ID: 1097201696

View in Genome Browser
Species Human (GRCh38)
Location 12:57284365-57284387
Sequence TGGGATTACCCTCAGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097201696_1097201705 6 Left 1097201696 12:57284365-57284387 CCCACCCTCTGAGGGTAATCCCA 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1097201705 12:57284394-57284416 CAAGCAATAATGGGGAACAGAGG 0: 1
1: 0
2: 1
3: 18
4: 167
1097201696_1097201706 7 Left 1097201696 12:57284365-57284387 CCCACCCTCTGAGGGTAATCCCA 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1097201706 12:57284395-57284417 AAGCAATAATGGGGAACAGAGGG 0: 1
1: 0
2: 1
3: 33
4: 273
1097201696_1097201701 -4 Left 1097201696 12:57284365-57284387 CCCACCCTCTGAGGGTAATCCCA 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1097201701 12:57284384-57284406 CCCACACATGCAAGCAATAATGG 0: 1
1: 0
2: 0
3: 18
4: 185
1097201696_1097201704 -2 Left 1097201696 12:57284365-57284387 CCCACCCTCTGAGGGTAATCCCA 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1097201704 12:57284386-57284408 CACACATGCAAGCAATAATGGGG 0: 1
1: 0
2: 0
3: 23
4: 196
1097201696_1097201703 -3 Left 1097201696 12:57284365-57284387 CCCACCCTCTGAGGGTAATCCCA 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1097201703 12:57284385-57284407 CCACACATGCAAGCAATAATGGG 0: 1
1: 0
2: 0
3: 12
4: 156
1097201696_1097201707 8 Left 1097201696 12:57284365-57284387 CCCACCCTCTGAGGGTAATCCCA 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1097201707 12:57284396-57284418 AGCAATAATGGGGAACAGAGGGG 0: 1
1: 0
2: 1
3: 25
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097201696 Original CRISPR TGGGATTACCCTCAGAGGGT GGG (reversed) Intronic
900078631 1:837925-837947 TGTGCTTGTCCTCAGAGGGTGGG + Intergenic
900172408 1:1275415-1275437 TGAGATTGCCCTCTGAGGGCAGG + Intergenic
903590992 1:24455882-24455904 TAGGATTACCTTCAGGGGGTTGG + Intronic
904081792 1:27876880-27876902 TGGGGATGTCCTCAGAGGGTCGG + Intronic
910087423 1:83420010-83420032 TGGGATTACCCTTAAAGAATAGG - Intergenic
917270130 1:173263759-173263781 TGGGATTAACCACTGAGTGTAGG + Intergenic
1063267862 10:4474240-4474262 TAGGACTATCCTCAGGGGGTCGG + Intergenic
1063975009 10:11408091-11408113 TGGGTTCACACACAGAGGGTGGG + Intergenic
1067736017 10:48851495-48851517 TGGGACTAAACTCAGAGGGGAGG - Intronic
1068126979 10:52851903-52851925 TGGCATGACCCTCAGAGAGAAGG - Intergenic
1073203292 10:101753574-101753596 TGGGATTACCCAGACAGGCTGGG - Intergenic
1073805058 10:107088427-107088449 TGGGATTTCCCTGATTGGGTGGG + Intronic
1077042187 11:529763-529785 TGGGGTTACCCGCAGAGGCCTGG - Intergenic
1078853817 11:15190092-15190114 TGGGAGTCCCGTCAAAGGGTGGG - Intronic
1083419397 11:62544765-62544787 TGGGATTTCCCTCACGGGGAGGG + Intronic
1085293027 11:75413705-75413727 TGAGGTTACCCTGAGAGGGCAGG - Intronic
1095406053 12:41868578-41868600 TGGTTATACCCTCAGATGGTGGG + Intergenic
1096872581 12:54602873-54602895 TGGGATTAACCACAGAGGTGTGG + Intergenic
1097201696 12:57284365-57284387 TGGGATTACCCTCAGAGGGTGGG - Intronic
1101421670 12:104555953-104555975 AGGGATTACCATCAGGTGGTGGG + Intronic
1107722997 13:43268714-43268736 TTTGATTACTCACAGAGGGTTGG + Intronic
1113551067 13:111193502-111193524 TGGGGGTTCCCTCAGAGGTTAGG + Intronic
