ID: 1097208207

View in Genome Browser
Species Human (GRCh38)
Location 12:57342310-57342332
Sequence CATTCAAGGGTGAAGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097208207_1097208215 2 Left 1097208207 12:57342310-57342332 CCCGCCCCCTTCACCCTTGAATG 0: 1
1: 0
2: 3
3: 25
4: 240
Right 1097208215 12:57342335-57342357 ATGATACTGATCCTTGCTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097208207 Original CRISPR CATTCAAGGGTGAAGGGGGC GGG (reversed) Intronic
900399538 1:2467368-2467390 CAGCCAAGGGTTAAGTGGGCGGG + Intronic
900762790 1:4484013-4484035 GATGCAAGGGTGAAGGAGGGAGG + Intergenic
900816582 1:4851844-4851866 AATTCCAGGGTGGAGGGAGCTGG - Intergenic
900873005 1:5318314-5318336 CATTCCAGAGTGATGGCGGCTGG - Intergenic
900999909 1:6143757-6143779 CATTCAAGTCTGAGGTGGGCAGG + Intronic
901574984 1:10193432-10193454 GATTATAGGGTGATGGGGGCAGG + Intergenic
904411261 1:30326212-30326234 CATTTCAGGGTGAAGGGAGTGGG + Intergenic
904727053 1:32556992-32557014 CATTCAAGGGTGAAAGGGAAGGG + Intronic
905514383 1:38551259-38551281 CATGCAAGTGTGAAGGGAGCAGG - Intergenic
906922981 1:50084581-50084603 CATACAAGACAGAAGGGGGCAGG - Intronic
907117125 1:51978739-51978761 CATTCAAGTGTGATGGTGTCTGG + Intronic
908496093 1:64696385-64696407 CAGTCAAGGGTACAGTGGGCAGG + Intergenic
908651793 1:66341824-66341846 CATTCTAGGGTGTAGGGAGAGGG - Intronic
908806232 1:67936242-67936264 CACTCAAGGGTCGAGGGAGCAGG + Intergenic
909650356 1:77968860-77968882 CATTTAAGTTTGAAGGGGGGAGG - Intronic
909924506 1:81423328-81423350 CATTAGAGGGTGAATGGAGCTGG + Intronic
910019136 1:82565187-82565209 CTATAAAGAGTGAAGGGGGCGGG - Intergenic
912804154 1:112742685-112742707 CCTTCAAGGCTGAAGGGCCCAGG + Intergenic
915525945 1:156476310-156476332 GATTCAAAGGTGAATGGGGTGGG - Intronic
916281386 1:163054984-163055006 CATTCAAGAGTGAAAAGGCCTGG - Intergenic
917167602 1:172129986-172130008 GAATCAAGGGTGACAGGGGCTGG + Intronic
918113570 1:181478930-181478952 CAATCAGGTGTGAAGGGGACTGG - Intronic
920743536 1:208603878-208603900 CATTCAAGGCTGTAGGGGAGTGG + Intergenic
922801539 1:228366897-228366919 CAGTCCAGGGGAAAGGGGGCTGG - Intronic
1064307249 10:14178537-14178559 TGTTGCAGGGTGAAGGGGGCAGG + Intronic
1066649213 10:37639423-37639445 GTTTCAAGGGAGGAGGGGGCAGG - Intergenic
1067694117 10:48523389-48523411 CAGTCAAGGGTTAAGTCGGCCGG + Intronic
1067792693 10:49299798-49299820 CATTCAGGGCTGAGGGAGGCTGG + Intronic
1067803393 10:49376064-49376086 CAATACAGGGTGTAGGGGGCTGG + Intronic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1071259113 10:83903502-83903524 CATTAAAGGTTGCAGGGGGCAGG - Intergenic
1072565384 10:96612709-96612731 CATCAAAGGCTGATGGGGGCTGG + Intronic
1074883650 10:117678005-117678027 CAGTCAAGGGTGAGGGTGGAAGG + Intergenic
