ID: 1097201495

View in Genome Browser
Species Human (GRCh38)
Location 12:57282649-57282671
Sequence TTTTGCTTTTTCAAGAGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1097
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 1030}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097201495_1097201498 5 Left 1097201495 12:57282649-57282671 CCCCGACTCTTGAAAAAGCAAAA 0: 1
1: 0
2: 2
3: 64
4: 1030
Right 1097201498 12:57282677-57282699 ATCATAAAAAGAGCTGAGAATGG 0: 1
1: 0
2: 4
3: 39
4: 496
1097201495_1097201499 24 Left 1097201495 12:57282649-57282671 CCCCGACTCTTGAAAAAGCAAAA 0: 1
1: 0
2: 2
3: 64
4: 1030
Right 1097201499 12:57282696-57282718 ATGGAGTAGAGATATCAGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 213
1097201495_1097201500 25 Left 1097201495 12:57282649-57282671 CCCCGACTCTTGAAAAAGCAAAA 0: 1
1: 0
2: 2
3: 64
4: 1030
Right 1097201500 12:57282697-57282719 TGGAGTAGAGATATCAGTTTGGG 0: 1
1: 0
2: 1
3: 18
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097201495 Original CRISPR TTTTGCTTTTTCAAGAGTCG GGG (reversed) Intronic
900317118 1:2062658-2062680 TTTTTCTTTTTGTAGAGTTGGGG + Intronic
901047167 1:6403990-6404012 TTTTGATTTTTATAGAGACGGGG + Intergenic
901369529 1:8784714-8784736 GTTTGCTTTTTTTAGAGTTGGGG - Intronic
902856097 1:19206638-19206660 TTTTTCTTTTTTAAGAGACAGGG - Intronic
902935239 1:19760170-19760192 TTTTTCTTTTTTAAGAGATGGGG + Intronic
903080345 1:20805963-20805985 TTATGCTTTTACAAAAGTGGGGG - Intergenic
903286495 1:22280437-22280459 TTTTTTTTTTTTAAGAGACGAGG + Intergenic
903388684 1:22947789-22947811 TTTTGGTTTTTGTAGAGACGGGG + Intergenic
903594244 1:24482066-24482088 TTTTTTTTTTTAAAGAATCGGGG - Intergenic
904000978 1:27338509-27338531 TTTTTTTTTTTTAAGAGACGGGG - Intergenic
904020136 1:27457625-27457647 TTTTTTTTTTTTAAGAGACGGGG + Intronic
904170353 1:28587799-28587821 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
904182670 1:28677750-28677772 TTTGGCCTTTTCTAGACTCGAGG + Intronic
904393612 1:30202790-30202812 TTTTACTTTTTCTAGAGATGCGG + Intergenic
904628800 1:31825897-31825919 TTTTACTTTTTTAAGAGACAGGG + Intergenic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
905076137 1:35271954-35271976 TTTTACTTTTTCTAGAGAGGGGG - Intronic
905088325 1:35404961-35404983 TTTTGGATTTTTAAGAGTCAGGG - Intronic
905469935 1:38184169-38184191 ATTAGCTTTTTGAAGAGTCTAGG + Intergenic
905593630 1:39186779-39186801 TTTTTCTTTTTGTAGAGTTGGGG + Intronic
905601700 1:39257642-39257664 TTTTGCTTTTTCCAGAGTGTTGG - Intronic
906181706 1:43826091-43826113 TTTTTTTTTTTGAAGAGACGAGG - Intronic
906330491 1:44880086-44880108 TTTTGTTTATTTAAGAGACGAGG + Intronic
906472259 1:46141032-46141054 TTTTTCTTTTTGTAGAGACGAGG + Intronic
906505349 1:46374879-46374901 TTTTTTTTTTTCCAGAGACGGGG - Intergenic
906618417 1:47252373-47252395 TTTTTCTTTTTTAAGAGACAGGG - Intronic
906620175 1:47270411-47270433 TTCTGCTTTTTCAAGAAGGGTGG + Intronic
906734654 1:48114237-48114259 TTTTGCTTTTTGTAGAGTTGGGG + Intergenic
907153492 1:52310529-52310551 TTTTGCTTTTTTAAGAGATGGGG - Intronic
907172666 1:52484026-52484048 TTTTGCTTTTTCAAGAGGCAAGG - Intronic
907375259 1:54032930-54032952 TTTTTTTTTTTAAAGAGACGGGG + Intronic
907376818 1:54051025-54051047 TTTTCTTTTTTCCAGAGACGGGG + Intronic
907415870 1:54313457-54313479 TTTTTCTTTTTAAAGAGCTGGGG + Intronic
908217071 1:61964779-61964801 TTTTTCTTTTTTAAGAGTTGAGG - Intronic
908568432 1:65383328-65383350 TTTTTCTTTTCGAAGAGTTGGGG + Intronic
909005586 1:70272529-70272551 ATTTTCTTTTTCAAGAGTAGTGG + Intronic
909957293 1:81795204-81795226 TTTTATTTTTTCTAGAGACGGGG - Intronic
910050607 1:82969626-82969648 TTTTGCCTTACCAAGAGTCAGGG + Intergenic
910131098 1:83907421-83907443 TTTTGCTCTTTCAAGATTACAGG - Intronic
910187422 1:84558726-84558748 TTTTACTTTTTGTAGAGACGGGG - Intronic
910276437 1:85454125-85454147 TTTTGCATTTTTCAGAGGCGGGG - Intronic
910704222 1:90109665-90109687 ATTTGCTTTTTAGAGAGTGGAGG + Intergenic
910803633 1:91169580-91169602 TTTTTTTTTTTCAAGAGACAGGG + Intergenic
910862088 1:91751701-91751723 TTTTGTATTTTCAAGAAGCGGGG - Intronic
910891869 1:92027197-92027219 TTTTTCTTTTTCAAGAGACAGGG - Intergenic
910953185 1:92673437-92673459 TTTTCCTTTTTAAAGATTTGTGG + Intronic
911017805 1:93353065-93353087 TTTTACTTTTTGTAGAGACGAGG + Intronic
911200790 1:95041605-95041627 TTTTTTTTTTTAAAGAGACGGGG - Intronic
911213659 1:95168572-95168594 TTTTTTTTTTTTAAGAGACGGGG + Intronic
911584854 1:99678956-99678978 TTTTTTTTTTTTAAGAGTCAAGG - Intronic
912328780 1:108797180-108797202 TTTTGTTTTTTGTAGAGGCGAGG - Intronic
912767997 1:112433908-112433930 TTTTTTTTTTTAAAGAGACGGGG + Intronic
912911252 1:113760616-113760638 TTTTTTTTTTTTAAGAGACGGGG - Intergenic
912930423 1:113954131-113954153 TTTTATTTTTTGTAGAGTCGGGG + Intronic
913009132 1:114665260-114665282 TTTTTTTTTTTCAAGAGACAGGG - Intronic
913488473 1:119355976-119355998 TTTTGTTTTTTGTAGAGACGAGG + Intergenic
914099302 1:144570128-144570150 ATTTGCTTTTTCTAGCGTAGTGG + Intergenic
914736343 1:150420817-150420839 TTTTTCTTTTTCTTGAGACGGGG - Intronic
914893321 1:151648016-151648038 AATTGCCTTTTAAAGAGTCGGGG + Intronic
914922519 1:151857079-151857101 TTTTCTTTTTTGTAGAGTCGGGG - Intergenic
915222018 1:154382483-154382505 TTTTGTTTTTTTAAGAGACAGGG + Intergenic
915241797 1:154528204-154528226 TTTTTTTTTTTTAAGAGACGAGG - Intronic
915297871 1:154934323-154934345 GTTTGGTTTTTTAAGAGTCAGGG + Intronic
915487736 1:156233786-156233808 TTTTTTTTTTTCTAGAGTCAGGG + Intronic
915590467 1:156867504-156867526 TTTTTCTTTTTGTAGAGTTGGGG + Intronic
916292139 1:163178458-163178480 TTATGCATTTTCAGGAGTCCAGG + Intronic
916441301 1:164827661-164827683 TTTTGCTTCTTCAATCATCGTGG - Intronic
916683404 1:167124082-167124104 TTTTGTTTTTTTTAGAGACGAGG + Intronic
916763856 1:167841512-167841534 TTTTTTTTTTTTAAGAGTTGGGG + Intronic
916780613 1:168024040-168024062 TTTTTTTTTTTTAAGAGACGGGG - Intronic
916796506 1:168172282-168172304 TTTTTTTTTTTAAAGAGTCAGGG - Intergenic
917361311 1:174179080-174179102 TTTTTATTTTTCAAGAGACAGGG + Intronic
917558226 1:176114758-176114780 TTTTGTTTTTTGTAGAGGCGGGG + Intronic
917955386 1:180091185-180091207 TTTTTTTTTTTTAAGAGACGGGG + Intronic
918293617 1:183133806-183133828 TTTTGTTTTTTTAAGAGATGGGG - Intronic
918457829 1:184742559-184742581 TTTGTCTTTTTGAAGAGACGGGG + Intronic
918478918 1:184956197-184956219 TTTTGTTTTTTGTAGAGACGAGG + Intronic
918556829 1:185811587-185811609 TTTTTATTTTTCAAGAGACAGGG - Intronic
919244410 1:194961570-194961592 TTTTCCTATTTCAAGAGAAGAGG + Intergenic
919702592 1:200646325-200646347 GTTTGTTTTTTTAAGAGACGGGG - Intronic
919719812 1:200821353-200821375 TTTTACTTTTTGTAGAGTCAGGG + Intronic
919741778 1:200985313-200985335 TTTTACTTTTTGTAGAGTTGAGG - Intronic
920004165 1:202820642-202820664 TTTTACTTTTTGTAGAGACGGGG + Intronic
920028614 1:203021036-203021058 TTTTTTTTTTTTAAGAGACGTGG + Intronic
920402786 1:205687142-205687164 TTTTTCTTTTTAAAGAGATGGGG + Intergenic
920411057 1:205761280-205761302 TTTTTTTTTTTTAAGAGTCAGGG - Intergenic
920514368 1:206573834-206573856 TTTTGTTTTTTTAAGAGATGGGG - Intronic
920962940 1:210680370-210680392 TTTTCCTCTTTGAGGAGTCGGGG - Exonic
921083069 1:211759268-211759290 TTTTGGTTTTTTTAGAGACGGGG + Intronic
921578249 1:216863681-216863703 TTTTTCTTTCTCAGGAGTCATGG + Intronic
921720822 1:218469205-218469227 TTTAGTTTTTTGTAGAGTCGAGG - Intergenic
921723828 1:218502829-218502851 TTTTTCTTTTTGAAGAGACAGGG + Intergenic
922305745 1:224342850-224342872 TTTTTCTTTTTTAAGAGTTAGGG + Intergenic
922510038 1:226157712-226157734 TTTTTCTTTTTTAAGAGATGGGG + Intronic
922518802 1:226228182-226228204 TTTTTTTTTTTCAAGAGACAGGG - Intergenic
922526110 1:226305484-226305506 TTTTGTTTTTTAAAGAGACAGGG - Intronic
922575892 1:226660407-226660429 TTTTGGTTACTCAAGAATCGAGG + Intronic
923697537 1:236268578-236268600 TTTTGCTTTTTTTAGAGACAGGG - Intronic
923705236 1:236338589-236338611 TTTTTCTTTTTGCAGAGACGGGG - Intergenic
923726757 1:236512502-236512524 TTTTTATTTTTCTAGAGACGGGG + Intergenic
924150454 1:241124220-241124242 TTTTTTTTTTTCTAGAGACGAGG - Intronic
924171909 1:241351244-241351266 TTTTGTTTTTTCTAGAGATGGGG - Intronic
924207760 1:241731334-241731356 TTTTTTTTTTTTAAGAGACGAGG - Intronic
924480803 1:244432365-244432387 TTTTTCTTTTTTAACAGTCTAGG - Intronic
924526104 1:244850979-244851001 TTTTTTTTTTTCAAGAGACCAGG + Intronic
924749277 1:246870414-246870436 TTTTGTTTTTTTAAGAGACAAGG - Intronic
924790499 1:247242846-247242868 TTTAGCTTTTTATAGAGACGGGG + Intergenic
1062766200 10:67429-67451 TTTTGTTTTTTCCAGAGATGGGG + Intergenic
1063022181 10:2140486-2140508 TTTTGCGTTTTGTAGAGACGGGG - Intergenic
1063127642 10:3149834-3149856 TATTGTTTTTTCAAGAATGGAGG + Intronic
1063703609 10:8409696-8409718 TTTTCCTTTTTTAAGAGACAGGG + Intergenic
1063809428 10:9687134-9687156 TTTTTCTTTTCCAATAGTCCTGG - Intergenic
1064132793 10:12724871-12724893 TTTTGGTTTTTTAAGAGATGGGG - Intronic
1064139627 10:12779438-12779460 TTTTCTTTTTTCAAGAGACAGGG + Intronic
1064148793 10:12845990-12846012 TTTTTTTTTTTTAAGAGACGAGG + Intergenic
1064253162 10:13722415-13722437 TTTTTTTTTTTGTAGAGTCGAGG + Intronic
1064409118 10:15089970-15089992 TTTTGCTTTATAAAGAGAAGAGG - Intergenic
1064747406 10:18491409-18491431 TTTTACTTTTTGAAGAGATGAGG - Intronic
1065003438 10:21358132-21358154 TTTGGCTTTTTTAAGAGATGGGG + Intergenic
1065105594 10:22380477-22380499 TTTTGTTTTTTGTAGAGACGGGG + Intronic
1065216287 10:23451970-23451992 CTTTCCTTTTTCAAGAATTGGGG - Intergenic
1065232146 10:23609468-23609490 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1065330344 10:24590329-24590351 GTTTGCATTTACAAGAATCGGGG + Intronic
1065508835 10:26457311-26457333 TTTTTCTTTTTTAAGAGACAGGG + Intronic
1065541430 10:26772898-26772920 TTTTTTTTTTTCAAGAGAAGGGG - Intronic
1065692849 10:28353263-28353285 TTTTTTTTTTTCAAGAGACTGGG - Intergenic
