACTGTTTGCAGACATAGG + Intronic
1114750290 14:25197021-25197043 TCAGTATTGTACCTAGACCTTGG - Intergenic
1115270200 14:31543101-31543123 TCACTGCTGTTTCCAGTCCTAGG + Intronic
1116257722 14:42578361-42578383 TCAGTACCCTTCCCAGACTCTGG - Intergenic
1116849260 14:49892694-49892716 CCAGGCCTGTTCCCAGACCTCGG - Intergenic
1117479060 14:56125230-56125252 CCAGCACTGCTCCCAGCCCTGGG + Intronic
1124554475 15:30711876-30711898 CTAGTACTGATCCCAGACCTGGG + Intronic
1124676774 15:31693801-31693823 CTAGTACTGATCCCAGACCTGGG - Intronic
1125183221 15:36901183-36901205 TCCCTACTGTCCCCAGCCCTGGG + Intronic
1128803180 15:70510090-70510112 TCTGTGCTGCTCCCAGAGCTGGG - Intergenic
1131025375 15:89137033-89137055 GCACCACTATTCCCAGACCTGGG - Intronic
1131397467 15:92097975-92097997 ACAGTAATGTTCCCATACATTGG - Intronic
1132473019 16:117478-117500 TCATTGCTTTTCCAAGACCTTGG - Intronic
1136646608 16:31624601-31624623 GCAGAACTGCTCCCAGACCCTGG - Intergenic
1136658542 16:31731632-31731654 GCAGAACTGCTCCCAGACCCTGG + Intronic
1138191166 16:55015603-55015625 TTAGTACTGCACCTAGACCTGGG + Intergenic
1139375087 16:66491890-66491912 CCAGTACTGGTCCAAGGCCTGGG + Intronic
1141696178 16:85620743-85620765 TCTGCACTGTTCTCAGCCCTGGG + Intronic
1141728405 16:85805992-85806014 TCAGGATTGTTTCCAGGCCTTGG + Intronic
1143159373 17:4859052-4859074 CCAGTGCTGTTCCCAGACCCAGG - Intronic
1144405658 17:14950457-14950479 CCAGTACTGTTTGCAGGCCTGGG + Intergenic
1144999245 17:19291921-19291943 TCAGCTCTATTCCCAGAGCTGGG - Intronic
1148346991 17:46909972-46909994 TGAGCACTGGTCCCAGGCCTGGG + Intergenic
1151770593 17:76157908-76157930 TCCTTGCTGTTCCCAGACCTAGG + Intronic
1151829822 17:76542983-76543005 TCAGCACTTCTCCCACACCTGGG - Intronic
1153513979 18:5888060-5888082 ACAATACTGTTTCCAGTCCTCGG - Exonic
1155899396 18:31369353-31369375 TGAGTACTATGCTCAGACCTGGG + Intergenic
1156412179 18:36841132-36841154 TCTCTACTGTTCCCAGTCATTGG + Intronic
1158553094 18:58453652-58453674 TCTGAACTGTTCCCAGACTCGGG + Intergenic
1161980803 19:7629346-7629368 CCATTAGGGTTCCCAGACCTTGG + Intronic
1162571887 19:11479191-11479213 ACACTCCAGTTCCCAGACCTGGG + Intronic
1162910203 19:13843989-13844011 GCAGGACCCTTCCCAGACCTGGG + Intergenic
1163692386 19:18744826-18744848 TGACTACTGTCCCCAGCCCTGGG - Intronic
1164435319 19:28223623-28223645 ACAGTACTGTTATCAGATCTTGG + Intergenic
1164478914 19:28596699-28596721 TCATTACTGTTGACAGAGCTAGG - Intergenic
1164801293 19:31079004-31079026 TCTTTTCTTTTCCCAGACCTGGG + Intergenic
1166300049 19:41908105-41908127 GCAGCAATGTGCCCAGACCTGGG + Intronic
925976337 2:9144721-9144743 TCTGTCCTTTTCCCACACCTAGG + Intergenic
926114617 2:10204543-10204565 TCAGCGCTGTGCCCAGCCCTGGG + Intronic
928386450 2:30872498-30872520 TCATTACTGTTCTCACACCTGGG - Intergenic
928932978 2:36644692-36644714 TCACTACCCTTCCCAGACTTTGG - Intronic
931528580 2:63186489-63186511 CCAGTATTTTTCTCAGACCTGGG - Intronic
932877800 2:75471864-75471886 TCAGCACTGTTGCCATCCCTGGG + Intronic