1075934877 10:126331805-126331827 CATTCAAGCGAGAAGGGTTCTGG + Intronic
1076090474 10:127681225-127681247 GATTCATTGGTGAAAGGGGCAGG + Intergenic
1076902992 10:133348954-133348976 CAGTCAAGGGTGTCTGGGGCAGG - Intronic
1077550063 11:3196280-3196302 CATGCAGGAGAGAAGGGGGCCGG + Intergenic
1078252504 11:9627942-9627964 CATTCAAGAGTGTTGGGGGTAGG - Intergenic
1078499909 11:11861390-11861412 CATTCAAAGTTGGATGGGGCCGG - Intronic
1079033452 11:17002567-17002589 CATTTGAGGCTGATGGGGGCAGG - Intronic
1079252902 11:18800416-18800438 CTTGGAAGGGTGAAGGGGGTGGG + Intergenic
1079527940 11:21413334-21413356 CACTCAAGGGTGCTGGGGGTGGG + Intronic
1080504819 11:32902133-32902155 CATTCTTGGGTGAAGGAGTCGGG + Intronic
1083264304 11:61539212-61539234 CAGTCAAGGCTGAACGGGGAGGG + Intronic
1084603526 11:70160154-70160176 CATGCAAGGGTGCAGAGGGCAGG - Intronic
1085574732 11:77591967-77591989 TATAGAAGAGTGAAGGGGGCCGG + Intronic
1086054413 11:82630132-82630154 CAATAAAGGATGAAGGGGCCAGG + Intergenic
1087582481 11:100075705-100075727 AATTCAAGGGAGAAGGGAGAAGG + Intronic
1089183455 11:116598713-116598735 CATGAAAGGGAGAAGGGGCCTGG + Intergenic
1089209308 11:116789847-116789869 CATTCAAGGGTGAGGGAGTAGGG - Exonic
1090640632 11:128726343-128726365 AATCCAGGGGTGCAGGGGGCTGG + Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091772461 12:3161883-3161905 CATTCAAGGCTGCAGTGAGCTGG - Intronic
1097208207 12:57342310-57342332 CATTCAAGGGTGAAGGGGGCGGG - Intronic
1097500787 12:60398715-60398737 CTTTCAAAGGTCAAGGTGGCAGG + Intergenic
1098081119 12:66786603-66786625 CACTCAAGGGTGAATGTTGCTGG + Intronic
1102454658 12:113064030-113064052 CTCTCAAGGGAGAAGGGGGAAGG - Intronic
1103327044 12:120128647-120128669 CTTTCAAGGCTGCTGGGGGCTGG + Intronic
1103983344 12:124750922-124750944 CTTTCTGGGGTGAAGGGGGCGGG + Intergenic
1105042433 12:132970936-132970958 TATTAAAGGGTTAATGGGGCCGG + Intergenic
1105479102 13:20756985-20757007 CATTGGAGGGTGAAGAGGGTGGG - Intronic
1105833873 13:24191943-24191965 CATTGAAGGGTGAACAGTGCAGG + Intronic
1106111036 13:26777131-26777153 CAATCATGGGTGAAGAGGGAAGG + Intergenic
1106181251 13:27371635-27371657 CAAGCAAGGGTGAAGGGTACGGG - Intergenic
1106878841 13:34106805-34106827 CATTGAGGGGTGAAGTTGGCGGG - Intergenic
1108212952 13:48156815-48156837 CATTGAAGGGTGAATAGAGCAGG - Intergenic
1110933759 13:81257188-81257210 CAATCATGGTTGAAGGTGGCAGG + Intergenic
1111459414 13:88519977-88519999 CTTAAAAGGGTGAAGGTGGCCGG + Intergenic
1114410632 14:22497284-22497306 GGTTCAAGGGTGAAGGTGGGGGG - Intergenic
1116578348 14:46605184-46605206 CATTCAAGTGAGAAGGGGCTGGG + Intergenic
1119591591 14:75893520-75893542 CATTCAAGAGTGAAGGCGGCTGG + Intronic
1121562004 14:94882818-94882840 CAGGCAAGGGTGGTGGGGGCGGG - Intergenic
