ID: 1097210947

View in Genome Browser
Species Human (GRCh38)
Location 12:57369192-57369214
Sequence ATGTAGCTCCACCTCTTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097210944_1097210947 24 Left 1097210944 12:57369145-57369167 CCAGCATCTTAACACCATCAAAT 0: 1
1: 0
2: 1
3: 44
4: 422
Right 1097210947 12:57369192-57369214 ATGTAGCTCCACCTCTTAAAAGG 0: 1
1: 0
2: 5
3: 19
4: 143
1097210943_1097210947 25 Left 1097210943 12:57369144-57369166 CCCAGCATCTTAACACCATCAAA 0: 1
1: 0
2: 0
3: 12
4: 215
Right 1097210947 12:57369192-57369214 ATGTAGCTCCACCTCTTAAAAGG 0: 1
1: 0
2: 5
3: 19
4: 143
1097210942_1097210947 26 Left 1097210942 12:57369143-57369165 CCCCAGCATCTTAACACCATCAA 0: 1
1: 0
2: 1
3: 11
4: 185
Right 1097210947 12:57369192-57369214 ATGTAGCTCCACCTCTTAAAAGG 0: 1
1: 0
2: 5
3: 19
4: 143
1097210941_1097210947 30 Left 1097210941 12:57369139-57369161 CCTACCCCAGCATCTTAACACCA 0: 1
1: 1
2: 0
3: 23
4: 243
Right 1097210947 12:57369192-57369214 ATGTAGCTCCACCTCTTAAAAGG 0: 1
1: 0
2: 5
3: 19
4: 143
1097210945_1097210947 10 Left 1097210945 12:57369159-57369181 CCATCAAATGATCTCAAGTGTCA 0: 1
1: 0
2: 1
3: 20
4: 160
Right 1097210947 12:57369192-57369214 ATGTAGCTCCACCTCTTAAAAGG 0: 1
1: 0
2: 5
3: 19
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097210947 Original CRISPR ATGTAGCTCCACCTCTTAAA AGG Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
903784949 1:25854282-25854304 ATGAAGCTCCACCTCTTGAAGGG + Intronic
904441463 1:30534617-30534639 ATGTAGCTCCACCTGTTCTGGGG - Intergenic
904946760 1:34204938-34204960 ATGCATCTCCACCTCTAAAGGGG + Intronic
906658766 1:47567776-47567798 ATCTAGCTCACCCTCTTAATGGG + Intergenic
906900461 1:49830413-49830435 ATGAAGAGACACCTCTTAAAAGG - Intronic
907550228 1:55298852-55298874 ATCTAGTTCTGCCTCTTAAATGG - Intergenic
909050651 1:70763851-70763873 ATTAAGCTTCACCTCTTTAAAGG + Intergenic
909341338 1:74534871-74534893 ATGTAGTTCCTCCTTTGAAATGG + Intronic
911479322 1:98417867-98417889 ATTAAGCTCCACTTTTTAAAGGG + Intergenic
911582620 1:99651805-99651827 ACCTAGCTCTACCTCTTAAGTGG - Intronic
913056803 1:115169668-115169690 CTGTAGGACCACCTCTCAAAGGG + Intergenic
915043115 1:152985026-152985048 TTTTAGCTCCTCCTCTTCAAAGG + Intergenic
919142242 1:193587197-193587219 ATTTAGCTCCCACTCTTAAGTGG - Intergenic
920244925 1:204580243-204580265 TTCTATCTCCACTTCTTAAATGG + Intergenic
920750682 1:208672339-208672361 ATGTGGTTCTACCACTTAAAAGG + Intergenic
920927081 1:210351909-210351931 ATGCTGCTCCACCTGTAAAAAGG - Intronic
1062993774 10:1846109-1846131 TTGCAGCTCCACCACTTACAGGG - Intergenic
1064026766 10:11855044-11855066 ATGTAAATGCACCTCTTAGAAGG + Intronic
1065005156 10:21373003-21373025 GTGAGGCTCCACCTCTTAAAGGG - Intergenic
1065857943 10:29845483-29845505 TTGTAGCTTCACCTCTAACATGG + Intergenic
1067746391 10:48939435-48939457 TTCTATCTCCACCACTTAAATGG - Intronic
1071915283 10:90288571-90288593 ATATAGCTCCACCTCTTGATGGG - Intergenic
1079161733 11:18001270-18001292 ATTAAGCTCCACATCTTGAAGGG - Intronic