1065945558 10:30602798-30602820 TTTTTTTTTTTTAAGAGTCAGGG - Intergenic
1066233459 10:33461384-33461406 TTTTTCTTTTTGTAGAGACGAGG - Intergenic
1067114171 10:43422089-43422111 TTTTTTTTTTTTAAGAGACGGGG - Intergenic
1067344968 10:45430621-45430643 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1067416058 10:46104047-46104069 TTTTTTTTTTTTAAGAGTCAGGG + Intergenic
1068124853 10:52827180-52827202 TTATTCTTTTTATAGAGTCGGGG - Intergenic
1068778295 10:60891518-60891540 TTTTTATTTTTCTAGAGACGTGG + Intronic
1069348027 10:67493123-67493145 TTTTGTTTTTTTAAAAGGCGGGG + Intronic
1069937755 10:71930294-71930316 TTTTTATTTTTTAAGAGTCAAGG + Intergenic
1069975987 10:72213732-72213754 TTTTTCTTTTTTTAGAGACGAGG - Intronic
1070567129 10:77612384-77612406 TTTTGCTTTCTCCAGATTTGAGG - Intronic
1070643866 10:78187980-78188002 TTTTGCTTTTTGTAGAGGCAAGG + Intergenic
1071534111 10:86413704-86413726 TTTTTTTTTTTTAAGAGTTGGGG + Intergenic
1071559406 10:86633303-86633325 TTTTGCTTTTTAATTAGTCCTGG + Intergenic
1071584222 10:86803751-86803773 TCTGACTTTTTCAAAAGTCGAGG + Intronic
1072079764 10:92017520-92017542 TTTTGTTTTTTTAAGAGAAGGGG + Intronic
1072427605 10:95343194-95343216 TTTTTTTTTTTAAAGAGTCCTGG - Intronic
1072595784 10:96870192-96870214 TTTTGTTTTTTGTAGAGACGGGG + Intronic
1072674213 10:97453580-97453602 TTCTGCTTTTTCATGACTCTGGG + Exonic
1072776510 10:98201891-98201913 TTTTTTTTTTTAAAGAGACGGGG + Intronic
1073035065 10:100558426-100558448 GTTTGTTTTTTCAAGAGATGGGG - Exonic
1073417845 10:103399370-103399392 TGTTGTTTTTTCAAGAGATGGGG + Intronic
1073421398 10:103426620-103426642 TTTTGTTTTTTCAGTAGACGGGG - Intronic
1075148146 10:119901027-119901049 TTTTTTTTTTTAAAGAGTGGGGG + Intronic
1075151646 10:119938116-119938138 TTTTTTTTTTTTAAGAGACGAGG - Intronic
1075252887 10:120897658-120897680 TTTTCATTTTTGAAGAGTCCTGG - Intronic
1075405250 10:122191122-122191144 TTTTTTTTTTTTAAGAGTCGAGG + Intronic
1075640786 10:124062902-124062924 TTTCCCATTTTCAAGAGTTGGGG + Intronic
1076392671 10:130115002-130115024 TTTTGCTTTTTGGAGAGACAGGG - Intergenic
1076649884 10:131980568-131980590 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1076651845 10:131995234-131995256 TTTTACTTTTTTAAGAGATGAGG - Intergenic
1076660029 10:132049651-132049673 TTTTTCTTTTTTAAAAGTGGGGG + Intergenic
1077290665 11:1789765-1789787 TTTTGCTTTTAGCAGAGACGGGG + Intergenic
1078769200 11:14331663-14331685 TTTTTTTTTTTTAAGAGTTGGGG - Intronic
1079066478 11:17298561-17298583 TTTTTCTTTTTTAAGAGATGAGG - Intronic
1079894594 11:26102799-26102821 TTCTTTTTTTTCAAGAGACGGGG + Intergenic
1080890054 11:36401429-36401451 TTTTCCTTTTTTAAGAGACAGGG + Intronic
1081291715 11:41334535-41334557 TTTTCCTTCTTCAAGAGGCCAGG + Intronic
1081593759 11:44445349-44445371 TTTTGCTTTTTTTAGAGATGGGG - Intergenic
1081741530 11:45444476-45444498 TTTTACTTTTTAAAGAGACAGGG - Intergenic
1081860482 11:46330884-46330906 GTTTGCTCTTTCAGGAGTCTTGG - Intergenic
1081951055 11:47043368-47043390 TTTTGTTTTTTTAATAGACGGGG - Intronic
1082820208 11:57539608-57539630 TTTTGTTTTTTTAAGAGCTGAGG + Intergenic
1083039482 11:59671693-59671715 TTGTGCTTTTTGTAGAGTCGCGG - Intergenic
1083555577 11:63623601-63623623 TTTTGTTTTTTCCAGAGACGGGG + Intergenic
1083599458 11:63937982-63938004 TTTTGTTTTTTTAAGAGACAGGG - Intergenic
1083992395 11:66254654-66254676 TTTTTTTTTTTTAAGAGCCGAGG - Intergenic
1084035249 11:66505798-66505820 TTTTTTTTTTTAAAGAGTTGAGG - Intronic
1084552488 11:69854215-69854237 TTTTACTTTTTAAAGAGATGGGG - Intergenic
1084875209 11:72126388-72126410 TTTTGTTTTTTCCAGAGTCAAGG - Intronic
1084921905 11:72477720-72477742 TTTTGTTATTTTTAGAGTCGGGG - Intergenic
1084986163 11:72874193-72874215 TTTTGCTTTTTTAAGAGACAGGG + Intronic
1085499539 11:77007103-77007125 TTTTTTTTTTTCAAGAGACAGGG - Intronic
1085551154 11:77373551-77373573 TTTTTTTTTTTAAAGAGACGAGG - Intronic
1085607790 11:77918257-77918279 TTTTTTTTTTTGTAGAGTCGAGG - Intronic
1085964415 11:81503449-81503471 TTTTTCTTTTTTAACAGTAGAGG - Intergenic
1087176482 11:95100667-95100689 TTTTGCTTTTTGTAGAGATGGGG + Intronic
1088128470 11:106458490-106458512 TTTTTCTTTTTGTAGAGACGGGG - Intergenic
1088195953 11:107273921-107273943 TTCTGCTTTTTCACGAGGTGGGG - Intergenic
1088859570 11:113787030-113787052 TTTTGTTTTTTTAAGAGACAGGG + Intergenic
1089434401 11:118452035-118452057 TTTTGTTTTTTTAAGAGACGAGG + Intronic
1089484578 11:118835548-118835570 TTTTACTTTTTAAAGAGATGGGG - Intergenic
1089547735 11:119242730-119242752 TTTTTTTTTTTAAAGAGTCAGGG - Intronic
1090296776 11:125595176-125595198 TTTTCCTTTTTAAAGAGAGGAGG + Intronic
1091495583 12:969781-969803 TTTTTTTTTTTTAAGAGTCAGGG - Intronic
1091505006 12:1058796-1058818 TTTTTTTTTTTTAAGAGACGAGG + Intronic
1091823290 12:3491926-3491948 TTTTGCATTTTCAAGAGGGAGGG - Intronic
1091900774 12:4142317-4142339 TTTTGTATTTTCTAGAGACGAGG + Intergenic
1092178654 12:6429151-6429173 TTTTGTATTTTTAAGAGACGGGG + Intergenic
1092613432 12:10194956-10194978 TTTTTCTTTTTCATGAATTGAGG - Intergenic
1092805521 12:12218821-12218843 TTTTGTTTTTTAAAGAGATGGGG - Intronic
1092819487 12:12339982-12340004 TTTTGTTTTTTGTAGAGGCGGGG + Intronic
1093471741 12:19509571-19509593 TTTTATTTTTTCTAGAGACGGGG - Intronic
1093504430 12:19848503-19848525 TTTTGATTTTTTAAGAGACAGGG - Intergenic
1093739673 12:22669795-22669817 TTTTGTTTTTTGTAGAGACGGGG - Intronic
1094135619 12:27122425-27122447 TTTTTTTTTTTTAAGAGTGGAGG + Intergenic
1095359760 12:41322201-41322223 TTTTGCTTTTACTAGAGGCAGGG + Intronic
1095578849 12:43771502-43771524 TGCTGCTTTTTAAAGAGTTGAGG - Intronic
1095754764 12:45752526-45752548 TTTTGTTTTTTTAAGAGACAGGG + Intronic
1096097028 12:48942251-48942273 TTTTTTTTTTTAAAGAGGCGAGG + Intronic
1096171304 12:49472865-49472887 TTTTACTTTTTGTAGAGACGGGG - Intronic
1096347260 12:50860614-50860636 TTTTGGTTTTTTAAGAGACATGG + Intronic
1096408849 12:51362868-51362890 TTTTTCTTTTTTAAGAGATGGGG + Intronic
1096459832 12:51815949-51815971 TTTTGTTTTTTTAAGAGACAGGG + Intergenic
1096618908 12:52850189-52850211 TTTTGTATTTTTAAGAGACGGGG - Intergenic
1097201495 12:57282649-57282671 TTTTGCTTTTTCAAGAGTCGGGG - Intronic
1097219222 12:57437361-57437383 ATTTGCATTTTCTAGAGTCCTGG - Intronic
1097257369 12:57689578-57689600 TTTTTCTTTTTTAAGAGACAGGG + Intergenic
1097769054 12:63559308-63559330 TTTTGTTATTTCAAGTGTAGAGG + Exonic
1097881817 12:64693423-64693445 TTTTTCTTTTTAAAGAGACTAGG + Intronic
1098902221 12:76124582-76124604 TTGTGTTTTTTGTAGAGTCGGGG + Intergenic
1099237079 12:80094735-80094757 TTTTTCTTTTTTAAGAGACAGGG - Intergenic
1099294944 12:80818496-80818518 TTTATCTGTTTCTAGAGTCGAGG + Intronic
1099305516 12:80950099-80950121 TTTTTTTTTTTGTAGAGTCGGGG - Intronic
1100515768 12:95326261-95326283 TTTTGTATTTTTAAGAGACGGGG + Intergenic
1100700310 12:97140316-97140338 GTTTGCTTTTTAAAGAGTCAGGG + Intergenic
1100868142 12:98879929-98879951 TTTTGTTTATTCAAGTGTCATGG - Intronic
1100967206 12:100025997-100026019 TTGTACTTTTTGAAGAGACGGGG - Intergenic
1101273613 12:103175271-103175293 TTTTGTTTTTTTAATAGTGGTGG + Intergenic
1101273709 12:103176160-103176182 TTTTGTTTTTTTAATAGTGGTGG - Intergenic
1101334226 12:103782030-103782052 TTTTTCTTTTTCAATGGTTGGGG + Intronic
1101355195 12:103970467-103970489 TTTTTCTTTTTTAAGAGACAGGG - Intronic
1101454066 12:104811243-104811265 TTTTGCTCTTACAACAGACGTGG - Intronic
1101475135 12:105038656-105038678 TTTTTCTTTTTTAAGAGACACGG - Intronic
1101707673 12:107235584-107235606 TTTTGTTTTTTATAGAGTTGAGG - Intergenic
1102018924 12:109668171-109668193 TTTTGTTTTGTTAAGAGTCAAGG + Intergenic
1102094999 12:110231772-110231794 TTTTTCTTTTTTTAGAGTCAGGG - Intergenic
1102237255 12:111301522-111301544 TTTTTCTTTTCCAAGAGACAGGG + Intronic
1102259207 12:111433784-111433806 TTTTGTTTTTTGAAGAGCTGGGG + Intronic
1102397735 12:112601757-112601779 TTTTGTTTTTTATAGAGACGTGG - Intronic
1102452314 12:113051004-113051026 TTCTTCTTTTTCAAGAGACAGGG - Intergenic
1102479353 12:113210587-113210609 TTTTTCTTTTTTAAGAGATGGGG - Intronic
1102802766 12:115750961-115750983 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1102857919 12:116310913-116310935 TTGTACTTTTTCTAGAGACGGGG - Intergenic
1103319527 12:120083433-120083455 TTTTGTTTTTTGTAGAGACGAGG + Intronic
1103424146 12:120816981-120817003 TTTTTATTTTTCAAGGGTCTAGG + Intronic
1103464865 12:121133894-121133916 TTTTTTTTTTTAAAGAGACGGGG + Intronic
1103598091 12:122036399-122036421 TTTTGCCTTTTGAAGAGATGGGG - Intronic
1103610755 12:122122863-122122885 TTTTTTTTTTTAAAGAGACGAGG + Intronic
1103679030 12:122678697-122678719 TTTTCTTTTTTTTAGAGTCGAGG + Intergenic
1103753188 12:123181532-123181554 TTTTTGTTTTTGAAGAGACGAGG - Intronic
1103975551 12:124700467-124700489 TTTTGTTTTTTGTAGAGTGGAGG + Intergenic
1104574129 12:129951110-129951132 TATTTTTTTTTTAAGAGTCGGGG - Intergenic
1105467211 13:20656111-20656133 TTTTTTTTTTTAAAGAGACGAGG - Intronic
1105507264 13:21020976-21020998 TTTTGATTTTTGAAGAATCAAGG - Intronic
1106641872 13:31593078-31593100 TTTTACTTTTTCTAGAGATGGGG + Intergenic
1106768102 13:32936005-32936027 TTTTTTTTTTTTAAGAGACGGGG - Intergenic
1106831237 13:33585519-33585541 TTGTACTTTTTCTAGAGTCTGGG - Intergenic
1107444940 13:40462032-40462054 TTTTTTTTTTTCAAGAGATGGGG + Intergenic
1107535311 13:41323655-41323677 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1107887525 13:44886098-44886120 TTTTACTTTTTGAAGAGACAGGG - Intergenic
1107894185 13:44942957-44942979 TTTTTTTTTTTTAAGAGTTGAGG - Intronic
1107908089 13:45080375-45080397 TTTTGCTTTTTGTAGAGACAGGG + Intergenic
1108156335 13:47589114-47589136 TTTTATTTTTTTAAGAGACGAGG - Intergenic
1108404510 13:50086465-50086487 TTTTGTTTTTTTAAGAGACAGGG + Intronic
1108489635 13:50968391-50968413 TTTTACTTTTTTAAGAGACAGGG - Intronic
1108606829 13:52047666-52047688 TTTTGTTTTTTGTAGAGACGGGG - Intronic
