ID: 1097202957

View in Genome Browser
Species Human (GRCh38)
Location 12:57295194-57295216
Sequence ATGTCTCTCTAGGGCTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 108}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097202947_1097202957 25 Left 1097202947 12:57295146-57295168 CCCAAGGAGTTCCAGGCCAAATG 0: 1
1: 0
2: 1
3: 13
4: 158
Right 1097202957 12:57295194-57295216 ATGTCTCTCTAGGGCTAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 108
1097202950_1097202957 9 Left 1097202950 12:57295162-57295184 CCAAATGAGATCACCTAGCAAAC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1097202957 12:57295194-57295216 ATGTCTCTCTAGGGCTAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 108
1097202949_1097202957 14 Left 1097202949 12:57295157-57295179 CCAGGCCAAATGAGATCACCTAG 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1097202957 12:57295194-57295216 ATGTCTCTCTAGGGCTAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 108
1097202951_1097202957 -4 Left 1097202951 12:57295175-57295197 CCTAGCAAACCTCAGCACCATGT 0: 1
1: 0
2: 3
3: 13
4: 245
Right 1097202957 12:57295194-57295216 ATGTCTCTCTAGGGCTAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 108
1097202948_1097202957 24 Left 1097202948 12:57295147-57295169 CCAAGGAGTTCCAGGCCAAATGA 0: 1
1: 0
2: 4
3: 44
4: 442
Right 1097202957 12:57295194-57295216 ATGTCTCTCTAGGGCTAAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097202957 Original CRISPR ATGTCTCTCTAGGGCTAAGA GGG Intronic
901572580 1:10173707-10173729 AAGTCTCTCTACGGCAACGATGG - Intronic
902457807 1:16548385-16548407 ACATCTCTCTGGTGCTAAGAGGG - Intergenic
902475254 1:16680726-16680748 ACATCTCTCTGGTGCTAAGAGGG - Intergenic
903660518 1:24974443-24974465 ATTTTTCTCTGGGGCTAGGAAGG - Intergenic
907399814 1:54218031-54218053 GTCTCTCTCTCGGACTAAGAAGG - Intronic
912783931 1:112580542-112580564 ATGCCTCTCTCAGGATAAGAAGG + Intronic
915168442 1:153961861-153961883 AGGTCTCTGTAGGCCTGAGAAGG - Intronic
916204299 1:162300410-162300432 GTGCCTCTCCAGGGCTCAGAGGG - Intronic
918191705 1:182181780-182181802 AGCTCTTTCCAGGGCTAAGATGG - Intergenic
923795850 1:237154707-237154729 ATGTCCCTCTAGGGATAGGACGG - Intronic
924294127 1:242568323-242568345 ATTTCTCTCTTGGGGTATGATGG - Intergenic
1063015322 10:2070908-2070930 AGGTCTCTGTAGAGCTAAGAAGG - Intergenic
1063042321 10:2356185-2356207 GTGTGTTTCTAGAGCTAAGAGGG + Intergenic
1065072486 10:22040288-22040310 ATCTCTCTCAAGGTCTCAGAGGG + Intergenic
1066049952 10:31624253-31624275 ATCCCTGTCTAGGGCTAGGAAGG + Intergenic
1069312249 10:67052415-67052437 ATTTCGTTCTAGGCCTAAGAAGG - Intronic
1070196693 10:74163711-74163733 CTGCCATTCTAGGGCTAAGAAGG - Intronic
1074342799 10:112651133-112651155 CTGACTTTCTAGGGCCAAGAAGG - Intronic
1074431137 10:113395798-113395820 GTGTCTCTCTAGGACTATGAGGG - Intergenic
1075623300 10:123943795-123943817 GTGTCCCTCTAGGCCCAAGACGG - Intergenic
1075698888 10:124455707-124455729 ATGTCCATCAAGGGCTATGATGG - Intergenic
1083110169 11:60398398-60398420 AGTTGTCTCTGGGGCTAAGAAGG - Intronic
1086255197 11:84867666-84867688 AGGTGTCTCTAGGACTAACATGG + Intronic
1089382771 11:118047959-118047981 AGGTGTCTCTGGGGCTCAGATGG + Intergenic
1090734932 11:129604172-129604194 ATTTATCTCTAGGGAGAAGATGG + Intergenic
1091625308 12:2116839-2116861 GTGTCTCTCAAGGGCCAGGATGG + Intronic