1123161420 14:106282034-106282056 AATGCAAGAGTGAAGGAGGCTGG + Intergenic
1124128064 15:26956655-26956677 CATTTAAGAGTAAATGGGGCGGG + Intergenic
1125286263 15:38095852-38095874 GATTCAAGGGAGAAGGAGGAAGG - Intergenic
1127191750 15:56538501-56538523 GTTTCCAGGGTGAAGGGGGAGGG - Intergenic
1128346334 15:66854738-66854760 CATTCACTGGGGAAGGGGGAGGG + Intergenic
1128976806 15:72160307-72160329 GATGAAAGGGTGAAAGGGGCTGG + Exonic
1129999455 15:80034454-80034476 ACTTCAGGGGGGAAGGGGGCAGG - Intergenic
1130052802 15:80497873-80497895 AATTTAAGGGAGAAGGGGGAAGG + Intronic
1130466923 15:84197101-84197123 CATTCCTGGGTGCAGGGGGCTGG + Intergenic
1130497341 15:84476435-84476457 CATTCCTGGGTGCAGGGGGCTGG - Intergenic
1130554912 15:84915816-84915838 CATTAAAGGGTGAGAGGGGAAGG - Intronic
1130897733 15:88183854-88183876 CATCCAAGGGTGGAGGTAGCTGG + Intronic
1131459076 15:92605792-92605814 CATTCCAGTGGCAAGGGGGCAGG + Intergenic
1132025477 15:98401237-98401259 CAATCAAGGGTAAAGGGGCTGGG + Intergenic
1132938643 16:2495862-2495884 CATTCAAGGCTGCAGAGAGCAGG + Intronic
1133677961 16:8093358-8093380 CATGTAAGGGTGGAGGGGGCAGG - Intergenic
1135293596 16:21260883-21260905 CCTTCAGAGGTGGAGGGGGCAGG - Intronic
1135451850 16:22565351-22565373 CATTAAACGGAGATGGGGGCCGG + Intergenic
1142304678 16:89278672-89278694 GGTCCAAGGGAGAAGGGGGCGGG + Intronic
1142744132 17:1947369-1947391 CGCTGCAGGGTGAAGGGGGCCGG - Intronic
1144681764 17:17200673-17200695 CAAGGAAGGGGGAAGGGGGCAGG + Intronic
1144783232 17:17818123-17818145 CAGCCAAGGGTGAGGTGGGCAGG + Intronic
1146768773 17:35548909-35548931 CATCCAAAGGCGAAGGGGACTGG - Exonic
1147436319 17:40418436-40418458 AATTCGAGGGTAAAGGGGGCGGG - Intergenic
1148143043 17:45341924-45341946 CCTTCAGGAGTCAAGGGGGCAGG - Intergenic
1149762209 17:59242698-59242720 CATTCAAAGGTGACGAGAGCAGG + Intronic
1149891085 17:60391535-60391557 CAATGAAGGATGAGGGGGGCTGG + Intronic
1151322529 17:73360416-73360438 CATTCTTGGCTGAAGGGGGTGGG + Intronic
1153333315 18:3896853-3896875 TCTTCAAGGGAGAAGGGGGAAGG - Intronic
1157777814 18:50410016-50410038 CATTGAAGGGTGAGTAGGGCAGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160339771 18:78079713-78079735 CATTCAAGGGAGATGACGGCAGG - Intergenic
1160417713 18:78723009-78723031 CATTCAAAGCTGAAGTAGGCAGG - Intergenic
1161920455 19:7261826-7261848 CTTTCAATGGTTAAGGGGGCCGG - Intronic
1162319095 19:9960240-9960262 CTTTCCAGGGTGCTGGGGGCTGG - Exonic
1163250216 19:16122394-16122416 CATTCAGGGGTAGAGGGAGCAGG + Intronic
1165777494 19:38413279-38413301 CATTGAAGGGGGAGGGTGGCTGG + Exonic
1166098560 19:40556943-40556965 CATTGTAGGCTGGAGGGGGCTGG + Intronic
1166894833 19:46016766-46016788 CAGTCAAGGCAGCAGGGGGCTGG - Exonic