1108612240 13:52095713-52095735 TTTTACTTTTTGTAGAGTCAGGG - Intronic
1110401164 13:75093580-75093602 TTTTGCTTTTTATAGAGACAAGG - Intergenic
1110816500 13:79866147-79866169 TTTTACTTATTCAAGATTCCAGG - Intergenic
1111196609 13:84882722-84882744 TTTTGCTGTTTCAGGAATGGCGG - Intergenic
1111402694 13:87761645-87761667 TTTTGCTTTTGGAAGAGTATAGG - Intergenic
1111434629 13:88190846-88190868 TTTTACTTTTTGTAGAGTCAGGG + Intergenic
1111870618 13:93826866-93826888 TTTTGCTTTTGCAACAGTGGTGG + Intronic
1111913685 13:94339069-94339091 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1112338833 13:98536538-98536560 TTTTACTTTTTGTAGAGACGGGG + Intronic
1112370163 13:98787081-98787103 TTTTGCTTTATAAAGAGGAGTGG - Intergenic
1112407913 13:99137166-99137188 TTTTGTTTTTTATAGAGACGAGG + Intergenic
1112469541 13:99675041-99675063 TTTTGTTTTTTTAAGAGACAGGG - Intronic
1112521366 13:100098195-100098217 TTTTGTTTTTTTAAGAGATGGGG - Intronic
1112940458 13:104855044-104855066 TTTTTTTTTTTCAAGAGAAGTGG - Intergenic
1113098591 13:106692606-106692628 TTTTGGTTTTTAAAGAGGTGGGG + Intergenic
1113135049 13:107079810-107079832 TTTTTTTTTTTCAAGAATCTTGG - Intergenic
1113205507 13:107911484-107911506 TTTTGCTTTTTATAGAGATGGGG + Intergenic
1114276263 14:21147981-21148003 TTTTTTTTTTTTAAGAGACGGGG - Intergenic
1114449726 14:22817511-22817533 TTTTGTTTTTAGTAGAGTCGGGG + Intronic
1114513057 14:23278370-23278392 TTTTGTTTTTTCAAGAGACAGGG + Intronic
1114792302 14:25673357-25673379 TTTTCCTTTTTTAAGAGACAGGG + Intergenic
1115243579 14:31272803-31272825 TTGTGGTGTTTCAAGAGTCCTGG + Intergenic
1116376360 14:44207487-44207509 TTTTTTTTTTTGTAGAGTCGGGG + Intergenic
1116408063 14:44589995-44590017 TTTAGCTTTTTTTTGAGTCGGGG - Intergenic
1116798614 14:49418413-49418435 TTTTCCTTTTTCAAGAGCAGTGG - Intergenic
1116830804 14:49717888-49717910 TTTTGTTTTTATAAGAGTCAGGG + Intronic
1116832890 14:49739857-49739879 TTTTGTTTTTTAAAGAGATGAGG - Intronic
1116833331 14:49744110-49744132 TTTTTTTTTTTGTAGAGTCGTGG - Intronic
1117242146 14:53844830-53844852 TTTTGTTTTTTGTAGAGTTGGGG - Intergenic
1117419946 14:55534461-55534483 TTTTGTTTTTTAAAGAGACAGGG + Intergenic
1117544626 14:56782553-56782575 TTTTTATTTTTGTAGAGTCGGGG + Intergenic
1118049727 14:62013789-62013811 TTTTGCTTTTTGTAGAGACATGG - Intronic
1118248109 14:64131586-64131608 TTTTGTTTTTTTAAGAGACACGG + Intronic
1118349727 14:64965151-64965173 TTTTGTTTTTTTAAGAGATGGGG + Intronic
1118632605 14:67719648-67719670 TTTTCCTTTTTGTAGAGACGGGG + Intronic
1118866352 14:69706999-69707021 TTTTTTTTTTTAAAGAGTCCAGG - Intronic
1119008392 14:70956550-70956572 TTTTGTTTTTTTAAGAGACAGGG - Intronic
1119349748 14:73954425-73954447 TTTTTCTTTTTCAAGATACAAGG - Intronic
1119374080 14:74174744-74174766 TTTTGTTTTTTTAAGAGAAGGGG - Intronic
1119407721 14:74409254-74409276 TTTTTTTTTTTGTAGAGTCGGGG + Intronic
1119521931 14:75293034-75293056 TTTTTATTTTTGTAGAGTCGGGG + Intergenic
1119572229 14:75685208-75685230 TTTTGTTTTTTTTAGAGCCGGGG - Intronic
1120791096 14:88583138-88583160 TTTTTTTTTTTTAAGAGGCGAGG + Intronic
1120948280 14:90018466-90018488 TTTTTCTTTTTCTTGAGACGAGG + Intronic
1120963509 14:90147257-90147279 TTTTTCTTTTTCTAGAGACAGGG + Intronic
1120989426 14:90362178-90362200 TTTTGTTTTTTGTAGAGACGAGG - Intergenic
1121049329 14:90810054-90810076 TTTTGGTTTTTAGAGAGTCCTGG - Intronic
1121087190 14:91155616-91155638 TTTTTCTTTTTGTAGAGACGGGG - Intronic
1121260406 14:92561856-92561878 TTTTACTTTTTGTAGAGACGAGG + Intronic
1121764189 14:96471322-96471344 TTTTTTTTTTTAAAGAGACGGGG - Intronic
1122464610 14:101922639-101922661 TTTTTCTTTTTCTAGAGATGAGG - Intronic
1123449920 15:20353098-20353120 TTTTTTTTTTTTAAGAGACGAGG + Intergenic
1123483084 15:20654005-20654027 TTTTGTATTTTTAAGAGACGGGG + Intergenic
1123692486 15:22850096-22850118 TTTTGGTTTTTCAAAAATCAGGG + Intronic
1123773053 15:23548488-23548510 TTTTTGTTTTTAAAGAGACGGGG + Intergenic
1123813572 15:23954057-23954079 TTTTGTATTTTCAAGAGATGAGG - Intergenic
1123823056 15:24051130-24051152 TTTTGCATTATCTAGAGTTGTGG - Intergenic
1124322597 15:28726206-28726228 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1124923036 15:34044874-34044896 TTTTGTATTTTTAAGAGACGGGG - Intronic
1125184294 15:36912820-36912842 TTTTTTTTTTTCAGGAGTGGGGG - Intronic
1125557677 15:40599804-40599826 TTTTTTTTTTTAAAGAGACGGGG + Intronic
1125583548 15:40804403-40804425 TTTTTTTTTTTCCAGAGACGGGG - Intronic
1125637631 15:41202637-41202659 TTTTGTTTTTTGTAGAGACGGGG + Intronic
1125764648 15:42126352-42126374 TATTGCTTTTTCAAGAGATGGGG + Intergenic
1125860092 15:42990966-42990988 TTTTTTTTTTTCAAGAGATGAGG + Intronic
1126021000 15:44401269-44401291 TTTTTTTTTTTTAAGAGACGAGG + Intronic
1126292536 15:47098937-47098959 TTTTCTTTTTTTAAGAGTCAGGG + Intergenic
1126469924 15:48998302-48998324 TATTGATTTTTGAAGAGTGGTGG + Intronic
1126550389 15:49922536-49922558 ATTTGCTTTTTAAAGATTCAGGG + Intronic
1126680557 15:51197947-51197969 TTTTCTTTTTTTAAGAGACGAGG - Intergenic
1127060453 15:55177424-55177446 TTTTTTTTTTTAAAGAGTCAGGG + Intergenic
1127082182 15:55391861-55391883 TTTTTTTTTTTAAAGAGTCAAGG - Intronic
1127427777 15:58873234-58873256 TTTTTGTTTTTAAAGAGACGGGG + Intronic
1127490146 15:59454807-59454829 TTTTACTTTTTGTAGAGACGGGG + Intronic
1127604170 15:60569410-60569432 TTTTTCTTTTTAAAGAGACAGGG - Intronic
1127991379 15:64120637-64120659 TTTTACTTTTTGTAGAGTCATGG - Intronic
1128257005 15:66204227-66204249 TTGTGCTTTTTGTAGAGACGGGG - Intronic
1128295011 15:66511311-66511333 TTTTGCTTTTTGTAGAGACAAGG - Intronic
1128470771 15:67950528-67950550 TTTTTCTTTTTTAAGAGACAGGG - Intergenic
1128490790 15:68141190-68141212 GTTTGCTTTTTTAAGAGACAGGG - Intronic
1128549694 15:68590301-68590323 CTTTGCTTTTTGAAGAGCCCTGG + Intronic
1128574622 15:68763972-68763994 TTTTTCTTTTTCTAGAGACAGGG - Intergenic
1129134911 15:73539616-73539638 TTCTGTTTTTTTAAGAGTTGGGG + Intronic
1129313962 15:74729880-74729902 TTTTTTTTTTTCAAGAGTGCAGG - Intergenic
1129485284 15:75864837-75864859 TTTTGCTTTTTCTAGTTTAGTGG + Intronic
1129766030 15:78168247-78168269 TTTTTTTTTTTTAAGAGACGGGG - Exonic
1130076313 15:80693902-80693924 TTTTTCTTTTTTAAGAGACAGGG - Intronic
1130112882 15:80980761-80980783 TTTTATTTTTTGAAGAGGCGAGG - Intronic
1130265349 15:82396651-82396673 TTTTGCTTTTTCTAGTTTAGTGG + Intergenic
1130475626 15:84263987-84264009 TTTTGCTTTTTCTAGTTTAGTGG + Intergenic
1130483044 15:84378041-84378063 TTTTGCTTTTTCTAGTTTAGTGG + Intergenic
1130506665 15:84550229-84550251 TTTTGCTTTTTCTAGTTTAGTGG - Intergenic
1130532044 15:84754694-84754716 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1131147480 15:90023675-90023697 TTTTGCTTTTAATAGAGTTGGGG - Intronic
1131185035 15:90266596-90266618 TTTTGTTTTTTAAAGAGACGGGG + Intronic
1132054166 15:98636528-98636550 TTTTTTTTTTTTAAGAGACGGGG - Intergenic
1132074469 15:98808684-98808706 TTTTTCTTTTTGAAGAGACAGGG + Intronic
1132421252 15:101672097-101672119 TTCTGCTTTTTCATGTGTGGAGG - Intronic
1133244496 16:4439028-4439050 TTTTTTTTTTTCAAGAGTTGAGG + Intronic
1133247742 16:4460556-4460578 TTTTTTTTTTTAAAGAGTCAAGG - Intergenic
1133341617 16:5040216-5040238 TTTTTTTTTTTAAAGAGACGGGG - Intronic
1133423171 16:5664753-5664775 TTTTGCTTTTTCCAAATTCCTGG + Intergenic
1133763571 16:8819686-8819708 TTTTTTTTTTTTAAGAGACGAGG - Intronic
1133791137 16:9010016-9010038 TTTTACTTTTTGTAGAGACGGGG + Intergenic
1134078042 16:11306004-11306026 TTTTGCTTTTTATAGAGATGGGG - Intronic
1134181482 16:12051322-12051344 TTTTTTTTTTTTAAGAGTTGGGG - Intronic
1134281836 16:12823885-12823907 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1134397554 16:13878900-13878922 TTTTTCTTTTTTAAGAGACAAGG - Intergenic
1134438301 16:14281864-14281886 TTTTGTTTTTTAAAGAGACAAGG - Intergenic
1134638895 16:15813340-15813362 TTTTGCTTTTTTTAGAGACAGGG - Intronic
1135054683 16:19221017-19221039 TTTTTTTTTTTTAAGAGTTGAGG - Intronic
1135295327 16:21274776-21274798 TTGTGTTTTTACAAGAGACGAGG + Intronic
1135308210 16:21385018-21385040 TTTTTTTTTTTTAAGAGTTGGGG - Intergenic
1135384899 16:22029798-22029820 TTTTGCTTTTTGTAGAGGTGGGG + Intronic
1135412111 16:22243053-22243075 TATTTTTTTTTCAAGAGACGGGG - Intronic
1135565912 16:23510711-23510733 TTTTTATTTTTTAAGAGACGGGG + Intronic
1136081473 16:27855053-27855075 TTTTATTTTTTTAAGAGTCGAGG - Intronic
1136108585 16:28050184-28050206 TTTTTTTTTTTTAAGAGTCAAGG + Intronic
1136159646 16:28410769-28410791 TTTTGTTTTTTGTAGAGACGGGG + Intergenic
1136180070 16:28545377-28545399 TTTTGCTTTTTTTAGAGACAGGG - Intergenic
1136203442 16:28704525-28704547 TTTTGTTTTTTGTAGAGACGGGG - Intronic
1136304955 16:29364139-29364161 TTTTTTTTTTTTAAGAGTTGGGG - Intergenic
1136386499 16:29929737-29929759 TTTTGCATTTTTAGTAGTCGGGG - Intergenic
1136531050 16:30869516-30869538 TTTTTTTTTTTAAAGAGACGGGG + Intronic
1136550895 16:30981942-30981964 TTTTGTTTTTTCTAGAGACACGG - Intronic
1136846850 16:33583059-33583081 TTTTTCTTTTTTAAGAGATGGGG + Intergenic
1137258523 16:46799809-46799831 TTTTACTTTTTGTAGAGACGCGG + Intronic
1137431423 16:48420882-48420904 TTTTTTTTTTTCAAGAGACAAGG - Intronic
1137622188 16:49883341-49883363 TTTTGTTTTTTTAAGAGTCTGGG + Intergenic
1137729295 16:50678032-50678054 TTTTATTTTTTCTAGAGACGGGG - Intronic
1138111022 16:54324007-54324029 TTTTTTTTTTTTAAGAGTCAGGG + Intergenic
1138408018 16:56814360-56814382 TTTTGTTTTTTGTAGAGACGGGG + Intronic
1138600381 16:58050447-58050469 TTTTTTTTTTTTAAGAGTCGAGG - Intergenic
1138670016 16:58606380-58606402 TTTTGTTTTTTTAAGGGACGGGG - Intronic
1138859543 16:60740036-60740058 TTTTCCTTTGTCAGAAGTCGTGG - Intergenic
1138932482 16:61677575-61677597 TTTTGGTTTTCCAAGATTGGGGG - Intronic
1139639449 16:68280494-68280516 TTTTGATTTTTCAAGAGAAAAGG - Intronic
1140056554 16:71530766-71530788 TTTTTCCTTTTTTAGAGTCGGGG - Intronic