1113814023 13:113159325-113159347 GGGGATCACCCTCTCAGGGTGGG - Intronic
1114798454 14:25743427-25743449 TGGGATTGCCCTCAGACAGAGGG + Intergenic
1117135839 14:52733494-52733516 TGTGATTACCATCTGAGGTTGGG - Intronic
1117597861 14:57342475-57342497 TCGGGTTACCCTCAAAGGGAAGG - Intergenic
1119437509 14:74607089-74607111 TGGGATGAGCCACTGAGGGTAGG + Intronic
1120930333 14:89841809-89841831 AGTGAGAACCCTCAGAGGGTTGG - Intronic
1121576146 14:94989728-94989750 AGGGATTACCTGCAGAGGGAGGG - Intergenic
1123053479 14:105558970-105558992 GGGGAGGAACCTCAGAGGGTCGG - Intergenic
1125597998 15:40899752-40899774 TGGGAGTACCCAGAGGGGGTAGG + Exonic
1127172278 15:56315536-56315558 TCGGGTTACCCTCAAAGGGAAGG - Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1132240691 15:100255230-100255252 AGGGATCAACCACAGAGGGTTGG + Intronic
1132465055 16:73555-73577 TGGGCTGACCCTCCCAGGGTGGG + Intronic
1140697158 16:77546556-77546578 TTGGAGCACCCCCAGAGGGTGGG - Intergenic
1141770682 16:86087975-86087997 TGGGAAGCCCCTCCGAGGGTTGG + Intergenic
1143287255 17:5799538-5799560 TGGGGTCCCCCTCAGAGAGTGGG - Intronic
1143545748 17:7594167-7594189 TGGGATTGTCCTCTGAGGGCTGG - Intronic
1144422340 17:15109897-15109919 TGGGATTAGGCTGAGGGGGTGGG - Intergenic
1146124135 17:30218729-30218751 AGGGATTTCCATCAGTGGGTGGG - Intronic
1146679440 17:34796431-34796453 AGGGACTACCCTCTGAGGCTGGG + Intergenic
1149272828 17:55000223-55000245 TGGGATTAGCCTCACTGTGTGGG - Intronic
1150338386 17:64346138-64346160 TGGGGTTAGCCTCAGAGGAAGGG + Intronic
1150487659 17:65555038-65555060 AGGAATTATCCTCAGAGGGCAGG - Intronic
1150575460 17:66426693-66426715 TGGGAATACCCTTCAAGGGTGGG + Intronic
1155084879 18:22448440-22448462 TGGGATTAGACTCCAAGGGTGGG - Intergenic
1156332042 18:36131481-36131503 TGGGAGGACCCTAAGAGGGGCGG + Intronic
1160028714 18:75240454-75240476 TGTGAGTACCCAAAGAGGGTTGG + Intronic
1160529355 18:79554523-79554545 CTGGGTTAGCCTCAGAGGGTCGG + Intergenic
1165522843 19:36328172-36328194 TGGGATGACCCTAAGGGAGTAGG + Intergenic
925680238 2:6412907-6412929 TGTGATTACAGTAAGAGGGTGGG - Intergenic
931805104 2:65796731-65796753 TGGGTTTCCCCTCTGAGGTTCGG + Intergenic
937076645 2:119112264-119112286 GGGGAGTACCCTCAGATGGGTGG - Intergenic
938263181 2:129909584-129909606 TGGGAGGACCCTCATGGGGTGGG - Intergenic
943902173 2:193454629-193454651 TGGGAGTTCCCCCAGAGGTTAGG - Intergenic
948457611 2:238114166-238114188 TGGGATTGTCAGCAGAGGGTGGG - Intronic
1170144411 20:13157071-13157093 AGCGATTACCCACGGAGGGTAGG + Intronic
1172206187 20:33164449-33164471 TGGTCTTGCCCTCAGAGAGTGGG + Intronic
1174189764 20:48731951-48731973 AGGGAATACTGTCAGAGGGTGGG + Intronic
1174764762 20:53242630-53242652 TGGGTTTAAACTCACAGGGTGGG - Intronic
1180901507 22:19376663-19376685 TGGGGGGACCCTGAGAGGGTAGG - Intronic
1181687361 22:24538732-24538754 TGGGATTACCTTCCAAGGTTGGG + Intergenic
1182298672 22:29326184-29326206 TGTGATGACCCTCAGAGGTGAGG + Intergenic
950097354 3:10337886-10337908 GGGGATTTCCCTGAGAGGGTGGG - Intronic
954647268 3:52139364-52139386 TGGGGTTAGCCTGAGATGGTAGG - Intronic
956382872 3:68684813-68684835 TCGGATTACCCACAAAGGGAAGG - Intergenic