1167292934 19:48634637-48634659 CCTTCAAGCGCGAGGGGGGCGGG - Intronic
1167381660 19:49142012-49142034 CCTGTAAGGGTGAAGGGGCCAGG - Exonic
1167792494 19:51690504-51690526 CCTCCAGGGGTTAAGGGGGCGGG + Intergenic
925097268 2:1216974-1216996 CAATGAAGGGTGAAGGGTGAAGG - Intronic
925851775 2:8088712-8088734 CATTCCAGAGGGAAGGAGGCAGG + Intergenic
926311624 2:11679785-11679807 CTCTGAAGGGTGATGGGGGCCGG + Intronic
927255267 2:21035772-21035794 CCTTCAAGGTAGAAGGGAGCAGG + Intronic
928136789 2:28693795-28693817 CATCCAAGGGGGAAGGAGGATGG - Intergenic
933726445 2:85430163-85430185 GAGTCAAGGGTGCAGGGGACAGG + Intronic
934122755 2:88855905-88855927 CATTCAGGGCTCAAGAGGGCAGG + Intergenic
936913537 2:117616574-117616596 CCTTTAAAGGTGAGGGGGGCGGG - Intergenic
938000906 2:127736015-127736037 GAATCATGGGTGAAGGGGTCCGG + Intronic
941876341 2:170437370-170437392 GCTTCAAGGGAGAAGGGGGTGGG - Intronic
942471806 2:176268688-176268710 CTTTCGGGGGTGAACGGGGCAGG - Intergenic
945006862 2:205417741-205417763 CAGTGAAAGGTTAAGGGGGCTGG - Intronic
945945841 2:215994845-215994867 CATGCAAATGTGAAAGGGGCTGG - Intronic
946242767 2:218367161-218367183 CCTTCCAGGATGCAGGGGGCTGG + Intronic
946281817 2:218671532-218671554 GATCCAAGGGGAAAGGGGGCCGG + Intronic
948532240 2:238616668-238616690 CATTCCAGGAAGAAGGGGGTGGG - Intergenic
1168797751 20:622830-622852 CATTCTAGGGTGGACGGGGTGGG - Intergenic
1168828892 20:833685-833707 CATTCTGGTGTGAAGGGGGGCGG + Intergenic
1169021850 20:2336227-2336249 CAGCCCAGGGTGAAGGGTGCTGG + Intronic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1169720776 20:8674041-8674063 CATTTAAGGGGGGAGGGAGCTGG - Intronic
1171438404 20:25141515-25141537 CACTCCAGGGGGCAGGGGGCAGG + Intergenic
1171447921 20:25217746-25217768 CATTAAAGGATGAAGGAGGAGGG - Intronic
1172489837 20:35327157-35327179 CAATGAAGAGTGAAAGGGGCGGG + Intronic
1173189242 20:40863529-40863551 CATTCATGGGTTCAGGGGGTGGG - Intergenic
1174035498 20:47666049-47666071 AAGTCGAGGGTGAAGGGGACAGG - Intronic
1174035538 20:47666221-47666243 AAGTCGAGGGTGAAGGGGACAGG - Intronic
1174137365 20:48389473-48389495 CATCCAAGGGTGAAGAAGGCAGG + Intergenic
1174814835 20:53677829-53677851 CAATCAAAGGGGGAGGGGGCAGG - Intergenic
1175660105 20:60804987-60805009 CATTCAAGGTTTCAGGGGGAGGG - Intergenic
1175802472 20:61808785-61808807 CAGTCAAAGGTGGAGGGGGCAGG - Intronic
1176424709 21:6541040-6541062 CATTCATGGGTGCTGGGGACGGG + Intergenic
1179700198 21:43149349-43149371 CATTCATGGGTGCTGGGGACGGG + Intergenic
1180979872 22:19873391-19873413 CACTCAGGGGTGTTGGGGGCAGG + Intergenic
1181596360 22:23917472-23917494 CACTCAAGAGTGAAGAGGCCAGG + Intergenic
1183540325 22:38426175-38426197 CATCCAAGGGCCAAGGTGGCTGG + Intergenic