1140384702 16:74525381-74525403 GTTTGCTTTTTAAAGAGACAGGG + Intronic
1140470702 16:75212687-75212709 TTTTTTTTTTTTAAGAGTCAGGG + Intergenic
1140497752 16:75404693-75404715 TTTTTTTTTTTTAAGAGTCCAGG - Intronic
1140625900 16:76794063-76794085 TTTTGCTTTTTCAACAGGCCAGG - Intergenic
1140806631 16:78537987-78538009 TTTTCCGTTTTCAAGAATCGGGG - Intronic
1141458818 16:84163975-84163997 TTGTGCTTTTTGTAGAGACGGGG + Intronic
1141588594 16:85051824-85051846 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1142333709 16:89473016-89473038 TTGTACTTTTTGTAGAGTCGGGG - Intronic
1142347502 16:89563310-89563332 TTTTTCTTTTTAAAGAGGCAAGG + Exonic
1203108558 16_KI270728v1_random:1431714-1431736 TTTTTCTTTTTTAAGAGATGGGG + Intergenic
1142662434 17:1440454-1440476 TTTTCTTTTTTTAAGAGTCAAGG - Intronic
1142796639 17:2312932-2312954 TTTTTCTTTTTCAAGAGATAGGG + Intronic
1143077625 17:4357986-4358008 TTTTTCTTTTTTAAGAGACAGGG - Intronic
1143605054 17:7978727-7978749 TTTTTTTTTTTAAAGAGACGAGG - Intergenic
1144665165 17:17097484-17097506 TTTTGTTTTTTTAAGAGACAGGG - Intronic
1146055676 17:29579714-29579736 TTTTTTTTTTTTAAGAGTTGGGG - Intronic
1146121495 17:30199903-30199925 TTTTTTTTTTTTAAGAGTCAGGG + Intronic
1146396710 17:32473585-32473607 TTTTTTTTTTTCAAGAGATGGGG + Intronic
1146963042 17:37001144-37001166 TTTTGCTTTTTATAGAGACGGGG - Intronic
1146965949 17:37029873-37029895 TTTTACTTTTTGTAGAGACGGGG + Intronic
1147197232 17:38775257-38775279 TTTTGTTTTTTAAAGAGATGGGG + Intronic
1147199907 17:38793696-38793718 TTGTATTTTTTGAAGAGTCGGGG - Intronic
1147274974 17:39308320-39308342 TTTTCATTTTTACAGAGTCGGGG - Intronic
1147295393 17:39478067-39478089 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1147659020 17:42107357-42107379 TTTTTTTTTTTTAATAGTCGGGG - Intronic
1147705836 17:42424094-42424116 TTTTATTTTTTTAAGAGACGGGG + Intergenic
1148427407 17:47611152-47611174 TTTTGTTTTTTTAAGAGACAGGG + Intronic
1148533643 17:48419453-48419475 TTTTGTTTTTACTAGAGACGAGG + Intronic
1149713134 17:58761076-58761098 TTTTGTTTTTTAAAGAGATGGGG + Intronic
1149887938 17:60359636-60359658 TTTTGCTTTTTGTAGAGACAGGG - Intronic
1150058900 17:62047037-62047059 TTTTTTTTTTTAAAGAGACGGGG + Intronic
1150177219 17:63071292-63071314 TTTTTTTTTTTAAAGAGTCAAGG + Intronic
1150201804 17:63364777-63364799 TTTTTTTTTTTTAAGAGTCAGGG - Intronic
1150268439 17:63846648-63846670 TTTTTTTTTTTAAAGAGTTGGGG + Intergenic
1150500610 17:65647480-65647502 TTTTTTTTTTTCAAGAGACAGGG + Intronic
1150729327 17:67678207-67678229 TTTTTTTTTTTAAAGAGACGAGG - Intronic
1150903050 17:69303750-69303772 TTTTTTTTTTTTTAGAGTCGAGG - Intronic
1151013032 17:70523556-70523578 TTTTGCTTTTTAATGGGCCGTGG - Intergenic
1151064303 17:71132462-71132484 TTTTTCTTTTTTAGGAGACGGGG - Intergenic
1151446638 17:74170245-74170267 TTTTGCTTTTTGTAGAGATGGGG + Intergenic
1151497795 17:74469352-74469374 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1151599211 17:75095975-75095997 TTTTACTTTTTGTAGAGACGGGG + Intronic
1151693122 17:75699494-75699516 TTTTTTTTTTTAAAGAGACGGGG - Intronic
1151832899 17:76566064-76566086 CTTTGCTTCTTCAAGAGTTGCGG - Exonic
1152060010 17:78065340-78065362 TTTTCCTTTTTAAAGAGATGGGG - Intronic
1152338725 17:79712795-79712817 TTTTTTTTTTTTAAGAGACGAGG - Intergenic
1152411626 17:80127141-80127163 TTTTGCTTTTTGTAGAGATGGGG - Intergenic
1152981755 18:284425-284447 TTTTGTTTTTTGAAGAGACAGGG + Intergenic
1153150033 18:2082081-2082103 TTTCTCTTTTTCAGGAGTCTTGG - Intergenic
1153246447 18:3077019-3077041 TTTTTTTTTTTCAAGAGACAGGG + Intronic
1153277690 18:3384036-3384058 TCCTCTTTTTTCAAGAGTCGAGG - Intergenic
1153365383 18:4249758-4249780 TTTTGCTTTCTGTAGAGACGGGG + Intronic
1153383789 18:4469562-4469584 TTTTTTTTTTTTTAGAGTCGTGG + Intergenic
1153463774 18:5366221-5366243 GTTTGCTTTTTCAAGCTTCAAGG - Intergenic
1153546951 18:6218112-6218134 TTTTTCTTTTTCAAGAGATGAGG + Intronic
1154012870 18:10590521-10590543 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1154210548 18:12375972-12375994 TTTTTATTTTTTAAGAGACGGGG - Intronic
1154218665 18:12433737-12433759 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1154988664 18:21579453-21579475 TTTTGTTTTTTAAAGAGATGGGG - Intronic
1155136803 18:23003882-23003904 TTTTGTATTTTCAGGAGACGGGG - Intronic
1155196387 18:23478583-23478605 TTTTGTTTTTTTAAGAGACAGGG - Intronic
1155411629 18:25552536-25552558 TTTTTTTTTTTTAAGAGTTGAGG + Intergenic
1155411651 18:25552706-25552728 TTTTGAATTTTCAAGAGATGGGG + Intergenic
1155436510 18:25818221-25818243 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1155976373 18:32136032-32136054 TTTTTTTTTTTCAAGAGACAGGG - Intronic
1156013992 18:32527164-32527186 TTTTTTTTTTTCAAGAGTGTTGG - Intergenic
1156220804 18:35049921-35049943 TTCTGCTTTTCAAAAAGTCGAGG + Intronic
1156279489 18:35621363-35621385 TTTTGCTTTTTGTAGAGATGCGG + Intronic
1156331424 18:36127784-36127806 TTTTTTTTTTTCTAGAGACGAGG + Intronic
1156821103 18:41374002-41374024 TTTTTTTTTTTTAAGAGTCAGGG + Intergenic
1156873697 18:41979054-41979076 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1158242274 18:55390276-55390298 TTTTTTTTTTTTAAGAGTCAGGG - Intronic
1158744200 18:60178763-60178785 TTTTACTTTTTATAGAGTCAGGG + Intergenic
1158751958 18:60272250-60272272 ATTTTCTTTTTCAAGAGTGTAGG - Intergenic
1158919378 18:62173402-62173424 TTTTACTTTTTCTAGAGACTGGG + Intronic
1159002210 18:62984330-62984352 TTTTTTTTTTTTAAGAGTCAGGG - Intergenic
1159983802 18:74818912-74818934 TTATGATTTATCAAGAGTCATGG - Intronic
1160769957 19:826293-826315 TTTTGTTTTTTTCAGAGTTGAGG - Intronic
1160848832 19:1179835-1179857 TTTTACTTTTTATAGAGACGGGG + Intronic
1160927040 19:1551606-1551628 TTTTGTTTTTTTAAGAGACAAGG - Intergenic
1161212005 19:3071653-3071675 TTTTTTTTTTCCAAGAGTCAGGG + Intergenic
1161330042 19:3682515-3682537 TTTTGTTTTTTGAAGAGGTGGGG - Intronic
1161367530 19:3889095-3889117 TTTTGTTTTTTTAAGAGACGAGG - Intronic
1161456427 19:4371983-4372005 TTTTTCTTTTTAAAGAGGCAGGG + Intronic
1161915087 19:7222398-7222420 TTTTGTTTTTTTAAGAGACAGGG + Intronic
1161925717 19:7297601-7297623 TTTTACTTTTTATAGAGACGAGG + Intergenic
1161983209 19:7641189-7641211 TTTTCTTTTTTTAAGAGACGGGG - Intronic
1162132044 19:8532116-8532138 TTTTCTTTTTTCAGGGGTCGGGG - Intronic
1162153734 19:8663129-8663151 TTTTGCTTTTTTAAGAGATGGGG + Intergenic
1162305901 19:9873459-9873481 TTTTGGTTTTTTAAGAGACAGGG + Intronic
1162372224 19:10286536-10286558 TTTTTTTTTTTCCAGAGACGGGG + Exonic
1162418721 19:10553580-10553602 TTTTTTTTTTTCAAGAGACAGGG + Exonic
1162447957 19:10735681-10735703 TTTTTTTTTTTCAAGAGATGGGG + Intronic
1162663793 19:12193056-12193078 TTTTTCTTTTTTAAGAGATGGGG + Intergenic
1162763724 19:12904823-12904845 TTTTGTTTTTACTAGAGACGAGG - Intronic
1162866583 19:13552378-13552400 TTTTTTTTTTTAAAGAGACGGGG + Intronic
1162990217 19:14297146-14297168 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1163415176 19:17182080-17182102 TTTTTCTTTTTTAAGAGATGGGG + Intronic
1163587334 19:18171098-18171120 TGTTTCTTTTTAAAGAGTCAAGG + Intronic
1163602255 19:18256157-18256179 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1163680320 19:18677791-18677813 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1164642544 19:29837066-29837088 TTTTGTTTTTTAAAGACACGGGG - Intergenic
1164929292 19:32162899-32162921 TTTTGCTTTTTATAGAGATGGGG + Intergenic
1164972079 19:32541300-32541322 TTTTCTTTTTTTAAGAGTCGTGG + Intergenic
1164987957 19:32662733-32662755 TTTTGTTTTTTAAAGAGATGGGG - Intronic
1165137164 19:33676868-33676890 TTTTTCTTTTTTAAGAGTCTGGG - Intronic
1165205772 19:34184223-34184245 TTTTGTATTTTTAAGAGACGGGG + Intronic
1165348434 19:35263532-35263554 TTTTGTTTTTTGTAGAGACGGGG + Intronic
1165477753 19:36041136-36041158 TTTTTTTTTTTGTAGAGTCGAGG - Intronic
1165721839 19:38084517-38084539 TTTTTCTTTTCCAAGAATAGAGG + Intronic
1165795720 19:38517931-38517953 TTTTGTTTTTTAAAGAGATGGGG - Intronic
1165930597 19:39355982-39356004 TTGTGCCTTTTCCAGAGTCAGGG + Intronic
1166583342 19:43922996-43923018 TTTTACTTTTTGTAGAGACGAGG + Intronic
1166711246 19:44938811-44938833 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1166814611 19:45535769-45535791 TTTTTTTTTTTTAAGAGTTGAGG + Intronic
1167153973 19:47726848-47726870 TTTTATTTTTTGTAGAGTCGAGG + Intronic
1167160221 19:47762629-47762651 TTTTGTTTTTTAAAGAGACAGGG - Intergenic
1167343094 19:48927784-48927806 TTTTCCTTTTTTAAGAGACGGGG - Intergenic
1167345976 19:48946077-48946099 TTTTTTTTTTTTAAGAGACGGGG - Intergenic
1167412686 19:49354330-49354352 TTTTGATTTTTGTAGAGACGGGG - Intronic
1167739955 19:51318563-51318585 TTTTTTTTTTTTAAGAGACGAGG - Intronic
1167830218 19:52013245-52013267 TTTTTCTTTTTTAAGAGACAGGG - Intronic
1167867765 19:52342113-52342135 TTTTGATTTTTGTAGAGTTGGGG + Intronic
1167882049 19:52467608-52467630 TTTTTCTTTTTTAAGAGCTGGGG - Intronic
1167993134 19:53377732-53377754 TTTTGTTTTTTGTAGAGACGGGG + Intronic
1168094555 19:54107253-54107275 TTTTGCTTTTTAAAGAGACAGGG + Exonic
1168190748 19:54737065-54737087 TTTTGCTTTTTGAAACTTCGGGG - Intronic
1168646902 19:58065198-58065220 TTTTGTTTTTTTAAGAGATGGGG + Intronic
926023995 2:9523880-9523902 TTTTTTTTTTTCAAGAGACAAGG + Intronic
926902955 2:17776214-17776236 TTTTTATTTTTGAAGAGTCCAGG - Intronic
927320558 2:21740100-21740122 TTTTGCTTTTTTATGAGTGAAGG - Intergenic
927474488 2:23402028-23402050 TTTTGCACTTTCAACAGTCGAGG + Intronic
927612362 2:24554375-24554397 TTTTGTTTTTTCAGGAGCAGAGG + Intronic
927996250 2:27488844-27488866 TTTTGTTTTTTGTAGAGACGAGG - Intronic
928164835 2:28962998-28963020 TTTTGTTTTTTGTAGAGTTGGGG + Intronic
928349955 2:30541383-30541405 TTTTTCTTTTTTAAGAGACAGGG - Intronic
928592906 2:32835411-32835433 TTTTTCTTTTTAAACAGACGGGG + Intergenic
929124585 2:38511589-38511611 TTTTTTTTTTTCAAGAGACGGGG + Intergenic
