ID: 1097202020

View in Genome Browser
Species Human (GRCh38)
Location 12:57287189-57287211
Sequence GTAATCCAGCTGACCAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097202018_1097202020 30 Left 1097202018 12:57287136-57287158 CCATGTAAACTTGGGCTAGCCAC 0: 1
1: 0
2: 2
3: 17
4: 193
Right 1097202020 12:57287189-57287211 GTAATCCAGCTGACCAAATTAGG 0: 1
1: 0
2: 0
3: 3
4: 90
1097202019_1097202020 11 Left 1097202019 12:57287155-57287177 CCACTTAAATCTCTCTGCTTTTG 0: 1
1: 0
2: 6
3: 49
4: 553
Right 1097202020 12:57287189-57287211 GTAATCCAGCTGACCAAATTAGG 0: 1
1: 0
2: 0
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097202020 Original CRISPR GTAATCCAGCTGACCAAATT AGG Intronic
903564991 1:24258600-24258622 GTATTCCAGCTGACCTGAATAGG + Intergenic
905276125 1:36819372-36819394 ACAATCCAGCTGAGCAAGTTGGG - Intronic
906623629 1:47306659-47306681 GTATTCCAGAATACCAAATTTGG - Intronic
907063285 1:51452727-51452749 CTAATAAAGCTGATCAAATTTGG - Intronic
910274297 1:85431672-85431694 GTAATGCATCTGACCCTATTAGG + Intronic
911572851 1:99538851-99538873 CTAATTCATGTGACCAAATTAGG + Intergenic
911727964 1:101262321-101262343 GTAATCCAGGTGAACAAAAAAGG - Intergenic
911882981 1:103265205-103265227 GTAATACCGTTCACCAAATTAGG - Intergenic
919948701 1:202342151-202342173 GTCATCCGGCAGTCCAAATTCGG + Intergenic
921817369 1:219579124-219579146 ATAGTCCATCAGACCAAATTAGG + Intergenic
922447665 1:225711259-225711281 GTCATCCACTTCACCAAATTTGG - Intergenic
922488377 1:225994782-225994804 GCTATCCAGCTGAACAAAGTGGG + Intronic
922908001 1:229190409-229190431 GTAATCCAGCCTTCCACATTTGG - Intergenic
1064032016 10:11888660-11888682 GGACTCCCGCTGACCAAATCTGG + Intergenic
1068652320 10:59536274-59536296 GTACTCCAGCTGTGCAACTTTGG - Intergenic
1068779856 10:60907762-60907784 GAAATCCAGCTCACCAATGTAGG + Intronic
1076191069 10:128483814-128483836 CTAATAAAGCTGACCAAACTGGG - Intergenic
1083521829 11:63320893-63320915 GTAATCCAGCTGAGCTCCTTGGG + Intronic
1086977627 11:93154361-93154383 GAAATCCAGAATACCAAATTAGG + Intronic
1090294800 11:125578071-125578093 GAAATCCAGAAGACCAAATGCGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1095738569 12:45584553-45584575 GTAATGCAGCTGTCCACTTTTGG - Intergenic
1097202020 12:57287189-57287211 GTAATCCAGCTGACCAAATTAGG + Intronic
1098713218 12:73793894-73793916 GTAAACCATCTGAAAAAATTAGG + Intergenic
1100383607 12:94085079-94085101 ATGATCCAGCAGAACAAATTGGG + Intergenic
1102814284 12:115850844-115850866 GTTATCCTTCTGACCTAATTTGG - Intergenic
1106690430 13:32109509-32109531 TTTATCCAGATGAACAAATTGGG + Intronic
1118948988 14:70416985-70417007 GCACTCCAGCTGACCCAAGTAGG - Exonic
1129364354 15:75045066-75045088 GAAGTCCAGCTGTCCAAAGTGGG + Intronic
1140014932 16:71173170-71173192 GAAATTCAGCTGTCCAATTTTGG - Intronic
1142507416 17:373623-373645 GGAATCCAACTGTCCAAATGGGG + Intronic
1145122976 17:20277326-20277348 GTAAGCCATCTTACCCAATTAGG - Intronic
1152989185 18:347328-347350 TTATTCCAGGTGACCAAACTGGG - Exonic
1153597657 18:6744372-6744394 ATAATCCAGATGAAGAAATTGGG - Intronic
1158197810 18:54908579-54908601 GTAATTCAGATGAGGAAATTAGG - Intronic
1158248760 18:55462975-55462997 GTAATCAAGCTGTCAAAATGAGG - Intronic
1159206727 18:65263436-65263458 GCAATCCACCTGAACAAATAAGG + Intergenic
1161886229 19:6998217-6998239 CTATTCCAGTTGACCAACTTGGG + Intergenic
929445805 2:42000188-42000210 CTAATCTAGACGACCAAATTAGG - Intergenic
933472144 2:82739660-82739682 GTAATCCAGATGCCCAAAGGAGG + Intergenic
943534971 2:189137452-189137474 TCAACCCAGCTCACCAAATTTGG - Intronic
943537106 2:189166438-189166460 GAAATTCAGCTGGCCAAGTTAGG + Intronic