1184099850 22:42336340-42336362 CATCCAAGGGGAGAGGGGGCGGG - Intronic
952827670 3:37537657-37537679 CATTCTAGTGGGAGGGGGGCAGG + Intronic
953388860 3:42523056-42523078 CATGCAACAGTGAAGGGGTCAGG - Intronic
953415308 3:42712258-42712280 CATTCCAGCCTGGAGGGGGCTGG + Intronic
954774825 3:53007313-53007335 GATACAACGGTGAAGGTGGCAGG - Intronic
955534084 3:59904704-59904726 CATTGAAGGGTGAGGAGGGCAGG + Intronic
960044429 3:113183046-113183068 CATTCAGGGTTGCAGGAGGCTGG + Intergenic
960092698 3:113657615-113657637 CTTTCAAGCCTGAGGGGGGCTGG + Exonic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961064875 3:123866856-123866878 CATTGAAGGGTGAGGAGGGAGGG - Intronic
961745740 3:129062545-129062567 CAGTTAAGGGTGAAGGGTGGGGG - Intergenic
961958081 3:130824877-130824899 CAGTCAAGGGGCAAGGGAGCTGG - Intergenic
962343754 3:134605344-134605366 CACTCAACTGTGAACGGGGCTGG - Intronic
963071877 3:141311476-141311498 CATCCAAGGGGGAAGGGGTGTGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966624816 3:182004650-182004672 GATTCATGGGGGAAGGGGGTAGG - Intergenic
966743965 3:183258260-183258282 GCTTAAAGGGTGAAGTGGGCCGG - Intronic
967720184 3:192807948-192807970 CCATCAAGGGTGAGTGGGGCGGG + Intronic
967741726 3:193010441-193010463 CTGTCAAGGCTGAAGGGGACAGG + Intergenic
968944193 4:3654991-3655013 CATTCCAGGATGGTGGGGGCAGG + Intergenic
968960857 4:3742888-3742910 CATTCAAGAGTGAAGGGCTGAGG + Intergenic
971174462 4:24267423-24267445 CATTTAAGGGTGAAGGGGAAAGG - Intergenic
971194067 4:24455183-24455205 CATTAAAGAATGAATGGGGCCGG + Intergenic
971233678 4:24821650-24821672 GATTCAAGGATGAAGGAGACTGG + Intronic
974832925 4:67211394-67211416 CAGTCAGGGGTGGAGGGGGTGGG + Intergenic
975590173 4:75991686-75991708 CATACAAGGGAAAAGAGGGCTGG + Intergenic
981205058 4:142031213-142031235 CATTCAGTGGTTAAGGGGGTGGG + Intronic
981321497 4:143396846-143396868 CACTCAAGGGTGCAGTGGTCAGG + Intronic
982277139 4:153647561-153647583 CACTCAAGGGGGAAGGAGGCTGG + Intergenic
987842936 5:23244466-23244488 CAATCATGGGTGAAGGGTGAAGG + Intergenic
988751638 5:34193513-34193535 CTTGCAGGTGTGAAGGGGGCAGG - Intergenic
991736954 5:69636259-69636281 CTTGCAGGTGTGAAGGGGGCAGG - Intergenic
991739389 5:69654292-69654314 CTTGCAGGTGTGAAGGGGGCAGG - Intergenic
991758111 5:69898887-69898909 CTTGCAGGTGTGAAGGGGGCAGG + Intergenic
991788527 5:70215983-70216005 CTTGCAGGTGTGAAGGGGGCAGG - Intergenic
991790964 5:70234033-70234055 CTTGCAGGTGTGAAGGGGGCAGG - Intergenic
991813279 5:70491088-70491110 CTTGCAGGTGTGAAGGGGGCAGG - Intergenic
991816411 5:70512369-70512391 CTTGCAGGTGTGAAGGGGGCAGG - Intergenic
991818851 5:70530409-70530431 CTTGCAGGTGTGAAGGGGGCAGG - Intergenic
991837514 5:70774769-70774791 CTTGCAGGTGTGAAGGGGGCAGG + Intergenic