929658363 2:43756774-43756796 TTGTGCTTTTTGTAGAGACGGGG - Intronic
929704393 2:44195208-44195230 TTTTTTTTTTTCAAGAGACAGGG + Intronic
929765129 2:44837915-44837937 TTGTACTTTTTGTAGAGTCGGGG - Intergenic
929858602 2:45655835-45655857 TTTTTTTTTTTCAAGAGACAGGG - Intronic
929866532 2:45721868-45721890 TTTTTTTTTTTTAAGAGTCAGGG - Intronic
929929807 2:46244785-46244807 TTTTTTTTTTTGTAGAGTCGGGG + Intergenic
930043766 2:47150655-47150677 TTTTTTTTTTTAAAGAGTTGAGG + Intronic
930639112 2:53837321-53837343 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
931014803 2:57964419-57964441 TCTTGCTGTCTCAAGAGTGGTGG + Intronic
931033770 2:58213699-58213721 TTTTTCTTTTTTAAGAGACAAGG - Intronic
931847171 2:66216313-66216335 TTTTGTTTTTTTAAGAGACACGG + Intergenic
931880095 2:66559616-66559638 TTTAGCTTTTTCATTAGTAGAGG + Intronic
932014214 2:68007926-68007948 TTGTGTTTTTTTAAGAGACGGGG - Intergenic
932031578 2:68191884-68191906 TTTTTCTCTTTCAAGAGTAAGGG - Intronic
932158348 2:69438257-69438279 TTTTTCTTTTTCCAGAGACAGGG + Intergenic
932204453 2:69866634-69866656 TTTTACTTTTTGTAGAGTTGGGG + Intronic
932223745 2:70022511-70022533 TTTTGTTTTTTGTAGAGTTGAGG - Intergenic
932241697 2:70162335-70162357 TTTTATTTTTTTAAGAGTAGGGG + Intronic
932371300 2:71190415-71190437 TTTTATTTTTTAAAGAATCGGGG - Intronic
932511275 2:72294456-72294478 TTTTCCTTTTTGTAGAGACGGGG + Intronic
932755384 2:74404674-74404696 TTTTGCATTTTTGAGAGACGGGG + Intergenic
933103890 2:78296810-78296832 AATTTCTGTTTCAAGAGTCGAGG - Intergenic
933670279 2:85000783-85000805 TTTTTTTTTTTTAAGAGTCAGGG + Intronic
933690182 2:85173578-85173600 TTTTTGTTTTTCAAGAGACAGGG + Intronic
934023482 2:87978908-87978930 TTTTTTTTTTTTAAGAGACGGGG - Intergenic
934092856 2:88569061-88569083 TTGTGTTTTTACAAGAGACGGGG + Intronic
934527939 2:95063370-95063392 TTTTTGTTTTTCAAGAGAAGGGG + Intergenic
934676910 2:96255964-96255986 TTTTGTTTTTTTAAGAGACAGGG - Intronic
934847443 2:97671316-97671338 TTTTATTTTTTGTAGAGTCGGGG + Intergenic
937101430 2:119273674-119273696 TTTTGTTTTGTCAAGAGATGAGG + Intergenic
937293348 2:120795212-120795234 TTTTTCTTTTTTAAGAGACAGGG - Intronic
937335786 2:121061641-121061663 TTTTGCTTTTTAAAAAATTGAGG - Intergenic
937420536 2:121751240-121751262 TTTTGGTTTTTTAAGAGACATGG - Intronic
938012364 2:127839138-127839160 TTTTGCTTTTTAATCAGACGGGG + Intergenic
938242934 2:129757130-129757152 TTTTGCTTATTCAAGTTTGGAGG - Intergenic
938459179 2:131486607-131486629 TTTTTTTTTTTTAAGAGTGGTGG + Intronic
939149002 2:138450559-138450581 TTTTTTTTTTTAAAGAGTCAGGG - Intergenic
939208979 2:139146884-139146906 TTTTTTTTTTTGAAGAGACGAGG - Intergenic
939314943 2:140536300-140536322 TTTTTTTTTTTAAAGAGACGGGG - Intronic
940772617 2:157855242-157855264 TTTTTTTTTTTTAAGAGACGAGG - Intronic
940835590 2:158517742-158517764 TTTTTTTTTTTGTAGAGTCGGGG - Intronic
940894416 2:159066405-159066427 TTTTTCTTTTTTAAGAGACAGGG - Intronic
940987985 2:160067675-160067697 TTCTGCTTTTTTCAGAGTCAAGG - Intergenic
941489259 2:166123775-166123797 ATTTGTTTTTTTAAAAGTCGGGG + Intronic
941619021 2:167755966-167755988 TTTTGTTTTTTTAAGAGACGAGG - Intergenic
941831149 2:169961353-169961375 TTTTTCTTTTTTAAGAGTCAAGG + Intronic
941962293 2:171265420-171265442 TTTTGTTTTTTTAAGAGATGAGG - Intergenic
942265371 2:174219267-174219289 TTTTTTTTTTTAAAGAGTCAGGG - Intronic
942516334 2:176757410-176757432 TTTTGCTGTCTCAAGGGTGGCGG + Intergenic
942701858 2:178720237-178720259 CTTAGCTTTTTCACGAATCGTGG + Exonic
943068680 2:183115910-183115932 TTTTGTTTTTTGAAGAGACAGGG + Intergenic
943139598 2:183964327-183964349 TTTATTTTTTTCAAGAGTGGAGG + Intergenic
944232472 2:197410000-197410022 TTTTGCTTTTTTAAGACCCCTGG - Exonic
944244874 2:197520883-197520905 TTTTTTTTTTTTAAGAGACGAGG - Intronic
944614913 2:201450873-201450895 TTTTTCTTTTTCAAGATATGTGG + Intronic
944801791 2:203243860-203243882 TTGTACTTTTTAAAGAGACGGGG + Intronic
944814821 2:203364739-203364761 TTTTTTTTTTTCAAGAGACAGGG + Intronic
945885517 2:215371683-215371705 TTTTTTTTTTTCAAGAGACGAGG + Intronic
945995826 2:216435159-216435181 TTTTGTTTTTTTAAGAGTTGGGG - Intronic
946257541 2:218456450-218456472 TTTTTTTTTTTCAAGAGACAGGG - Intronic
946928942 2:224653991-224654013 TTTTGTTTTTTTAAGAGACAGGG - Intergenic
946937825 2:224739581-224739603 TTTTTCTTTTTCTAGAGACAGGG + Intergenic
947116020 2:226771373-226771395 TTTTGCTTTTCCTTGAGTGGTGG - Intronic
947122373 2:226830678-226830700 TTTTTATTTTTCAAGAGATGGGG + Intergenic
947437672 2:230086709-230086731 TTTTTTTTTTTGAAGAGACGGGG + Intergenic
948728605 2:239949653-239949675 TTTTACTTTTTGAAGAGACAAGG + Intronic
948882411 2:240866688-240866710 TTTTGCTATTTCAAGGGAGGCGG - Intergenic
1168943856 20:1735643-1735665 CTTTGTTTTTTCAAGAGACAGGG - Intergenic
1169097416 20:2915083-2915105 TTTTTTTTTTTAAAGAGTTGGGG + Intronic
1169529646 20:6471108-6471130 TTTTGCAATGTCAAGAGTTGAGG + Intergenic
1169944112 20:10970531-10970553 TTTTGCTTTTTCAATACTCACGG - Intergenic
1170683829 20:18550816-18550838 TTTTTTTTTTTTAAGAGTCAGGG - Intronic
1171367089 20:24632649-24632671 TTGTTCTTTGTCAAGAGTCCAGG + Intronic
1171536827 20:25899652-25899674 TTTTCTTTTTTTAAGAGTCAGGG - Intergenic
1171725612 20:28618175-28618197 TTTTACATATTCAAGGGTCGAGG + Intergenic
1171804277 20:29661505-29661527 TTTTCTTTTTTTAAGAGTCAGGG + Intergenic
1171839774 20:30194917-30194939 TTTTCTTTTTTTAAGAGTCAGGG - Intergenic
1172246685 20:33450250-33450272 TTTTTGTTTTTAAAGAGACGGGG + Intergenic
1172305469 20:33877189-33877211 TTTTTTTTTTTTAAGAGTTGGGG + Intergenic
1172382808 20:34510808-34510830 TTTTGTTTTTTTAAGAGACAGGG - Exonic
1172707479 20:36892618-36892640 TTTTTCTTTTTTAAGAGACAAGG - Exonic
1172908570 20:38388499-38388521 TTTTTTTTTTTTAAGAGTCAGGG - Intergenic
1173477890 20:43375203-43375225 TTTTGCTTTTTCTGGAGACAGGG - Intergenic
1173490306 20:43474272-43474294 TTTTTTTTTTTAAAGAGACGAGG - Intergenic
1173530069 20:43762439-43762461 TTTTTCTTTTTCTAGAGACAGGG + Intergenic
1173608401 20:44348683-44348705 TTTTGTTTTTTGTAGAGACGGGG + Intronic
1174219091 20:48938027-48938049 ATATGCTTGTTCGAGAGTCGAGG + Intronic
1174344039 20:49916297-49916319 TTTTTTTTTTTTAAGAGACGTGG - Intergenic
1174365182 20:50052393-50052415 TTTTTATTTTTCTAGAGACGAGG - Intergenic
1174441349 20:50557669-50557691 TTTTGTTTTTTAAAGAGATGGGG + Intronic
1175008051 20:55706633-55706655 TTTTTTTTTTTCCAGAGTCAGGG + Intergenic
1175354795 20:58355816-58355838 TTTTGTTTTTTTAAGAGACAGGG - Intronic
1175605696 20:60310683-60310705 TTTTCCTTTCTCAAGTGTCAGGG + Intergenic
1175800336 20:61797778-61797800 TTTTGTTTTTTGTAGAGACGGGG - Intronic
1177325604 21:19584351-19584373 TTTTATTTTTTCAAGAGATGAGG - Intergenic
1177569484 21:22869812-22869834 TTTTGTATTTTTAAGAGACGGGG + Intergenic
1177824597 21:26068370-26068392 TTTTTTTTTTTAAAGAGACGGGG + Intronic
1177826318 21:26088007-26088029 TTTTGTTTTTTTAAGAGACGGGG + Intronic
1177890374 21:26797546-26797568 TTTTTCTTTTTCTAGAGACAGGG + Intergenic
1178120967 21:29469808-29469830 TTTTGCTTTTTCAAGCTTTAAGG + Intronic
1178330915 21:31690312-31690334 TTTTGCATTTTCAATAGACACGG - Intronic
1178454902 21:32739927-32739949 TTTTTTTTTTTAAAGAGACGAGG - Intronic
1178542709 21:33468055-33468077 TTTTTTTTTTTAAAGAGACGAGG - Intronic
1179000498 21:37453103-37453125 TTTTTCTTTTTAAAGAGACAGGG - Intronic
1179446787 21:41437464-41437486 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1179589041 21:42393236-42393258 TTTTTCTTTTTCTTGAGACGAGG - Intronic
1181125665 22:20700650-20700672 TTTTTCTTTTTTTAGAGTCAGGG - Intergenic
1181303816 22:21902653-21902675 TTTTGTTTTTTGTAGAGACGGGG + Intergenic
1181381364 22:22507557-22507579 TTTTTTTTTTTCAAGAGATGTGG + Intronic
1181819451 22:25464232-25464254 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1181869735 22:25888268-25888290 TTTTATTTTTTTAAGAGTCAGGG + Intronic
1182607840 22:31520821-31520843 TTTTACTTTTTGTAGAGACGGGG - Intronic
1182800632 22:33029179-33029201 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1182909597 22:33971219-33971241 TTTTTTTTTTTCAAGAGATGGGG - Intergenic
1183050242 22:35255171-35255193 TTTTGCTTTGGCAAAAGTCATGG - Intergenic
1183132703 22:35854585-35854607 TTTTTTTTTTTCAAGAGACAGGG - Intronic
1183375315 22:37461294-37461316 TTTTTTTTTTTAAAGAGACGAGG - Intergenic
1183968846 22:41460713-41460735 TTTTTTTTTTTCAAGAGATGGGG - Intronic
1184544708 22:45159376-45159398 TTTTGTTTTTTGACGAGACGAGG + Intergenic
1184615050 22:45632289-45632311 TTTTGTTTTTTGAAGAGACAGGG - Intergenic
1184627627 22:45749566-45749588 TTTTTCTTTTTTAAGAGGTGGGG + Intronic
1184696839 22:46144372-46144394 TTTTACTTTTTGTAGAGACGGGG + Intergenic
1184793437 22:46716495-46716517 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1185001409 22:48248759-48248781 TTATGCTTTTTGTAGAGACGGGG - Intergenic
1185357746 22:50384744-50384766 TTTTGTTTTTTTAAGAGATGGGG + Intronic
949830651 3:8210702-8210724 TTTTACTTTTTGTAGAGACGGGG + Intergenic
949869674 3:8577681-8577703 TTTTTCTTTTTAAAGAGACAGGG - Intergenic
950054975 3:10017214-10017236 TTTTGTTTTTTAAAGAGCCTGGG + Intergenic
950386824 3:12666591-12666613 TTCTTCTTTTTTAAGAGACGGGG - Intergenic
950779852 3:15382055-15382077 TTTTTTTTTTTTAAGAGTCGGGG + Exonic
950783860 3:15416255-15416277 TTTTGTTTTTTAAAGAGACAGGG + Intronic
950785667 3:15432794-15432816 TTTTTTTTTTTAAAGAGTCGAGG + Intronic
951438285 3:22690540-22690562 TTGTGGTTTTTGAAGAGTCAGGG - Intergenic
951717796 3:25666768-25666790 TTTTACTTTTACTAGAGACGGGG + Intergenic
952088621 3:29856980-29857002 TTTTTCTAATTCAAGAGTCAAGG - Intronic
952118332 3:30211595-30211617 TTTTGTTTTTTGTAGAGACGGGG - Intergenic
953493558 3:43368691-43368713 TTTTTTTTTTTCAAGAGCCAGGG + Intronic
953504418 3:43470255-43470277 TTTTGCTTTTTCCAGAATGTTGG - Intronic
953938865 3:47072635-47072657 TTTTCATTTTTCTAGAGACGAGG - Intronic
953967491 3:47320904-47320926 TCTTTCTTTTTCAAGAGTCAAGG - Intronic