933230728 2:79804130-79804152 TCAATAATGTTCCCAGATATGGG + Intronic
934476036 2:94594232-94594254 TCAGTGCTGTTTACAGAGCTCGG + Intronic
938141312 2:128796903-128796925 TCAGAACAGTTTCCAGACCATGG + Intergenic
938190975 2:129280382-129280404 TCAGTAATGACCCCAGAACTTGG - Intergenic
938322755 2:130376045-130376067 TCAGCACTGTTCTCGGAGCTGGG - Intergenic
945476476 2:210287677-210287699 GCAGTACTGTTCTCAGACAAGGG - Intergenic
948307016 2:236955818-236955840 TGACTATTTTTCCCAGACCTTGG - Intergenic
1170256470 20:14349618-14349640 TGAGTACTTTTCCCAGACCCTGG + Intronic
1172314586 20:33943936-33943958 TCAGTACTGTCCTTAGACCCAGG + Intergenic
1173800994 20:45894486-45894508 GCAGGAATCTTCCCAGACCTGGG - Intronic
1175302621 20:57953474-57953496 TCAGTCATGTTCCAAGCCCTGGG + Intergenic
1176219883 20:63964827-63964849 TCACCACTGTTCCCCGACCTGGG + Intronic
1176219895 20:63964870-63964892 TTACCACTGTTCCCTGACCTGGG + Intronic
1176219906 20:63964913-63964935 TCACCACTGTTCCCTGACCTGGG + Intronic
1176219917 20:63964956-63964978 TCACCACTGTTCCCCGACCTGGG + Intronic
1176219929 20:63964999-63965021 TCACCACTGTTCCCTGACCTGGG + Intronic
1176219953 20:63965088-63965110 TCACCACTGTTCCCCGACCTGGG + Intronic
1176219975 20:63965174-63965196 TCACCACTGTTCCCCGACCTGGG + Intronic
1176219987 20:63965217-63965239 TCACCACTGTTCCCCGACCTGGG + Intronic
1176219999 20:63965260-63965282 TCACCACTGTTCCCCGACCTGGG + Intronic
1176220011 20:63965303-63965325 TCACCACTGTTCCCCGACCTGGG + Intronic
1176220023 20:63965346-63965368 TCACCACTGTTCCCCGACCTGGG + Intronic
1176220035 20:63965389-63965411 TCACCACTGTTCCCTGACCTGGG + Intronic
1176220046 20:63965432-63965454 TCACCACTGTTCCCCGACCTGGG + Intronic
1176220058 20:63965475-63965497 TTACCACTGTTCCCCGACCTGGG + Intronic
1176220109 20:63965656-63965678 TCACCACTGTTCCCTGACCTGGG + Intronic
1176220159 20:63965837-63965859 TTACCACTGTTCCCCGACCTGGG + Intronic
1176220171 20:63965880-63965902 TCACCACTGTTCCCTGACCTGGG + Intronic
1176220182 20:63965923-63965945 TTACCACTGTTCCCTGACCTGGG + Intronic
1176220206 20:63966012-63966034 TCACCACTGTTCCCCGACCTGGG + Intronic
1178132987 21:29594391-29594413 TCAGTACTGTTCTACGAACTAGG + Intronic
1178478943 21:32962450-32962472 TCAGTAATGTCCCCAGCCTTTGG + Intergenic
1182151193 22:28028272-28028294 TGAGTATTGTGCCCAGCCCTGGG - Intronic
1184512034 22:44939588-44939610 TAAGTAGGGTTCCCAGACATGGG + Intronic
956870605 3:73413640-73413662 GCAGTGCTGTTACCTGACCTGGG + Intronic
960300307 3:115995318-115995340 CCAGTACTGATCCCAGACAAGGG + Intronic
961461774 3:127054920-127054942 GCAGTCCTGTTCTCAGGCCTGGG - Intergenic
963087904 3:141455558-141455580 TCAGTATCATTCTCAGACCTAGG + Intergenic
963231332 3:142911189-142911211 TCAGTACTATTTGCAGAGCTTGG - Intergenic
964766788 3:160187150-160187172 TCATTTCAGTTCCCAGAACTTGG - Intergenic
967846796 3:194050324-194050346 TTACTACTGTTCTCAGACATTGG + Intergenic
968086733 3:195877261-195877283 TCATTCCTATTCCCAGACCCTGG + Intronic