991880975 5:71216347-71216369 CTTGCAGGTGTGAAGGGGGCAGG - Intergenic
991883412 5:71234368-71234390 CTTGCAGGTGTGAAGGGGGCAGG - Intergenic
994486483 5:100390223-100390245 CTTTCAGCTGTGAAGGGGGCAGG - Intergenic
994486655 5:100391042-100391064 CTTTCAGCAGTGAAGGGGGCAGG - Intergenic
995833251 5:116376514-116376536 GATTCAAGGGAGCAGGGGGCAGG + Intronic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
997308804 5:132862282-132862304 CACTAAAGGTTGAAGGAGGCTGG + Exonic
997806987 5:136927893-136927915 AATTCTAGGGTGAAGGGGAATGG - Intergenic
1000632191 5:163603250-163603272 CAGTCAAGGGGGAAGGATGCTGG + Intergenic
1001535637 5:172496015-172496037 CATTCACTGGTGAAGGTGGGAGG - Intergenic
1002190863 5:177476830-177476852 CATGCAGGGGTGAGGTGGGCTGG + Intergenic
1006408361 6:33857902-33857924 GATTCAGGTGTGGAGGGGGCTGG - Intergenic
1006848161 6:37077785-37077807 CCTTTTAGGCTGAAGGGGGCAGG - Intergenic
1006991728 6:38220856-38220878 CATGCATGGGTGGAGGGAGCTGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1009690942 6:67031246-67031268 CATTGAGAGGTGAAGCGGGCTGG + Intergenic
1011994303 6:93565912-93565934 CATTAAAGAGTGAAGTCGGCCGG + Intergenic
1012795226 6:103750950-103750972 CTTTGAAGGGTGAATAGGGCAGG - Intergenic
1013067807 6:106700458-106700480 CATTCAAGGGAGAAGGGCGAGGG - Intergenic
1015973363 6:138764780-138764802 AATTAGAGGGTGAAGGGGCCTGG + Intronic
1016183538 6:141175290-141175312 CATTGAAAGGTGAAGCCGGCTGG + Intergenic
1016869711 6:148804457-148804479 CATGCAAGGGTGAAGTGGTCTGG + Intronic
1016901620 6:149108573-149108595 GATTGAAGGGTGAAGTGGGAGGG - Intergenic
1017044457 6:150334222-150334244 CAAACAGGGGTGAGGGGGGCGGG + Intergenic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1019647810 7:2140348-2140370 CCCTGAAGGGTGAAGGGTGCCGG + Intronic
1019788382 7:2994088-2994110 CATGCATGAGTGAATGGGGCTGG - Intronic
1020406730 7:7843903-7843925 CAGGCAAGGGTGCAGGGGCCAGG - Intronic
1020670629 7:11104755-11104777 AACTCCAGGGTGAAGGGGGAGGG - Intronic
1021647664 7:22802265-22802287 CATTGAAGGCTGAGGAGGGCTGG - Intergenic
1022326515 7:29336996-29337018 CATGCAAGGGTGGTGGGTGCCGG - Intronic
1022670328 7:32449461-32449483 CAATCATGGGGGAAGGGGGATGG - Intergenic
1022758903 7:33326242-33326264 GATTCAAGGGAGAAGAGGGGAGG - Intronic
1022806645 7:33829264-33829286 CACTGAAGGGCGAAGGGGGATGG - Intergenic
1022809381 7:33853970-33853992 CATCCAAGGGTGACAGGGTCTGG - Intergenic
1022887494 7:34661576-34661598 AATTCAAGGGTGGAGGTGGGAGG - Intronic
1023165579 7:37340286-37340308 TGTTCAGGGGTGAAGGGGGATGG + Intronic
1027057293 7:75058524-75058546 CATTAAAGTGTTAAGGGGCCGGG - Intronic
1030106404 7:105990901-105990923 CAATCAAGGGTGAATGGGGCAGG + Intronic
1033202757 7:139387707-139387729 CATTCAAGGGAGAAGTAGCCTGG - Intronic