953988807 3:47467594-47467616 TTTTTCTTTTTCTTGAGACGGGG - Intronic
954154271 3:48676485-48676507 TTTTGTTTTTTAAAGAGACAAGG + Intronic
954203124 3:49037063-49037085 TTTTTTTTTTTTAAGAGACGGGG - Intronic
954381769 3:50222653-50222675 TTTTTCTTTTTTTAGAGACGAGG - Intergenic
954783938 3:53079704-53079726 TTTTTCTTTTGACAGAGTCGTGG - Intronic
954811443 3:53250788-53250810 TTTTGTTTTTTTAAGAGCCAGGG + Intronic
954892416 3:53943317-53943339 TTTTTTTTTTTCAAGAGACAGGG - Intergenic
954940789 3:54370825-54370847 TTTTTTTTTTTCTGGAGTCGGGG - Intronic
955082478 3:55670811-55670833 TTTACCTTTTTCAACAGTTGGGG + Intronic
955332369 3:58057958-58057980 TTTTGTATTTTTAAGAGTTGGGG + Intronic
955408581 3:58641525-58641547 TTTTACTTTTTGTAGAGACGGGG + Intronic
956533917 3:70253714-70253736 TTTTACTTTTTTTAGAGTTGGGG - Intergenic
956829065 3:73027949-73027971 TTTTTTTTTTTTAAGAGACGGGG + Intronic
956906339 3:73769710-73769732 TTTTGCTTTTTGAAAACTCATGG - Intergenic
956975824 3:74577410-74577432 TTATACTTTCTCAAGAGTGGGGG + Intergenic
957332777 3:78787775-78787797 TTTTGTTTTTTGGAGAGACGGGG - Intronic
958540698 3:95467556-95467578 CTTTGCTTTTTCAATTTTCGAGG + Intergenic
960089300 3:113623182-113623204 TTTTTTTTTTTTAAGAGTTGGGG - Intronic
960656719 3:120012684-120012706 TTTTTCTTTTTTAAGAGACAGGG + Intronic
960726206 3:120672892-120672914 TTTTGCCTTTTCAAGACCCAAGG + Intronic
960980477 3:123219858-123219880 TTCTGCTTTTTCAACAATCATGG - Intronic
961108563 3:124263579-124263601 TTTTTTTTTTTAAAGAGTCAGGG - Intronic
961348948 3:126287006-126287028 TTTTATTTTTTTAAGAGTCGAGG + Intergenic
961409540 3:126708639-126708661 TTTTTTTTTTTCAAGAGATGGGG - Intronic
961445875 3:126981350-126981372 TTTTTTTTTTTCAAGAGATGAGG - Intergenic
961709279 3:128814822-128814844 TTTTCCTTCTTCAAGAGCCTTGG + Intergenic
961836700 3:129667210-129667232 TTTTTTTTTTTTAAGAGTCAGGG - Intronic
962569069 3:136693740-136693762 TTTTTTTTTTTTAAGAGACGGGG + Intronic
962704793 3:138032619-138032641 TTTTGCTTTGTTTAGAGACGGGG + Exonic
963072494 3:141316238-141316260 TTTTTCTTTTTCAACAGATGGGG + Intergenic
963510636 3:146243340-146243362 TTTTTGTTTTTCAAGAGTTTTGG - Intronic
963627029 3:147686441-147686463 TTTTGCTTTTTCTAAATTCATGG + Intergenic
963886577 3:150589350-150589372 TTTTACTTTTTGTAGAGACGAGG + Intronic
964085667 3:152814817-152814839 TTTTGCTTTTTAAAGTTTTGTGG + Intergenic
964228241 3:154432110-154432132 TTTTTCTTTTTAAAGAGCCAGGG + Intergenic
964871512 3:161318395-161318417 TTTTTTTTTTTTAAGAGACGTGG - Intergenic
965222377 3:165943164-165943186 TTTTGTTTTTTTAAGAGGCAAGG + Intergenic
965403204 3:168238207-168238229 TTGTGATTTTTTAAGAGTTGTGG - Intergenic
965568079 3:170142448-170142470 TTTTTTTTTTGCAAAAGTCGGGG - Intronic
965766677 3:172137635-172137657 TTTTTCTTTTTTAATAGACGGGG - Intronic
965789076 3:172368261-172368283 TTTTTTTTTTTTAAGAGTCTGGG - Intronic
966050774 3:175616469-175616491 TTTTGCTCTTTCTAGAGTGAGGG + Intronic
966794408 3:183699538-183699560 TTTTTTTTTTTTAAGAGACGGGG - Intronic
966795396 3:183708692-183708714 TTTTATTTTTTAAAGAGACGGGG - Intronic
967085611 3:186092604-186092626 TTTTTTTTTTTAAAGAGACGGGG + Intronic
967140032 3:186549647-186549669 TTTTTCTTTTTCTAGAGATGAGG - Intronic
967191111 3:186985589-186985611 TTTTACTTTTTGAAGAGACGGGG - Intronic
968216084 3:196892092-196892114 TTTTCTTTTTTTAAGAGTCAAGG - Intronic
968362462 3:198157108-198157130 TTTTGTTTTTTGTAGAGACGGGG + Intergenic
968788423 4:2641927-2641949 TTTTTCTTTTTTAAGAGATGGGG - Intronic
968822429 4:2864821-2864843 TTTTGGTTTTTTAAGAGATGGGG + Intronic
970393236 4:15637841-15637863 CTTTGCTTCTTCAAGATTAGTGG - Intronic
971015243 4:22482481-22482503 TTTTTTTTTTTTAAGAGTTGGGG - Intronic
971282812 4:25255633-25255655 TTTTGTTTTTTTAAGAGACAGGG + Intronic
971289731 4:25326170-25326192 TCTTGCTTTTTCCAGCGTCTGGG + Intronic
971289875 4:25327650-25327672 TTTTACTTTTTGAAGAGATGAGG + Intronic
971481027 4:27115192-27115214 TTCTGCATTTTCAAAACTCGTGG + Intergenic
971912178 4:32808955-32808977 TTTTTCTTTTTCTAGAGACAGGG - Intergenic
972473187 4:39426692-39426714 TTTTTTTTTTTTAAGAGACGGGG + Intronic
972483271 4:39518353-39518375 TTTTATTTTTTCAAGAGACAGGG + Intronic
972490572 4:39583093-39583115 TTTTGTTTTTTTAAGAGACAGGG + Intronic
972530140 4:39954351-39954373 TTTTGTTTTTTTAAGAGACAGGG - Intronic
972544773 4:40069906-40069928 TTTTGTTTTTTTAAGAGACAGGG - Intronic
972615061 4:40690209-40690231 TTTTTCTTTTTTCAGAGTTGAGG - Intergenic
973320075 4:48800963-48800985 TTTTTCTTTTTTTAGAGGCGGGG - Intergenic
973749030 4:53994180-53994202 TTTTGGTTTCTAAAGAGTTGAGG - Intronic
975070786 4:70135166-70135188 TTTTGCATTTTTAAGAGGCGAGG + Intronic
975145055 4:70957761-70957783 TTTTTTTTTTTCAAGAGATGGGG + Intronic
975222143 4:71824899-71824921 TTTTGTTTTTTTAAGAGACAAGG - Intergenic
975544642 4:75548432-75548454 TTTTTTTTTTTTAAGAGACGGGG + Intronic
975867996 4:78745468-78745490 TTTTACTTTTTTAAGAGACAGGG - Intergenic
976202102 4:82589201-82589223 TTTTGTTTTTTTTAGAGACGGGG + Intergenic
976305341 4:83554163-83554185 TTTTCCTTTTTGTAGAGGCGGGG + Intronic
976426654 4:84911478-84911500 TTTTTCTTTTTTAAGAGACAGGG - Intronic
976704937 4:88010099-88010121 TTTTTTTTTTTTAAGAGTCGGGG + Intronic
977008795 4:91609147-91609169 TATTGCATTTTAAAGAGTCAGGG + Intergenic
977149300 4:93489449-93489471 TTTTATTTTTTAAAGAGTCCTGG + Intronic
978418017 4:108499253-108499275 TTTTTCTTTTTGTAGAGACGGGG + Intergenic
978559397 4:110016068-110016090 TTTTTTTTTTTCAAGAGACAGGG - Intergenic
978758262 4:112327435-112327457 TTTTGATTTTTGAAGAGACAGGG + Intronic
980044149 4:127970053-127970075 TTTTTTTTTTTTAAGAGACGAGG + Intronic
980256455 4:130386226-130386248 TTTTTCTTTTTCTAGAGATGGGG - Intergenic
980960035 4:139465898-139465920 TTTTTTTTTTTTAAGAGACGAGG + Intronic
981302516 4:143204559-143204581 TTTTATTTTTTGTAGAGTCGGGG + Intronic
981621102 4:146699782-146699804 TTTTTTTTTTTTAAGAGGCGGGG + Intergenic
981721796 4:147809200-147809222 TTTTGTTTTTTATAGAGACGAGG - Intronic
981925331 4:150132798-150132820 TTTTACTTTTTGTAGAGACGGGG + Intronic
981974409 4:150707380-150707402 TTTTGCTTTTTTAAAAGTATAGG - Intronic
982553479 4:156831744-156831766 TTTTCTTTTTTCAAGAGACAGGG - Intronic
982700088 4:158650942-158650964 TTTTATTTTTTGAAGAGTTGGGG - Intronic
982719506 4:158845416-158845438 TTTTTCTTTTTAAAGAGATGAGG + Intronic
983307001 4:166002449-166002471 TTTTTCTTTTTTAAGAGACAGGG + Intronic
983527828 4:168778184-168778206 TTTTTCTTTTTCAAAAGTTGAGG - Intronic
983536359 4:168861471-168861493 TTTTGCATTTTGAAGAGCAGAGG + Intronic
983600929 4:169526482-169526504 TTTTGTTTTTTTTAGAGACGGGG - Intronic
983710730 4:170712727-170712749 TTTTGTATTTTCTAGAGACGGGG - Intergenic
984354801 4:178644200-178644222 TATTGCTTTTTCAAGAACCCTGG + Intergenic
984744271 4:183198778-183198800 TTTTTTTTTTTAAAGAGACGAGG - Intronic
984759481 4:183351356-183351378 TTTTTCTTTTTGTAGAGACGAGG + Intergenic
984760981 4:183362781-183362803 TTTTTTTTTTTGTAGAGTCGGGG - Intergenic
985048046 4:185960677-185960699 TTTTTTTTTTTCAAGAGGCAGGG - Intergenic
985138801 4:186817166-186817188 TTTTTATTTTTTAAGAGTCAAGG - Intergenic
985173628 4:187177923-187177945 TTTTTCTTTTTTAAGAGATGGGG + Intergenic
985268665 4:188174117-188174139 TTTTGCTTTTTAGAAAGTGGTGG + Intergenic
986201529 5:5583707-5583729 TTTTGCTTTTTCAATGGTGATGG + Intergenic
986263839 5:6175379-6175401 TTTTTCTTTTTCATGGGTCATGG + Intergenic
986836554 5:11645136-11645158 TTTAACTTTTTCTAGAGACGGGG + Intronic
987059986 5:14233306-14233328 TTTTTTTTTTTTAAGAGACGAGG - Intronic
987758265 5:22125063-22125085 TTTTATATTTTCAAGATTCGGGG + Intronic
987915619 5:24209106-24209128 TTTGGCTTTTCCAAGAGGCAAGG + Intergenic
988614624 5:32763484-32763506 TTTTTTTTTTTTAAGAGTCAGGG + Intronic
989150712 5:38296985-38297007 TTTTGTTTTTTGAAGAGTACTGG - Intronic
989238722 5:39179402-39179424 TTTTCCATTTTCAGGAGTCAGGG + Intronic
989535529 5:42559539-42559561 TTTTACTTTTTGAAGAGACATGG - Intronic
989628728 5:43459336-43459358 TATTGCTTTTTGCAGAGTGGGGG - Intronic
989690789 5:44141583-44141605 TATTGCTTTTTGTAGAGACGGGG - Intergenic
989764344 5:45062418-45062440 TTTTGTTTTTTGTAGAGTCAGGG - Intergenic
989978984 5:50619473-50619495 TTTTTTTTTTTCTAGAGACGAGG - Intergenic
990270289 5:54130064-54130086 TTTTACTTTTTGTAGAGACGAGG - Intronic
990589475 5:57247912-57247934 TTTTACTTTTTGTAGAGACGAGG + Intronic
991176882 5:63698903-63698925 TTGTACTTTTACAAGAGACGGGG - Intergenic
991350970 5:65720582-65720604 TTTTGATCTTTCAAGAGGAGAGG - Intronic
991388239 5:66113929-66113951 TTTTTCTTTTTTAAGAGTCAAGG - Intergenic
991913267 5:71582435-71582457 TTTTTGTTTTTTAAGAGTTGGGG + Intergenic
992061548 5:73053519-73053541 TTGTATTTTTTCAAGAGACGGGG - Intronic
992519429 5:77535065-77535087 TTTTCTTTTTTTAAGAGTCATGG + Intronic
992544993 5:77804801-77804823 TTTTTTTTTTTTAAGAGTCAGGG - Intronic
992788072 5:80188713-80188735 TTTTACTTTTTGTAGAGACGGGG - Intronic
992871536 5:81010507-81010529 TTTTGCTTTTTGAAGATTTTTGG + Intronic
992910039 5:81387541-81387563 TTTTTTTTTTTTAAGAGACGAGG + Intronic
993617550 5:90132248-90132270 TTTTGCTTTTTTAAAATTCCAGG - Intergenic
993641672 5:90413322-90413344 TTTTCCTTTTTTTAGAGACGGGG + Intergenic
993732450 5:91438837-91438859 TGTTTCTTATTCAAGAGTCCTGG - Intergenic
994386108 5:99134563-99134585 TTTTTTTTTTTTAAGAGTTGGGG + Intergenic
994796202 5:104303190-104303212 ATTTGCCTTTTCAAAAGTCAAGG + Intergenic
995499959 5:112794007-112794029 TTTTCTTTTTTTAAGAGACGTGG + Intronic
995784417 5:115813949-115813971 TTTTGCTTTTTTCACAGTCGTGG - Intronic
995877311 5:116803775-116803797 TTTTTTTTTTTTAAGAGTTGGGG + Intergenic
997548918 5:134735508-134735530 TTTTTTTTTTTCTAGAGACGAGG + Intergenic
998105092 5:139463216-139463238 TTTTTTTTTTTTAAGAGTTGGGG + Intergenic
998145828 5:139727696-139727718 TTTTGTTTTTTTAAGAGACAAGG + Intergenic
998180345 5:139934024-139934046 TTGTACTTTTTGAAGAGACGAGG - Intronic