969412843 4:7041101-7041123 TCAGTGCTGAGCCCAAACCTGGG - Exonic
969496522 4:7529506-7529528 TCAGTCCTGCTCCCCGCCCTGGG - Intronic
972822244 4:42715034-42715056 TTAGAACTGTGCCCAGCCCTTGG + Intergenic
973293089 4:48489826-48489848 CCAGAACAGTTCCCAAACCTTGG + Intergenic
974058649 4:57009933-57009955 TCAGTACTTTTTCCAGACTGAGG - Intronic
976561505 4:86506788-86506810 TCAGAACTGCTCCCAGACTGAGG + Intronic
977305971 4:95324125-95324147 CCAGTACTGGTCCCTGGCCTGGG - Intronic
977993992 4:103480769-103480791 TCAGTACTGATGCCACACCTGGG - Intergenic
981077746 4:140607701-140607723 TTAGTACTGTCCTCAGACGTGGG - Intergenic
981147147 4:141338554-141338576 TCAGTACCTTTTCCAGACCCAGG - Intergenic
981319043 4:143370328-143370350 GCAGTTCTGTTCCCTGACCCTGG + Intronic
981880928 4:149611671-149611693 CCATTACTCTTCCCAGACTTGGG - Intergenic
982042823 4:151411883-151411905 TGAGCACTGTTCCCCTACCTGGG - Intronic
982047220 4:151460772-151460794 TCAGAACTTTTACCTGACCTCGG - Intronic
982911547 4:161148723-161148745 ACAGTACTCTTCACAGGCCTTGG + Intergenic
984509083 4:180657238-180657260 TCCTTACTGTCCCCAGACCTTGG + Intergenic
985750318 5:1669880-1669902 TCTGTCCTGTTTCCAGGCCTGGG - Intergenic
987091725 5:14513580-14513602 TCAGTACTGGTCCACGGCCTGGG + Intronic
993675870 5:90815213-90815235 TCAGTTCTGTTCTCGGAGCTGGG + Intronic
996783656 5:127215359-127215381 TCAGTACTGATGCCAGAACCTGG - Intergenic
996806062 5:127455385-127455407 TCATTTCTCTTCACAGACCTGGG + Exonic
997733602 5:136197819-136197841 ACAGTCCTGTTCCCAGTCTTTGG - Intergenic
998086810 5:139333074-139333096 TCAGTACTCATCCCAAACTTAGG - Intergenic
998701883 5:144712108-144712130 TCAATCCTGCTCCCAGGCCTTGG - Intergenic
998769708 5:145528311-145528333 TCAGTACTTATCACAGTCCTAGG + Intronic
1000714480 5:164623576-164623598 TCAGTTCTGTTCCTTGACTTTGG - Intergenic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1002758231 6:181029-181051 GCAGTGCTGTGCCCACACCTAGG - Intergenic
1003951884 6:11124154-11124176 TCAGTACCGTTCCCAGCCTCTGG + Intronic
1008211769 6:48733258-48733280 TCAGTTTTGTTCCCAGGCTTAGG + Intergenic
1010976716 6:82323872-82323894 TCATTCTTGTTCCCAGTCCTTGG + Intergenic
1011207233 6:84913123-84913145 GCAGTACCGTTCCCAGGCCTTGG - Intergenic
1014349776 6:120325544-120325566 CCAGTACTGTTTCTTGACCTAGG + Intergenic
1014767393 6:125422338-125422360 CCAGTGCTGTTCCCAGTCTTTGG + Intergenic
1015108325 6:129563698-129563720 TCAGTACTTCTCCCAGTTCTGGG + Intergenic
1018826858 6:167415062-167415084 ACAGTAATTATCCCAGACCTAGG - Intergenic
1019015873 6:168878989-168879011 TCAGAACTGTCCCCCGACCCAGG + Intergenic
1019949681 7:4361367-4361389 CCAGTACTGGTCCATGACCTGGG + Intergenic
1020184392 7:5947818-5947840 CCAGTACTGCTCCCTGGCCTGGG + Intronic
1020298524 7:6776948-6776970 CCAGTACTGCTCCCTGGCCTGGG - Intronic
1021931958 7:25589903-25589925 TCTGTACTTTTCTCAGACTTGGG + Intergenic
1024487711 7:49938097-49938119 CCAGTACTGTTCCCTGGCCTGGG + Intronic