1033427037 7:141253846-141253868 CCTTCAAAAATGAAGGGGGCCGG - Intronic
1033553247 7:142466457-142466479 CATTAAAAGGTGATGGAGGCTGG + Intergenic
1033790850 7:144790905-144790927 CAATCAAGGGTGAAGGGGGTGGG + Intronic
1034269353 7:149796208-149796230 CTCTCAAGGCTGGAGGGGGCTGG - Intergenic
1035161493 7:156953526-156953548 AATACAAGGGGGAAGGGGGTGGG - Intronic
1035168273 7:157004096-157004118 CATCGATGGGGGAAGGGGGCCGG + Intronic
1035851209 8:2921019-2921041 CGTTCAAGGTTCAAGGTGGCAGG + Intergenic
1036965078 8:13288733-13288755 CAATAAAGGGGGAAAGGGGCAGG - Intronic
1039179855 8:34854399-34854421 GATTCAAGGGAGAAGGGAGAAGG + Intergenic
1039251943 8:35675677-35675699 AATTCAAAGGTCAAGGGGCCTGG + Intronic
1040994136 8:53384568-53384590 CATTGAAGGGTGAGGAGGGCTGG + Intergenic
1041479802 8:58307350-58307372 CAGTCATGGCTGAAAGGGGCCGG - Intergenic
1042487341 8:69361174-69361196 TATTCAAGGGAGAAGGGAGGAGG - Intergenic
1043343369 8:79269065-79269087 TATTCAAGGGTGAAGAGGAGAGG + Intergenic
1044457058 8:92401261-92401283 CATTGAAAGGTGAAGCCGGCTGG - Intergenic
1049447881 8:142639852-142639874 CATTAAATGGTGCAGTGGGCTGG - Intergenic
1049959318 9:723210-723232 CATCCAAGGGTCAAGGTGGAAGG - Intronic
1053391345 9:37738856-37738878 CATTCAAGGCCGAGGGGGCCTGG + Intronic
1056999638 9:91495719-91495741 CTCTCAAGGGAGAAGGGGACTGG + Intergenic
1058707320 9:107648178-107648200 AAATCAAGGGTGAAGTGGCCTGG - Intergenic
1059385328 9:113959903-113959925 CGTTTAAAGGAGAAGGGGGCCGG - Intronic
1060484786 9:124040187-124040209 CATGCAGGGCTGGAGGGGGCAGG + Intergenic
1186347655 X:8710727-8710749 CATTCAAGGGAAAAGGGGTGAGG + Intronic
1186516782 X:10172180-10172202 CATTCAAGGGACAAGGGAGTAGG + Intronic
1186517754 X:10179227-10179249 CCTGCGAGGGTGAAAGGGGCCGG + Intronic
1187199482 X:17121163-17121185 CCTTCAAGGATGAAGGAGTCTGG - Intronic
1187425538 X:19174606-19174628 CACCCAAGGGGCAAGGGGGCTGG + Intergenic
1189187879 X:39069988-39070010 CATTGAAAGGTGAAGTTGGCTGG - Intergenic
1190580387 X:51888011-51888033 CAATTAAGGGTAATGGGGGCTGG + Intronic
1190946872 X:55103482-55103504 AATCCAAGAGTAAAGGGGGCTGG + Intronic
1192411483 X:70936890-70936912 CATTTAAGAGTGAAGTGGGCCGG - Intergenic
1195453951 X:105046969-105046991 TATTCAGGAGTGAAGGGAGCGGG - Intronic
1196032033 X:111101757-111101779 CATTCAATGGTGCAGTGGGTGGG + Intronic
1197300836 X:124778391-124778413 CATTGAAGGGTGAGGGGAGCAGG - Intronic
1197819772 X:130531236-130531258 CATCCAAGGCTGAAGGGGTGAGG - Intergenic
1199429233 X:147740309-147740331 CATTCAAGGGTGAGGATGGCAGG - Intergenic
1200110420 X:153738027-153738049 CATGCCAGGGAGGAGGGGGCCGG + Intronic
1201482705 Y:14457082-14457104 GATGCAATTGTGAAGGGGGCGGG + Intergenic
1201982388 Y:19922216-19922238 AATTCAAGGGTGCAGTGGCCTGG + Intergenic