1094097528 12:26723919-26723941 ATGCTTCCCTATGGCTAAGAGGG + Intronic
1096240985 12:49960291-49960313 AGGGCTCTCTAGGGCTTAGAGGG - Intergenic
1097202957 12:57295194-57295216 ATGTCTCTCTAGGGCTAAGAGGG + Intronic
1098143283 12:67472467-67472489 ATTTATGTCAAGGGCTAAGAGGG + Intergenic
1098452734 12:70638347-70638369 TTGTCTCTCTTTTGCTAAGAAGG - Exonic
1100216755 12:92458315-92458337 ATGACTCTCTAGAGCCAAGAAGG - Intergenic
1101958487 12:109230870-109230892 ATGTCTCTCTGGGTCAAAAAAGG - Intronic
1104090156 12:125509575-125509597 ATATCTCTGCAGGGCTAATAAGG + Intronic
1104276954 12:127337851-127337873 ATGTCTCCCTGGGGATAGGAAGG + Intergenic
1111931782 13:94519988-94520010 ATGTCTCTCTGAGGTCAAGAAGG + Intergenic
1119008492 14:70957597-70957619 ATGGTTGTCTAGGGCTAAGGAGG + Intronic
1121286117 14:92737259-92737281 GTGTTTCTCAAGGGCTAAGCAGG - Intronic
1121718919 14:96095813-96095835 ATGGGTTTCTAGGGCTGAGATGG + Intergenic
1125368887 15:38948503-38948525 ATGTTTCTATAGGCCTCAGAAGG - Intergenic
1127000078 15:54492894-54492916 ATGTTTCTCTGGGTCTTAGAGGG + Intronic
1130836775 15:87658196-87658218 ATGTCTCTCTGGGACTTACAGGG + Intergenic
1132020301 15:98355601-98355623 ATGTCTCTGTAGGCCTAAAAAGG - Intergenic
1136013613 16:27381236-27381258 TTGTCTCTCTAGGGCTGGGATGG - Intergenic
1143101419 17:4506655-4506677 GTGTCTCTCTAGGGCTAGCGGGG + Intronic
1143398995 17:6628544-6628566 AAGTCTCTCTTGGGATATGACGG + Exonic
1143446078 17:7010416-7010438 GAGTCACTCTAGGGCTCAGATGG - Exonic
1144018148 17:11216498-11216520 CTCTATCTCTAGGACTAAGATGG - Intergenic
1149083482 17:52685802-52685824 ATGACACTCTATGGCTAACAGGG - Intergenic
1149092196 17:52797271-52797293 ATGTGTCTGTAGGGATAAAAGGG - Intergenic
1152273363 17:79338805-79338827 ATTTGTCTCCAGGGCTAACAAGG - Intronic
1153056761 18:953260-953282 CTGTCCTTCTAGGGCTAAGTGGG - Intergenic
1153569464 18:6454291-6454313 ATGCCTCTCAATGTCTAAGAAGG + Intergenic
1159216906 18:65404060-65404082 ATGTGTATCCAGGGTTAAGAAGG + Intergenic
1161057618 19:2198504-2198526 CTGTCTCTCTGGGGCTGAGTGGG + Intronic
1161917043 19:7236429-7236451 ATGTCTCTCAACAGCTAAAATGG + Intronic
1163033915 19:14560969-14560991 ACCTCTCTCTAGGCCTCAGAAGG - Intronic
1164422102 19:28103446-28103468 ATGTCCTTCTAGAGCTGAGATGG + Intergenic
1167573426 19:50305151-50305173 AGATCTCTCTGGGGCTAAGGTGG + Intronic
927386024 2:22534610-22534632 ATGTCTCTCTATGGAGTAGATGG - Intergenic
935788549 2:106570626-106570648 ATCTCCCTCTAGGGCTAAAGTGG - Intergenic
942560863 2:177217087-177217109 ATGTCTCTCCAGGGGAAAAAGGG - Intronic
944862671 2:203829624-203829646 ATGTCTCTGTAGGGTTCAGTTGG + Intergenic
947698232 2:232210866-232210888 CTGCCTCTCTAGGGCTGAGCTGG + Intronic
948422865 2:237871238-237871260 CTGTCTCTCTAGGGGTCAGCTGG - Intronic
948992753 2:241563116-241563138 ATGCCTCTCCAGGGCAGAGATGG - Intronic
1168851090 20:977721-977743 AGGACTCCCCAGGGCTAAGAAGG + Intronic
1169049275 20:2562307-2562329 ATGTCTCTGTTGGGCTGTGAGGG - Intronic
1180016730 21:45091556-45091578 ATCTCTGTCTATGGCTCAGAGGG + Intronic
952887842 3:38022399-38022421 ATGTCCCTCTAAAGCTGAGAGGG + Intronic
953831015 3:46297616-46297638 ATGGCACTCTGGGGCTAGGATGG - Intergenic
961301331 3:125924043-125924065 CTGTCACTCTGGGGCTAAGTTGG - Intergenic
976507936 4:85871168-85871190 ATTACTCTCTAGGGGTAGGAGGG + Intronic
977257263 4:94754960-94754982 ATGACTCTCTTAGGCTAAGCAGG - Intergenic