998246464 5:140510996-140511018 TTTTACTTTTTGTAGAGACGAGG + Intronic
998361258 5:141589921-141589943 TTTTTTTTTTTAAAGAGACGGGG + Intronic
998512335 5:142723849-142723871 TTTTGCTTTTTGTAGAGGCGAGG - Intergenic
998597380 5:143547026-143547048 TTTTTCTTTTTTAAGAGACAGGG + Intergenic
998835330 5:146197641-146197663 TTTGTCTTTTTTAAGAGACGGGG + Intergenic
999140299 5:149357086-149357108 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
999225184 5:150016170-150016192 TTTTGCTTTTTGTAGAGACGGGG - Intronic
1000343030 5:160292053-160292075 TTTTGTTTTTTAAAGAGACGGGG - Intronic
1000500749 5:162046185-162046207 CTTTTCTTTTTTAAGAGTTGGGG - Intergenic
1000624574 5:163524643-163524665 TTTTTCTTTTTTAAGAGATGGGG + Intergenic
1000652900 5:163838821-163838843 TTTTGCTTTCTCAGCAGTAGTGG + Intergenic
1001619502 5:173071514-173071536 TTTTGTTTTTTTAAGAGACTAGG + Intronic
1001967348 5:175920501-175920523 TTTTTTTTTTTAAAGAGGCGGGG + Intronic
1002437621 5:179241467-179241489 TTCTGCTCTTTCATGAGTCAGGG + Intronic
1003096572 6:3147087-3147109 TCTTGCTTTTTGTAGAGACGAGG - Intronic
1003198281 6:3934015-3934037 TTTTATTTTTTCTAGAGACGAGG + Intergenic
1003514755 6:6808675-6808697 TTTTTCTTTTTTAAGAGACAGGG + Intergenic
1003541967 6:7025819-7025841 TTTTTTTTTTTCAAGAGACAGGG - Intergenic
1003577391 6:7310231-7310253 TTTTTTTTTTTTAAGAGTCAGGG + Intronic
1003909576 6:10731323-10731345 TTTTTGTTTTTCAAGAGACAAGG + Intergenic
1004496069 6:16164454-16164476 TTTTTCTTTTTTTAGAGACGGGG + Intergenic
1004968762 6:20884952-20884974 TTTTTCTTTTTTAAGAGATGGGG - Intronic
1005275977 6:24218659-24218681 TTTTGCTTTTTGTAGAGATGAGG + Intronic
1005525851 6:26647883-26647905 TTTTTTTTTTTAAAGAGTCGGGG + Intronic
1005642142 6:27806813-27806835 TTGTGCTTTTTGCAGAGACGGGG + Intergenic
1005875177 6:30006110-30006132 GTTTTCTTTTTGAAGAGTCCAGG + Intergenic
1006533898 6:34682045-34682067 TTTTTTTTTTTCTAGAGACGGGG + Intronic
1006782974 6:36644589-36644611 TTTTGTGTTTTCTAGAGACGGGG + Intergenic
1006848301 6:37078523-37078545 TTTTATTTTTTCAAGAGATGGGG - Intergenic
1006981185 6:38149613-38149635 TGTTCCTTTTTCCAGAGTCCTGG + Intronic
1007669134 6:43536971-43536993 TTTTGTTTTTTAAAGAGACAGGG + Intronic
1007795287 6:44342421-44342443 TTTTTTTTTTTTAAGAGTTGTGG - Intronic
1007796436 6:44352299-44352321 TTTTGTTTTTTGTAGAGACGGGG + Intronic
1007847596 6:44772761-44772783 TTTTGCTTATTCTAGTGTTGAGG + Intergenic
1008732448 6:54499283-54499305 TTTTGTTTTTTGTAGAGACGAGG - Intergenic
1008923304 6:56865506-56865528 TTTTGTTTTTTGAAGAGATGGGG + Intronic
1011600532 6:89055938-89055960 ATTTTCTTTTTCAAGAGACAGGG + Intergenic
1011604670 6:89091233-89091255 TTTTTCTTTTTTAAGAGACAGGG - Intergenic
1011610700 6:89147226-89147248 TTTCCCTGTTTAAAGAGTCGAGG - Intronic
1011681796 6:89790694-89790716 TATTTATTTTTCTAGAGTCGGGG - Intronic
1011940030 6:92831637-92831659 TTTTGTTTTTTTCAGAGTCAAGG + Intergenic
1012209898 6:96506780-96506802 TTTTGTTTTTTGTAGAGTTGGGG + Intergenic
1012237166 6:96832443-96832465 TTTTACTTTTTGGAGAGACGGGG + Intronic
1012844517 6:104372944-104372966 ATTTGCTTTTTCAAAAGGTGTGG + Intergenic
1012884519 6:104830765-104830787 TTTTTTTTTTTGAAGAGACGAGG + Intronic
1013482506 6:110564617-110564639 TTTTGTTTTTTGTAGAGACGGGG - Intergenic
1013503279 6:110773041-110773063 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1013520769 6:110931230-110931252 TTTTTTTTTTACAAGAGTTGGGG - Intergenic
1013529698 6:111007524-111007546 TTTTTCTTTTTAAAGAGACAGGG - Intronic
1013544812 6:111145674-111145696 TTTTTCTTTTTTAAGAGACGAGG - Intronic
1013574923 6:111473231-111473253 TTTTTTTTTTTAAAGAGACGGGG + Intronic
1014331249 6:120067057-120067079 TTGTGGTTTTTCAGGAGTTGAGG - Intergenic
1014783477 6:125591458-125591480 TTTTTTTTTTTTAAGAGTCAGGG + Intergenic
1014939179 6:127418266-127418288 TTTTGCTTTTTGAAGCTTTGTGG + Intergenic
1015219755 6:130790824-130790846 TTTTCCTTTTTCTAGATTCTTGG + Intergenic
1015774629 6:136801158-136801180 TTTTGTTTTTTTAAGAGATGGGG - Intergenic
1015947022 6:138513381-138513403 TTTTTCTTTTTCCAGAGACAGGG + Intronic
1016478287 6:144452761-144452783 TTTTACTTTTTGTAGAGACGGGG - Intronic
1016564474 6:145437721-145437743 TTATACTATTTCAAGAGTCTAGG - Intergenic
1017559523 6:155611791-155611813 TTTTGTTTTTTTCAGAGTCAAGG - Intergenic
1017677415 6:156828069-156828091 TTTTTTTTTTTCAAGAGACAGGG + Intronic
1017910647 6:158789790-158789812 TTTTACTTTTTGTAGAGACGGGG + Intronic
1018581677 6:165313319-165313341 TCTTGCTTTTTCAAGGGCCCCGG + Intergenic
1019253218 7:31599-31621 TTTTGTTTTTTGTAGAGACGGGG - Intergenic
1020066915 7:5195312-5195334 TTTTGTTTTGTGTAGAGTCGAGG - Intronic
1020076982 7:5264744-5264766 TTTTTTTTTTTTAAGAGTTGGGG + Intergenic
1020098835 7:5383072-5383094 TTTTTATTTTTGTAGAGTCGGGG + Intronic
1020455180 7:8364771-8364793 TTTGGCCTTTTGAAGAGTCAAGG + Intergenic
1022298908 7:29083936-29083958 TTTTCTTTTTTCAAGACTCGTGG + Intronic
1022409281 7:30124699-30124721 TTTTTCTTTTTAAATAGTCGAGG - Intronic
1022486482 7:30782694-30782716 TTTTTCTTTTTTAAGAGACAGGG - Intronic
1022813538 7:33892364-33892386 TTCTCCTTTTTCAAGATTCTAGG + Intergenic
1022928332 7:35080379-35080401 TTTTGTTATTTCAAGTGTAGAGG + Intergenic
1023014080 7:35949150-35949172 TTTTTTTTTTTTAAGAGACGAGG + Intergenic
1023065307 7:36371765-36371787 TTTTGTTTTTTCCAGAGACAGGG + Intronic
1023070954 7:36432986-36433008 TTTTTCTTTTTTAAGAGATGGGG + Intronic
1023288152 7:38640882-38640904 TTTTTCTTTTTTAAGAGACAGGG - Intergenic
1023736927 7:43243581-43243603 TTTTTCTTTTTCAAGAAACAAGG - Intronic
1024602470 7:50995898-50995920 TTGTGCTTTTTGTAGAGACGGGG + Intergenic
1025084348 7:56010473-56010495 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1025202122 7:56968904-56968926 TTTTTTTTTTTTAAGAGTTGGGG - Intergenic
1025669825 7:63608024-63608046 TTTTTTTTTTTTAAGAGTTGGGG + Intergenic
1025999069 7:66547324-66547346 TTTTGTATTTTTAAGAGACGGGG + Intergenic
1026006345 7:66603137-66603159 TTTTGCATTTTGTAGAGACGGGG + Intergenic
1026218673 7:68372550-68372572 TTTTTCTTTTTAAAGAGACAGGG + Intergenic
1026273200 7:68854124-68854146 TTTTTCTTTTTGCAGAGACGGGG + Intergenic
1026406362 7:70070398-70070420 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1026981156 7:74527314-74527336 TTTTATTTTTTGAAGAGACGGGG - Intronic
1027023641 7:74834709-74834731 TTTTTTTTTTTTAAGAGTCAGGG + Intronic
1027064289 7:75110610-75110632 TTTTTTTTTTTTAAGAGTCAGGG - Intronic
1027122611 7:75532724-75532746 TTTTTTTTTTTCAAGAGACAGGG + Intergenic
1027163453 7:75818601-75818623 TTTTTTTTTTTAAAGAGTCCGGG - Intronic
1027177049 7:75911169-75911191 TTTTGTATTTTTAAGAGACGAGG + Intronic
1027184864 7:75965007-75965029 TTTTAGTTTTTCTAGAGACGGGG - Intronic
1027214972 7:76177905-76177927 TTTTTTTTTTTGTAGAGTCGGGG + Intergenic
1027376977 7:77561091-77561113 TTTTGTTTTTTATAGAGTTGAGG + Intronic
1027571750 7:79876694-79876716 TTTTGCTTTTAGTAGAGACGGGG + Intergenic
1027759187 7:82256102-82256124 TTTTTCTTTTTTAAGAGATGGGG - Intronic
1027762074 7:82291675-82291697 TTTTTCTTTTTGTAGAGACGTGG + Intronic
1028178546 7:87686765-87686787 TTTTTTTTTTTCTAGAGGCGGGG - Intronic
1028373948 7:90125185-90125207 TTTTGTTATTTCAAGTGTAGAGG - Intergenic
1028388098 7:90282340-90282362 TTTTTCTTTTTTAAGAGACAGGG - Intronic
1028847317 7:95496672-95496694 TTTTGCTTTTTGTAGAGATGGGG - Intronic
1029066520 7:97854982-97855004 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1029083832 7:97995968-97995990 TTTTATTTTTTGTAGAGTCGGGG - Intergenic
1029134198 7:98357057-98357079 TTTTTTTTTTTTAAGAGTAGGGG + Intronic
1029234876 7:99106737-99106759 TTCTGTTTTTTCAAGAGACAAGG - Intronic
1029267321 7:99352645-99352667 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1029368288 7:100130564-100130586 TTTTTCTTTTTTTAGAGTTGGGG - Intergenic
1029449170 7:100631320-100631342 TTTTTTTTTTTAAAGAGTCAGGG + Intronic
1029495023 7:100891958-100891980 TTTTTTCTTTTTAAGAGTCGGGG + Intronic
1029581223 7:101437746-101437768 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1029706129 7:102277125-102277147 TTTTTATTTTTGCAGAGTCGGGG - Intronic
1029794748 7:102882086-102882108 TTTAAATTTTTCTAGAGTCGGGG - Intronic
1030173017 7:106623785-106623807 TTTTGTTTTTTAAAGAAACGGGG - Intergenic
1030269593 7:107656066-107656088 TTTTTTTTTTTCAAGAGATGGGG - Intergenic
1030308905 7:108048861-108048883 TTTTGTTTTTTGTAGAGACGGGG + Intronic
1030827923 7:114184725-114184747 TTTTGCTTTACCAAAAGTCAGGG - Intronic
1031058707 7:117024407-117024429 TTTTGCTTTTTCAATTCTCAAGG + Intronic
1031666588 7:124491778-124491800 TGTTGCTTTTTTAAGAGATGGGG + Intergenic
1031684493 7:124716537-124716559 TTTTGTTTTTTGTAGAGACGGGG - Intergenic
1032361504 7:131260050-131260072 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1032584568 7:133134468-133134490 TTTTTTTTTTTTAAGAGACGGGG - Intergenic
1032827779 7:135589161-135589183 TTTTTTTTTTTAAAGAGTCAGGG - Intronic
1033115258 7:138619392-138619414 TTTTTCTTTTTCCAGAGACAGGG - Intronic
1033144862 7:138862493-138862515 TTTTTTTTTTTTAAGAGTCTAGG - Intronic
1033203536 7:139395818-139395840 TTTTACTTTTTGTAGAGACGGGG + Intronic
1033328789 7:140400968-140400990 TTTTTCTTTTTTAAGAGACTGGG - Intronic
1034524520 7:151648843-151648865 TTCTGTTTTTTAAAGAGACGGGG - Intronic
1034684496 7:152958305-152958327 TTTTTATTTTTTAAGAGTCAGGG + Intergenic
1034990706 7:155546356-155546378 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1035005519 7:155655879-155655901 TTTTTATTTTTTAAGAGACGGGG - Intronic
1035157545 7:156926229-156926251 TTTTTTTTTTTTAAGAGTCAGGG - Intergenic
1035431321 7:158824986-158825008 TTTTGTTTTTTAAAGAGAGGCGG - Intronic
1035433373 7:158839510-158839532 TTTTGTTTTTTAAAGAGATGGGG + Intergenic
1035576126 8:707022-707044 TTGTTCTTTTTCAAGACTCAGGG - Intronic
1035731348 8:1855560-1855582 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1036532572 8:9608111-9608133 TTTTACTTTTTGAAAAGTCCAGG + Intronic