1024646373 7:51374321-51374343 TCAGAACTGTGGCCAGCCCTGGG - Intergenic
1025855943 7:65278668-65278690 GCAGGACTGTTCCCAGACACTGG + Intergenic
1026565070 7:71483055-71483077 TCAGTACTGGTCCAAGGCCTGGG + Intronic
1026586513 7:71660284-71660306 CCAGGACTGGTCCCAGAGCTTGG + Intronic
1027807351 7:82845319-82845341 CCAGTTCCGTTCCCAGCCCTGGG - Exonic
1028946777 7:96589093-96589115 GCAGTGCGGTTCCCACACCTGGG - Intronic
1029608710 7:101615226-101615248 TCAGTCCTCTCCCCAGACCCTGG + Intronic
1030812270 7:113989252-113989274 GCAGGACTGCTCCCAGACCATGG - Intronic
1031529653 7:122860737-122860759 CCAATACTTTTCCCAGCCCTTGG + Intronic
1034892722 7:154854983-154855005 TCACCTCTGTCCCCAGACCTAGG - Intronic
1037254868 8:16942038-16942060 TCGTTAATGTTCCCAGGCCTAGG - Intergenic
1038876783 8:31559025-31559047 CCAAGGCTGTTCCCAGACCTTGG - Intergenic
1042392197 8:68248823-68248845 CCAGCACTGTTCTCAGCCCTGGG + Intergenic
1045311973 8:101010638-101010660 TAGGTACAGTTCTCAGACCTGGG + Intergenic
1046638975 8:116703992-116704014 TCAGTACTGGTCCGTGGCCTGGG + Intronic
1048205355 8:132411299-132411321 AGTGTACTGTCCCCAGACCTTGG + Intronic
1048277996 8:133081759-133081781 TCAGCAGTGTTCCCAGAGGTTGG + Intronic
1049584749 8:143427729-143427751 CCAGAACTGTCCCCAGCCCTCGG - Intronic
1050922100 9:11216425-11216447 CCACTACCCTTCCCAGACCTTGG + Intergenic
1053351835 9:37418324-37418346 TCAGAAATGTTCCCTGGCCTGGG - Intergenic
1053682021 9:40491846-40491868 TCAGTGCTGTTTACAGAGCTCGG - Intergenic
1054281692 9:63133086-63133108 TCAGTGCTGTTTACAGAGCTCGG + Intergenic
1054295118 9:63327349-63327371 TCAGTGCTGTTTACAGAGCTCGG - Intergenic
1054393138 9:64631849-64631871 TCAGTGCTGTTTACAGAGCTCGG - Intergenic
1054427787 9:65137059-65137081 TCAGTGCTGTTTACAGAGCTCGG - Intergenic
1054502589 9:65884479-65884501 TCAGTGCTGTTTACAGAGCTCGG + Intronic
1056325173 9:85471894-85471916 TCAGTACTGGTCCATGGCCTGGG - Intergenic
1059182063 9:112225649-112225671 CCAGTACAGTACCCAGAACTTGG + Intronic
1062451463 9:136617446-136617468 TGGGTGCTGGTCCCAGACCTGGG - Intergenic
1186300224 X:8192630-8192652 TGAGTACATTTCCCAAACCTCGG - Intergenic
1189074871 X:37905217-37905239 ACAGTACTTTTCCAAGACCCAGG + Intronic
1190126397 X:47709244-47709266 TCATGACTGCTCCCAGACCATGG + Intergenic
1191115213 X:56845131-56845153 ACAGAACTGGTCCCAGACCATGG - Intergenic
1193031739 X:76906405-76906427 TCAGGCATTTTCCCAGACCTGGG + Intergenic
1193797668 X:85896437-85896459 TCAGAACTGTTCCCAGAAGTAGG + Intronic
1194040631 X:88938183-88938205 TCAGTGCTGGCCACAGACCTTGG + Intergenic
1194344110 X:92741610-92741632 TCACAACTGTTGCAAGACCTTGG - Intergenic
1195124264 X:101790039-101790061 CCAGTACTGGTCCATGACCTGGG - Intergenic
1195648782 X:107263169-107263191 TCTCTCCTCTTCCCAGACCTAGG - Intergenic
1196793073 X:119481714-119481736 CCAGACCTGCTCCCAGACCTGGG + Intergenic
1200018222 X:153181233-153181255 TCACTCCTGTTTCCAGATCTGGG + Intronic
1200652457 Y:5858264-5858286 TCACAACTGTTGCAAGACCTTGG - Intergenic