1080600229 11:33815600-33815622 ATCTAACTTCACATCTTAAATGG + Intergenic
1081711189 11:45216568-45216590 ATTTAGCTTTACCTCTTAAATGG + Intronic
1082192601 11:49265727-49265749 ATGTACCTCCATTTCTTAATAGG + Intergenic
1084054470 11:66623526-66623548 ATGTATGTCCACCTGTTAAATGG + Intronic
1084629882 11:70341104-70341126 ATCACCCTCCACCTCTTAAAGGG + Intronic
1084630486 11:70345201-70345223 ATCACCCTCCACCTCTTAAAGGG + Intronic
1085702110 11:78754851-78754873 AAGTAGCTTCACCTCTAGAAAGG + Intronic
1086673515 11:89575244-89575266 ATGTACCTCCATTTCTTAATAGG - Intergenic
1087223700 11:95574359-95574381 AAATAGCTCCACATCTTAACTGG + Intergenic
1088303283 11:108381795-108381817 ATTAAGCTCTATCTCTTAAAAGG - Intronic
1088953746 11:114597732-114597754 ATGTACCTCCATTTTTTAAAAGG - Intergenic
1089114615 11:116084562-116084584 ACATATCTCCACTTCTTAAAGGG - Intergenic
1089362038 11:117897280-117897302 ATGGAGCTCCACGACTTAGAGGG + Intergenic
1089897117 11:121941804-121941826 ATTAAGCTCCACCTCTGGAAAGG - Intergenic
1093109095 12:15127575-15127597 ATTTAACTCCAACTCTTAAGTGG + Intronic
1094116734 12:26922653-26922675 AAGTAGCTCCACATCATAATTGG + Exonic
1097210947 12:57369192-57369214 ATGTAGCTCCACCTCTTAAAAGG + Intronic
1097347432 12:58509457-58509479 ATTAAGATCTACCTCTTAAAGGG + Intergenic
1097893907 12:64805383-64805405 ATTTAGCTCTTCCTCTAAAAGGG - Intronic
1100027444 12:90147493-90147515 AGCTGGCTTCACCTCTTAAAAGG - Intergenic
1101461202 12:104896784-104896806 ATGTAGCTCCAAGCCTTAGAAGG - Intronic
1102881509 12:116488656-116488678 ATTAAGCTCCACCTTTTAAAGGG + Intergenic
1104087541 12:125490428-125490450 ATTAAGTTTCACCTCTTAAAGGG - Intronic
1106069944 13:26400626-26400648 AAGTTGCTCCTCCTCTTATATGG + Intronic
1106582805 13:31032304-31032326 TTGTAGCACAACTTCTTAAAAGG + Intergenic
1108966487 13:56311091-56311113 ACATAGCTCCACCTCTAAAAGGG - Intergenic
1109829062 13:67761881-67761903 TTGTAGCTCAATCTGTTAAAGGG - Intergenic
1111748681 13:92299150-92299172 ATGTCACTCCAACTCTTAAAAGG + Intronic
1113219436 13:108082704-108082726 AAGTAGTTCCACCTCTGGAATGG - Intergenic
1113413979 13:110113773-110113795 ATGAAGCTCCATCTCCTGAAGGG + Intergenic
1114152607 14:20061632-20061654 ATGTAGCTTTACCTTTTTAAGGG + Intergenic
1115467328 14:33729817-33729839 TAGTAGCTCCACCTTTTAGAAGG + Intronic
1117941796 14:60975166-60975188 ATGAAGATCCACCTCTTAAAAGG - Exonic
1121434354 14:93909302-93909324 ATTAGGCTCCACTTCTTAAAGGG + Intergenic
1122167301 14:99837588-99837610 TTGTAGCTCCACCTTTTGATAGG + Intronic
1126314161 15:47350875-47350897 ATATAGTTCCACCTCTGAACAGG - Intronic
1126409999 15:48363546-48363568 ATGTAGCTTCACTTCTTAATGGG + Intergenic
1129760720 15:78127867-78127889 AAGTGTCTCCACCTCTAAAATGG - Intronic
1131268312 15:90931882-90931904 GTGTAGCTCCACCTCATCCAGGG + Exonic
1131821889 15:96282113-96282135 ATGTAGCATCACCACTTAGATGG - Intergenic
1133161804 16:3916893-3916915 ATGAGGCTCCACCTCTTAAAGGG - Intergenic
1137241520 16:46658902-46658924 ATTAAGCTCCACCTCTTAAAGGG - Exonic