979797400 4:124863437-124863459 ATGCCTCTGTAGATCTAAGATGG + Intergenic
981405236 4:144360150-144360172 ATGGCTCTATAGTGCTGAGAAGG - Intergenic
981863339 4:149383358-149383380 ATGGCTCTCTAAGGATAATATGG + Intergenic
985723491 5:1502842-1502864 ATGTTTCTCTTGGGCTATGCTGG - Intronic
988505226 5:31816424-31816446 ATGTCTCTCCAAGGTAAAGATGG + Intronic
997232060 5:132252663-132252685 CTCTCTCTCTCGGGCTGAGAAGG + Intronic
999914502 5:156242822-156242844 AAGTCTCTGTAGGGCTCAGGTGG + Intronic
1000369890 5:160524978-160525000 ATGTCTGTCATGGGCTCAGAAGG - Intergenic
1004267658 6:14163199-14163221 ATGTCTCTCAAGGCCTTAGTGGG + Intergenic
1004957410 6:20744606-20744628 ATTTCTCTTTAAGGCTCAGATGG + Intronic
1004976609 6:20974142-20974164 TTCCCTCTCTAGGTCTAAGATGG + Intronic
1005148375 6:22719052-22719074 CTGTCTCTCTCAGTCTAAGAAGG + Intergenic
1007720904 6:43884928-43884950 ATGTCTCCCCAGGGCTGCGATGG + Intergenic
1008412435 6:51195669-51195691 ATGTCTTTATATGGCAAAGAGGG + Intergenic
1013005168 6:106065871-106065893 TTGTCTCTCTAGGGCTTAGCTGG + Intergenic
1013227876 6:108133815-108133837 CTGTCTCTCTAGGGCTTCGCTGG - Intronic
1014561320 6:122894223-122894245 ATTTCTCACTAGGACTAATAAGG + Intergenic
1018568704 6:165184678-165184700 ATGTGTCTGTAGGGATTAGATGG - Intergenic
1026407500 7:70082393-70082415 ATGTCTCCCTAGAGGAAAGAGGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028160248 7:87476265-87476287 GTGTCTCTTAAGTGCTAAGAGGG - Intronic
1029579580 7:101426642-101426664 CAGTTTCTCCAGGGCTAAGATGG + Intronic
1030450455 7:109703309-109703331 CTGACTCTTTGGGGCTAAGATGG - Intergenic
1032762509 7:134957078-134957100 ATTTCACACTTGGGCTAAGAGGG + Intronic
1033685033 7:143631316-143631338 ATGTGTCTCTGGGGCTAAGTTGG + Intronic
1033688206 7:143710535-143710557 ATGTGTCTCTGGGGCTAAGTTGG + Intronic
1033699580 7:143826305-143826327 ATGTGTCTCTGGGGCTAAGTTGG - Intergenic
1035958746 8:4113163-4113185 TTGTGTCTCTGGGGCTAGGAAGG - Intronic
1036678667 8:10854661-10854683 ATGCCTCTTTGGGCCTAAGAAGG - Intergenic
1036838885 8:12099617-12099639 ATGTCTCTGTTTGGATAAGAAGG + Intergenic
1036860673 8:12345860-12345882 ATGTCTCTGTTTGGATAAGAAGG + Intergenic
1037266599 8:17069215-17069237 AGGTCTCTCTAGGATGAAGAAGG - Intronic
1040829953 8:51665128-51665150 ATGTCTCTCTAAGGAAAGGAAGG - Intronic
1040835336 8:51724715-51724737 AGGTCTCACATGGGCTAAGATGG - Intronic
1043157406 8:76800911-76800933 ATGTCTCACCAAGGCTTAGAAGG - Intronic
1044358878 8:91258256-91258278 ATTTATCTCTAGAGCTAGGAAGG - Intronic
1050802628 9:9635103-9635125 GTGTCCATCTATGGCTAAGAAGG + Intronic
1050913767 9:11106207-11106229 ATGTCTCTCTCGGGCTTCCAGGG - Intergenic
1051245315 9:15104610-15104632 GTGTCTCTGTAGGGGAAAGAAGG - Intergenic
1052708441 9:32022249-32022271 AGGTATCTGTAGAGCTAAGATGG - Intergenic
1058607885 9:106743135-106743157 ATGTCTCCCTATGGCTAACATGG - Intergenic
1059994195 9:119893175-119893197 GTGTCTGTCCAGGGGTAAGATGG + Intergenic
1191626313 X:63274939-63274961 ATGGATCTCTAGAGCCAAGAGGG + Intergenic
1193318208 X:80089562-80089584 ATGGCTATCAGGGGCTAAGAAGG + Intergenic
1194608955 X:96017216-96017238 GGGTCTCTCTAGGGGAAAGAGGG - Intergenic
1195651829 X:107292723-107292745 ATACCACTCAAGGGCTAAGAAGG + Intergenic
1198539631 X:137623530-137623552 ATGTCTCTCCAGGTTTAACATGG + Intergenic
1199545779 X:149006090-149006112 ATGTCTCCCTAGAGCTTAGATGG - Intergenic