959549579 3:107639378-107639400 TGGGATACCCCTCAGAGATTGGG - Intronic
960057913 3:113288985-113289007 TGGCCTTACCCTCAGAGGTGAGG + Exonic
963408940 3:144905517-144905539 TGGGAGTTCCCCCAGAGGTTAGG + Intergenic
963668326 3:148218616-148218638 TGGGAGTATCCACAGGGGGTGGG + Intergenic
963836237 3:150060621-150060643 TGGGAGAACCCACAGAGGGTAGG + Intergenic
963991884 3:151665692-151665714 TGGGAGTACCCCCAGAGATTAGG + Intergenic
965194289 3:165573946-165573968 TCGGGTTACCCTCAAAGGGAAGG + Intergenic
966299608 3:178463168-178463190 TGGAGCTACCCTCTGAGGGTCGG + Intronic
966903716 3:184506794-184506816 TGGACTTCCCCTCAGAAGGTAGG - Intronic
968550815 4:1222663-1222685 TCGGGATGCCCTCAGAGGGTAGG - Intronic
970962787 4:21892367-21892389 TGCGATTACCCTCACAGGGCAGG + Intronic
974343672 4:60649454-60649476 TGGGATTTTCATCAGAGGTTGGG - Intergenic
974732343 4:65884677-65884699 CTGGATTACCCTCAGAGGAAAGG + Intergenic
974838458 4:67277024-67277046 TGGGGTTTCCCCCAGAGGTTAGG + Intergenic
978294148 4:107183516-107183538 TGGGATTTCCATCAGGAGGTAGG - Intronic
984818227 4:183857828-183857850 TGGGGATACCCTCAGAGGCATGG - Intronic
987144053 5:14974449-14974471 TGTGATTACCTTCAGAGAGGAGG + Intergenic
990753419 5:59041630-59041652 TGGGAGTCCCCTCTGAGGTTCGG + Intronic
991141609 5:63250599-63250621 TGGGCTAACTCTCAGAAGGTGGG - Intergenic
992241802 5:74778330-74778352 TGGGATTACCTTCTAAGGTTTGG - Exonic
997853871 5:137356074-137356096 TGAGCTCACCCTCAGAGGGTGGG + Intronic
998891561 5:146751757-146751779 GGTGATTGCCCCCAGAGGGTGGG + Intronic
1000997375 5:167973335-167973357 TGGGATTACCAACAGGAGGTGGG - Intronic
1001221665 5:169905550-169905572 TGACATTACCCTCAGAGAGGTGG - Intronic
1003877331 6:10450473-10450495 TGGGGTTTGCCTCAGAGGGGCGG + Intergenic
1007230638 6:40345468-40345490 TGGGAAAACCCGCAGAGGGCAGG + Intergenic
1020595436 7:10202460-10202482 TGGGATTTACCTCAGGGGGAAGG + Intergenic
1027304305 7:76876491-76876513 TGGGATTACCCTTAAAGAATAGG - Intergenic
1033771025 7:144551930-144551952 TGCCATTAGCCTCAGAGTGTAGG - Intronic
1034419418 7:150981140-150981162 TGGGGTTACCCACAGGGGATTGG + Intergenic
1035527013 8:321820-321842 TGTGCTTGTCCTCAGAGGGTGGG - Intergenic
1037591437 8:20315498-20315520 TGGGGTTACCATGAGTGGGTGGG + Intergenic
1042393973 8:68269423-68269445 TAGGAGTACCCTGAGAGAGTGGG + Intergenic
1046659506 8:116933977-116933999 TGGCATTTACCTCATAGGGTTGG + Intergenic
1047689035 8:127331788-127331810 TGGGATTACACTCTGAGAGCAGG - Intergenic
1050993261 9:12179443-12179465 AGAGATTACCCTCAGAGGGTGGG - Intergenic
1052936609 9:34098553-34098575 TGGGATTTCCCATAGAGGGGTGG - Intronic
1059062597 9:111049181-111049203 TGAGATTACGTTCAGAAGGTGGG - Intergenic
1059763315 9:117360114-117360136 TTGGATTACACTCTGAGGTTAGG + Intronic
1187442351 X:19331881-19331903 TGGGAGGACCCTCCAAGGGTAGG - Intergenic
1187834286 X:23415475-23415497 TGGGATTACCCTCAGAATCTCGG + Intergenic
1190216365 X:48481855-48481877 TGGGATTTCCATCAGAGAATGGG - Intronic
1192420788 X:71028339-71028361 TGGGCTTAGGCTGAGAGGGTGGG + Intergenic
1198704853 X:139437425-139437447 TCGGGTTACCCACAGAGGGAAGG + Intergenic
1201690943 Y:16763797-16763819 TCGGATTACCCACAAAGGGAAGG + Intergenic
1201729236 Y:17187351-17187373 TGGGGGTTCCCTCAGAGGTTAGG + Intergenic