1141572710 16:84943885-84943907 ATTAGGCTCCACCTTTTAAAGGG - Intergenic
1142128986 16:88423942-88423964 ATGAGGCTCCACCTCTTGAAGGG + Intergenic
1144456818 17:15425673-15425695 ATTAAGCTCCACCTCTGGAAGGG + Intergenic
1148018349 17:44538237-44538259 AGCTAGCTTCACCTCTCAAAAGG + Intergenic
1152016571 17:77754904-77754926 ATTAAATTCCACCTCTTAAAGGG - Intergenic
1160081865 18:75735651-75735673 AGGGAGCTTCACCTGTTAAAGGG + Intergenic
1163198804 19:15747038-15747060 GTGTGGTTCCACTTCTTAAAGGG + Intergenic
1167144724 19:47674935-47674957 ATTGAGCTCCACCTCTTGAAAGG + Intronic
931463343 2:62466749-62466771 CTGTAGCTCCCCCTCTCAGAGGG - Intergenic
932155817 2:69416198-69416220 TATTAGCTCCACATCTTAAAGGG + Intronic
933502090 2:83126244-83126266 ATAAATCTCCACCTCTTTAATGG - Intergenic
933833211 2:86226817-86226839 ATTAATCTCCACCTCTTGAAGGG - Intronic
935622667 2:105143522-105143544 ATCTGGGTCCGCCTCTTAAAGGG + Intergenic
936403472 2:112183319-112183341 CTGTAAGTCCACCTCTGAAAGGG + Intronic
937052673 2:118905205-118905227 ATGTGGCTCCACACCCTAAAGGG + Intergenic
939362744 2:141195030-141195052 ATTAAGCTTCATCTCTTAAAAGG - Intronic
942205456 2:173615796-173615818 AAGTAGCTCCACACCTAAAAAGG + Intergenic
942572213 2:177326094-177326116 ATGTAGCTTCATCTCAGAAAGGG - Intronic
946148050 2:217745613-217745635 ATCAAGCTCCACCTCTTAAATGG + Intronic
948285903 2:236785015-236785037 ATTAAGCTCCATCTCTTGAAGGG - Intergenic
1169503911 20:6187766-6187788 ATGAGGCTCTACCTCTTAAAGGG + Intergenic
1169998468 20:11586465-11586487 AAATAGCTCCACCCCTTAATGGG - Intergenic
1170172480 20:13430701-13430723 ATTGAGTTCCACCTCTTGAAGGG + Intronic
1170254993 20:14331788-14331810 ATGTAGATCCAGCTCAGAAAGGG - Intronic
1171459674 20:25291527-25291549 ATGTCGCTCCCCCTCTTTAGTGG + Intronic
1173457984 20:43219068-43219090 ATTGAGCTCCACCTCTCAAGGGG - Intergenic
1174233396 20:49066297-49066319 ATGTCGCTCCACTTTTTAGATGG + Intronic
1177715056 21:24829329-24829351 ATGAAGCTCCACCTTTTTATAGG + Intergenic
1178371965 21:32033864-32033886 ATGCAGCTCAACATCTTACAAGG - Intronic
1179435225 21:41358125-41358147 ATGTAGCACCATGTTTTAAAAGG - Intergenic
951028257 3:17852195-17852217 ATGAGGCTCCACCGCTTGAAAGG - Intronic
951711529 3:25588990-25589012 ATTAAGCTCCACCCCTTAAAGGG + Intronic
951753866 3:26067615-26067637 ATCTAGATCCAACTCCTAAAGGG + Intergenic
953196311 3:40737640-40737662 TTGTAGCTCCTCCTATTAAGCGG - Intergenic
955802455 3:62700230-62700252 ATTAAGCTCCACCTCTTGAAGGG - Intronic
957717693 3:83952002-83952024 ATATAGCTCCACCTCTTTGCAGG - Intergenic
959431211 3:106256885-106256907 ATGTGGCCCTATCTCTTAAAGGG + Intergenic
959447398 3:106457222-106457244 ATTAGGCTCCACTTCTTAAAAGG - Intergenic
966165209 3:177009015-177009037 ATTGAGCTCTACCTCTTAAGGGG - Intergenic
967540741 3:190664790-190664812 ATTCAGCTCCACCTCTTGGATGG + Intergenic
968617865 4:1588334-1588356 ATTAAGCTCCACCTCTTGAAGGG - Intergenic
971474677 4:27061403-27061425 ATCGAGCTCCACTTCTAAAAGGG - Intergenic
973985489 4:56348197-56348219 ATTAGGCTCCACCTCTTGAAAGG - Intronic