1036552031 8:9824389-9824411 TTTTAATTTTTGAAGAGACGGGG - Intergenic
1036816154 8:11904394-11904416 TTTTACTTTTTCTAGAGATGGGG + Intergenic
1036946276 8:13098009-13098031 TTTTCCTTTTTGAAGAGATGGGG - Intronic
1037318916 8:17625814-17625836 TTTTAGTTTTTCTAGAGTCAGGG - Intronic
1037460904 8:19108520-19108542 TTTTGTTTTTTTAAGAGATGAGG + Intergenic
1037918332 8:22786453-22786475 TTTTAGTTTTTGAAGAGACGGGG + Intronic
1038500003 8:28035887-28035909 TTTTTCTTTTTTAAGAGACAGGG + Intronic
1038620675 8:29139857-29139879 TTTTGCATTATCATGAGTGGGGG + Intronic
1038672130 8:29591163-29591185 TTTTGTTTTCTGAAGAGTCCGGG + Intergenic
1038726887 8:30089580-30089602 TTTTACTTTTTGTAGAGGCGGGG - Intergenic
1038774435 8:30515659-30515681 TTTTTCTTTTTTAAGAGATGGGG + Intronic
1038804782 8:30780315-30780337 TTTTGTTTTTTGTAGAGACGGGG - Intronic
1039513096 8:38106943-38106965 TTTTATTTTTTTAAGAGACGGGG - Intronic
1039735442 8:40327111-40327133 TTTTGTATTTTCACGAGTCATGG - Intergenic
1040462994 8:47667422-47667444 TTTTCCCTTTTGAAGAGACGAGG - Intronic
1041233985 8:55780341-55780363 TTTTGTTTTTTCTAGAGGTGGGG + Intronic
1041358908 8:57029781-57029803 TTTTGCTTTATTAAGAAGCGAGG + Intergenic
1041633011 8:60109363-60109385 TTTTGCTTTTTGAAAAGTAAAGG + Intergenic
1042030158 8:64466970-64466992 TTTTACTTTTTGTAGAGTCGGGG + Intergenic
1042215401 8:66426013-66426035 TTTTACTTTTTGTAGAGACGGGG + Intergenic
1042253652 8:66781352-66781374 TTTTTGTTTTTAAAGAGACGGGG + Intronic
1042291215 8:67171092-67171114 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1042525025 8:69755540-69755562 TTTTTCTTTTTCTTGTGTCGAGG + Exonic
1042551433 8:69997179-69997201 TTTTTCTTTTTTAAGAGACAGGG + Intergenic
1043580413 8:81705746-81705768 TTTTGTATTTTTAAGAGACGGGG - Intronic
1043927206 8:86050913-86050935 TTTTGCTTTTTTTAGAGATGGGG + Intronic
1044857300 8:96489797-96489819 TTTTTCTTTTTTTAGAGACGAGG - Intergenic
1044980076 8:97707845-97707867 TTTTTCTTTTTTAAGAGATGGGG - Intronic
1045067477 8:98462261-98462283 TTTTGCTTTCTCATCAGTTGCGG - Intronic
1045108632 8:98918595-98918617 TTTTATTTTTTGTAGAGTCGGGG - Intronic
1045201035 8:99981732-99981754 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1045332543 8:101167855-101167877 TTTTGTTTTTTAAAGAGATGGGG + Intergenic
1045513944 8:102840346-102840368 TATTACTTTTTCAAGAGTTGAGG + Intronic
1045769255 8:105715397-105715419 TTTTTTTTTTTCAAGAGATGGGG - Intronic
1046363664 8:113196188-113196210 TTTTTCTTTTTATAGAGTCATGG + Intronic
1046762295 8:118033648-118033670 TTTTGGTTTTTGTAGAGACGAGG + Intronic
1047344352 8:124012386-124012408 ATTTGCTTTGTCAAGACTCTTGG - Intronic
1047467742 8:125134732-125134754 TTTTTTTTTTTTAAGAGTCGGGG + Intronic
1048005385 8:130415467-130415489 TTTTGTTTTTTTAAGAGACAGGG - Intronic
1048501696 8:134982310-134982332 TTTTGTTTTTTTAAGAGACAGGG + Intergenic
1049851643 8:144835208-144835230 TTTTTTTTTTTAAAGAGTTGGGG + Intronic
1049970420 9:817413-817435 TTTTTCTTTTTGAAGAGACAGGG - Intergenic
1049976302 9:863309-863331 TTTTTTTTTTTTAAGAGACGTGG - Intronic
1050460626 9:5874668-5874690 TTTTGCTTTTTTTAGAGAGGGGG - Intergenic
1051288895 9:15525769-15525791 TTTTTCTTTTTTAAGAGAGGAGG + Intergenic
1051303948 9:15687417-15687439 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1052294928 9:26887039-26887061 TTTTGGATTTTTAAGAGACGGGG - Intronic
1052300830 9:26950530-26950552 TTTTGCTTATTCTAGTGTGGAGG - Intronic
1052317570 9:27131635-27131657 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1052749654 9:32476792-32476814 TTTTTCTTTTTTAAGAGATGAGG + Intronic
1052906587 9:33839987-33840009 TTTTTTTTTTTTAAGAGTCAGGG - Intronic
1053051692 9:34966695-34966717 TTTTTCTTTTTTAAGAGACAGGG + Intronic
1053119586 9:35536638-35536660 TTTTACTTTTAGAAGAGACGGGG - Intronic
1054729328 9:68684917-68684939 GTTTGCTTTTTATAGAGTTGGGG + Intergenic
1054795866 9:69301303-69301325 TTTTGTTTTTTGTAGAGACGGGG + Intergenic
1055034907 9:71808225-71808247 TGTTGTTTTTTAAAGAGACGGGG - Intronic
1055603131 9:77940566-77940588 TTTTTCTTTTTTAAGAGACAGGG - Intronic
1056202073 9:84286457-84286479 TTTTTTTTTTTTAAGAGACGGGG + Intronic
1056514857 9:87340451-87340473 TTCTGCTTTTGCTAGAGCCGGGG - Intergenic
1056850351 9:90078727-90078749 TTTTTCTTTTTGTAGAGACGAGG + Intergenic
1056944482 9:90982893-90982915 TTTTCATTTTTCAAGAGTAGGGG + Intergenic
1057362533 9:94387708-94387730 TTTTTCGTATTCAAGAGTAGAGG + Intronic
1057478049 9:95421353-95421375 TTTTGTTTTTTTAAGAGACAGGG - Intergenic
1057660803 9:97000386-97000408 TTTTTCGTATTCAAGAGTAGAGG - Intronic
1057692575 9:97298580-97298602 TTTTGCTTTTTCAATCATAGAGG - Intergenic
1057790399 9:98120655-98120677 CTGTGCTTTTTCAAGACTGGGGG + Intergenic
1058252674 9:102719905-102719927 TTTTGTTTTTTCACGGGTTGGGG - Intergenic
1058413281 9:104758425-104758447 TTTTGCTTTTTTAAAAATCAAGG + Intronic
1058528903 9:105886650-105886672 TTTTGCTTTTTTATGAGACAGGG + Intergenic
1058896803 9:109407374-109407396 TTTTTCTTTTTTAAGAGACAGGG - Intronic
1059106109 9:111513063-111513085 CTTTTCTTTTTCAAGAGACAGGG + Intergenic
1059207943 9:112484131-112484153 TTTTTCTTTTTGTAGAGACGAGG + Intronic
1059712561 9:116882818-116882840 TTTTTTTTTTTTAAGAGTCAAGG - Intronic
1060071123 9:120548633-120548655 TTTTGCTTTTTGTAGAGATGGGG - Intronic
1060982237 9:127800000-127800022 TTTTGCTTTTTGTAGAGAAGGGG + Intronic
1061457164 9:130707223-130707245 TTTTGTTTTTTTAAGAGACAAGG + Intergenic
1061522101 9:131124809-131124831 TTTTGTTTTTTATAGAGACGGGG + Intergenic
1061547225 9:131311512-131311534 TTTTGTTTTTTCAAGAGTTGAGG + Intergenic
1061683302 9:132255134-132255156 TTTTTCTTTTTTTAGAGACGGGG - Intergenic
1061756756 9:132818839-132818861 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1062405445 9:136394088-136394110 TTTTACTTTTTGAAGAGATGGGG + Intronic
1062509989 9:136899850-136899872 TTTTGCTTTTTGTAGAGACAGGG - Intronic
1062587869 9:137257813-137257835 TTTTTCTTTTTTAAGAGACAGGG + Intronic
1062739043 9:138156878-138156900 TTTTGTTTTTTCCAGAGATGGGG - Intergenic
1185948393 X:4403029-4403051 TTTTTCTTTTTTAAGAGACAGGG + Intergenic
1186124247 X:6395748-6395770 TTTTTTTTTTTTAAGAGTTGAGG - Intergenic
1186370680 X:8943988-8944010 TTTTTTTTTTTCAAGAGACAGGG + Intergenic
1186381865 X:9069395-9069417 TTTTGCATTTTTCAGAGTCCTGG + Intronic
1186480387 X:9892244-9892266 TTTTTTTTTTTTAAGAGACGAGG - Intronic
1187003539 X:15207432-15207454 TTTTGCTTTTGCGAGTGTCATGG - Intergenic
1187710123 X:22044868-22044890 TTTTATTTTTTTAAGAGACGGGG + Intronic
1189279264 X:39809768-39809790 TTTTTTTTTTTTAAGAGTCAGGG + Intergenic
1189369629 X:40417328-40417350 TTTTTTTTTTTTAAGAGACGGGG + Intergenic
1189502932 X:41581371-41581393 TTTTTTTTTTTTAAGAGACGGGG - Intronic
1189719609 X:43902623-43902645 TTCTACTTTTTCAAGAATAGAGG + Intergenic
1189841567 X:45084627-45084649 TTTTTCTTTTTTAAGAGACAGGG + Intronic
1190000193 X:46678607-46678629 TTTTGCTTTTTGTAGAGGCAGGG + Intronic
1190026229 X:46925860-46925882 TTTTTCTTTTTTGAGAGTCAGGG + Intronic
1190034517 X:47009148-47009170 TTTTACTTTTTGTAGAGACGAGG - Intronic
1190091787 X:47444361-47444383 TTTTTCTTTTTTAAGAGACTGGG + Intergenic
1190211557 X:48452620-48452642 TTTTTCTTTTTTAAGAGACGGGG + Intergenic
1190784702 X:53634291-53634313 TTTTCCTTTTTCAAGAGCTGGGG - Exonic
1190875015 X:54453575-54453597 TCTTTCTTTTTTAAGAGGCGAGG + Intronic
1191767634 X:64715972-64715994 TTTTGTTTTTTCAAAATTTGTGG - Intergenic
1192134410 X:68583454-68583476 TTTTGTTTTTTGTAGAGACGGGG + Intergenic
1192631133 X:72778483-72778505 TCCTGACTTTTCAAGAGTCGAGG + Intronic
1192650576 X:72942318-72942340 TCCTGACTTTTCAAGAGTCGAGG - Intronic
1193109745 X:77716290-77716312 TTTTTTTTTTTAAAGAGACGAGG - Intronic
1193138866 X:78004573-78004595 TTTTACTTTTTGTAGAGGCGGGG - Intronic
1193745157 X:85269382-85269404 TTTTTTTTTTTCAAGAGACAGGG + Intronic
1194718668 X:97315301-97315323 TTTTGTTGTTTCAAGAGCCAGGG - Intronic
1195292566 X:103443274-103443296 TTTTGTTTTTTAAAGAGACAGGG - Intergenic
1195471931 X:105240126-105240148 TTTATCTTTTTCATGAGTCATGG + Intronic
1195751306 X:108163818-108163840 CTTTGCTATTTAAAGAGTAGAGG + Intronic
1196310481 X:114158411-114158433 TTTTGCCTTTTGTAGAGGCGGGG - Intergenic
1196432521 X:115642049-115642071 TTTTTTTTTTTTAAGAGACGAGG + Intronic
1196461603 X:115937714-115937736 TTTTGCTTTTTGTAGAGACAAGG - Intergenic
1196463165 X:115949758-115949780 ATTGACTTTTCCAAGAGTCGGGG - Intergenic
1196660311 X:118262593-118262615 TTTTACTTTTTAAAGAGACAGGG - Intergenic
1196822864 X:119716579-119716601 TTTTTCTTTTTGTAGAGACGAGG - Intergenic
1197090974 X:122537168-122537190 TTTTTGATTTTCAAGAGTTGTGG - Intergenic
1197691920 X:129510559-129510581 TGTTTCTTTTTCCAGAGGCGGGG - Intronic
1197755190 X:129988854-129988876 TTTTGCTTTTCCAAGTTTTGTGG + Intronic
1197767351 X:130067646-130067668 TTTTTCTTTTTCTAGAGACAGGG + Intronic
1197947261 X:131852545-131852567 TTTTGTTTTCTCATGAGTTGGGG + Intergenic
1197980074 X:132208837-132208859 TTTTATTTTTTGTAGAGTCGGGG + Intronic
1198059013 X:133025013-133025035 TTTTGCTTTTTGCAGAGACAGGG - Exonic
1198115273 X:133538891-133538913 TTTTTTTTTTTCTAGAGACGGGG + Intronic
1198676080 X:139132354-139132376 TTTTGCTTTTTAAAATGTCTAGG + Intronic
1199448127 X:147950039-147950061 TTTTGTTTTTTGAAGTGTTGGGG + Exonic
1199591131 X:149469379-149469401 TTTTCCTTGTTCATGAGCCGTGG - Intergenic
1199785950 X:151104984-151105006 CTTTTCATTTTCATGAGTCGGGG + Intergenic
1200023940 X:153238864-153238886 TCTTTCTTTTTTAAGAGTTGGGG + Intergenic
1200055662 X:153458928-153458950 TTTTACTTTTTGTAGAGACGGGG + Intronic
1200131492 X:153850530-153850552 TTTTGCTTTTTGTAGAGACAGGG + Intergenic
1201902887 Y:19061501-19061523 TTTTTCTTTTTTAAGAGATGGGG - Intergenic
1202375118 Y:24228119-24228141 TTTTGCTTTTTCTAGTTTAGTGG - Intergenic
1202495662 Y:25442001-25442023 TTTTGCTTTTTCTAGTTTAGTGG + Intergenic