945418470 2:209604313-209604335 CTAATCCAGATGAGCTAATTTGG + Intronic
946967581 2:225054209-225054231 GTCATCCAACTGATCAAAATTGG - Intergenic
947297457 2:228647735-228647757 TTAATCCAGATTAACAAATTAGG - Intergenic
1168819879 20:765614-765636 GTCATCCAGCTGGCCAACATCGG - Exonic
1170504053 20:17005747-17005769 TTCCTCCAGTTGACCAAATTGGG + Intergenic
1170817389 20:19725640-19725662 GTAAGCCATCTGAACAACTTTGG - Intergenic
1171132716 20:22668762-22668784 GAAACTCAGCTGACAAAATTGGG - Intergenic
1173950138 20:46985895-46985917 GTTAGCCAACTGACCAAATGTGG - Intronic
1177355734 21:20004458-20004480 GTTATCCTGCTGACCAAAACTGG + Intergenic
1177468294 21:21519341-21519363 GTAATCCAGATGAAAAAAGTTGG + Intronic
1177779762 21:25609346-25609368 GTCCTCCCGCTGTCCAAATTTGG + Intergenic
1181767213 22:25100458-25100480 ATAATCCAGCTGACACAAATGGG + Intronic
949285671 3:2401080-2401102 GTAATACAGGTGATCAAAGTGGG - Intronic
951545388 3:23819642-23819664 TTAAACCATCCGACCAAATTAGG - Intronic
953999880 3:47547681-47547703 TTAATGCATCTGACCAAGTTAGG + Intergenic
962255243 3:133865959-133865981 TCAATCCAGCTAACCAAATCTGG - Intronic
964576087 3:158170148-158170170 ATAAGCCAGGTGAACAAATTAGG - Intronic
967699086 3:192570559-192570581 TAAATCCAGCTAACCAAATTTGG - Intronic
973589050 4:52421972-52421994 ATAATCCAGCTGTCCAAACATGG - Intergenic
977730073 4:100340592-100340614 GTATTCCTGCTGACCATACTCGG - Intergenic
977988269 4:103411545-103411567 ATTTTCCAGCTTACCAAATTTGG + Intergenic
979323809 4:119355385-119355407 GGAATCCAGCTTATAAAATTTGG - Intergenic
983241646 4:165240059-165240081 GGAATCCAGCTTATAAAATTTGG - Intronic
984249267 4:177311806-177311828 GAAATCCAGGTGACAAATTTGGG + Intronic
986479796 5:8175191-8175213 GTAATTCAGCTGAACTAAATGGG + Intergenic
991202614 5:64011768-64011790 GTCAACCAGCTTCCCAAATTAGG + Intergenic
998638986 5:143987777-143987799 GTAATCCAAGTCACCAAAATAGG - Intergenic
999206611 5:149852947-149852969 AAAATCCAACTGCCCAAATTTGG + Exonic
1000025992 5:157359663-157359685 GAAATTCAGATGACCATATTTGG - Intronic
1003692670 6:8370096-8370118 ACAAGCCAGCTGACCAAAATAGG + Intergenic
1012330657 6:97981570-97981592 GTGATGGAGCAGACCAAATTTGG - Intergenic
1020834593 7:13133387-13133409 GTAACCTAGCTGTCCATATTAGG - Intergenic
1021242380 7:18219511-18219533 GTAAGCCATCTGCCAAAATTTGG + Intronic
1022983739 7:35629100-35629122 GTGAGCCAGCTGGCCAAATTGGG + Intergenic
1026042951 7:66884024-66884046 GTATACCAGCTGACTAAATGGGG + Intergenic
1028910463 7:96202127-96202149 GTAATGCAACTGAACAATTTTGG - Intronic
1029233500 7:99091727-99091749 GTAATCCAACTGACTAATCTTGG - Intronic
1033384397 7:140857772-140857794 GGACTCCTACTGACCAAATTTGG + Intronic
1033838526 7:145345192-145345214 GTATTCCAGTTGACCAAACATGG - Intergenic
1041314617 8:56547911-56547933 GGAATACAGCTGATCAAGTTGGG - Intergenic
1041773976 8:61504002-61504024 GTATTCCAGCTGAAGAAAATGGG + Intronic
1042399252 8:68327177-68327199 GAAGTCCAGTTGACCCAATTAGG - Intronic
1043583278 8:81737868-81737890 GTATTCCAGAAGACCAAATTTGG - Intronic
1046095684 8:109557674-109557696 GGAATCCAGGTGACTAAACTGGG + Intronic
1046283440 8:112063850-112063872 GTAGTCCATCTGACTGAATTAGG + Intergenic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1050259700 9:3828479-3828501 GTAATGCAGCTCACCAAGTGAGG + Intronic
1052726863 9:32239066-32239088 GTCAGACAGCTGGCCAAATTTGG - Intergenic
1055368227 9:75569230-75569252 GACATCCAGCTGACAAGATTAGG + Intergenic
1055492609 9:76821105-76821127 GTAGTCTAGGTGACCAACTTAGG - Intronic
1056579627 9:87881328-87881350 TTAACCCAGTTGACCACATTAGG + Intergenic
1059977321 9:119731356-119731378 TTAATACAGATGAGCAAATTTGG - Intergenic