974466123 4:62258515-62258537 ATTTAGCTTTACCTCTTTAAAGG + Intergenic
975681364 4:76879897-76879919 AAGAAGCTCCAGCTCTTGAAAGG - Intergenic
976046372 4:80953041-80953063 ATATAGCTCCTCCTGTTAAAAGG - Intronic
976358065 4:84144091-84144113 ATGAAGCTCCACCTCCTGAAAGG - Intergenic
980951139 4:139378196-139378218 TAGTATCTCCACCTGTTAAATGG - Intronic
982105523 4:152008665-152008687 TTGTCCCTCCACTTCTTAAATGG - Intergenic
982428682 4:155297413-155297435 ATGTAGATGCATTTCTTAAATGG + Intergenic
993183842 5:84589889-84589911 ATTAGGCTCCACCTCTTGAAAGG - Intergenic
993706940 5:91181839-91181861 ATTAGACTCCACCTCTTAAAGGG + Intergenic
993811762 5:92488398-92488420 ATTAAGCTCCACTTCTTAGAAGG - Intergenic
993950955 5:94174649-94174671 ATGTTGTTTGACCTCTTAAAGGG - Intronic
994704899 5:103191547-103191569 ATGTAGCTATACCTCTCCAAAGG - Intronic
994872827 5:105375552-105375574 ATCTTGTTCCACTTCTTAAATGG + Intergenic
995576962 5:113547105-113547127 ATTAGGCTCCACCTCTTGAAGGG + Intronic
997238867 5:132293141-132293163 ATGTCCCTCCGCCTCTTAATCGG + Intronic
997242638 5:132319041-132319063 ATGTAAATCCACTTCTGAAAGGG + Intronic
1005208741 6:23435208-23435230 GTTTAATTCCACCTCTTAAATGG + Intergenic
1006120420 6:31801446-31801468 ATGTATCTCCCCCTCCTTAAGGG - Intronic
1008157969 6:48040352-48040374 CTGTAGCTCCACTTGTTATAAGG - Intronic
1011006649 6:82653313-82653335 ATGTAGTGCCACTTTTTAAAAGG + Intergenic
1011696858 6:89920944-89920966 ATTGAGCACCACCTCTTACATGG + Intergenic
1012144085 6:95659636-95659658 ATTAAGCTACACCTCTTGAAGGG - Intergenic
1018225577 6:161625664-161625686 ACGTAGAACCACTTCTTAAAGGG + Intronic
1018226859 6:161637040-161637062 ATGGAGCACGACCTCATAAAAGG + Intronic
1019817715 7:3213266-3213288 ATGCAGCTCGGCCTCTTAACTGG - Intergenic
1025070543 7:55894099-55894121 TGGTAGCTCCTCCTCTGAAAGGG - Intronic
1025934725 7:66026377-66026399 ATTAAGCTTCACCTCTTGAAGGG - Intergenic
1025949547 7:66132991-66133013 ATTAAGCTTCACCTCTTGAAGGG + Intronic
1027420974 7:78017965-78017987 CTGTAGCTACACATATTAAAAGG - Exonic
1030789147 7:113702220-113702242 CTGAAGCTCCACATCCTAAATGG + Intergenic
1034126060 7:148672524-148672546 ATTTGGTTCCACCTCTTAAATGG + Intergenic
1035733986 8:1874415-1874437 ATGCAGCTCCAGCTCTCAAAGGG + Intronic
1037843446 8:22261995-22262017 AGGTAACTGGACCTCTTAAAGGG - Intergenic
1038769462 8:30463650-30463672 ATTAAGCTCCACTTCTTTAAGGG + Intronic
1039842766 8:41305614-41305636 ATTTAGTTCCACCTCTCAGAAGG - Intronic
1040707581 8:50148293-50148315 ATTAAGCTCCACTTCTTGAAAGG - Intronic
1042547785 8:69966281-69966303 ATTAGGCTCCACCTCTTGAAGGG - Intergenic
1045209350 8:100080036-100080058 ATGTAGCTACACTTCAAAAAGGG + Intronic
1045317221 8:101053554-101053576 ATTCAGCTCCATCTCTTGAAGGG - Intergenic
1050043418 9:1519321-1519343 ATGTAGGTCTGCCTCTTAAGAGG + Intergenic
1050558459 9:6808797-6808819 ATGAAGCTCTACTTCTTGAAGGG + Intronic
1057811425 9:98259796-98259818 AAGTAGCTCCACCTCCTGGAGGG + Intergenic
1059252623 9:112900032-112900054 ATGTATTTCCACCTCAGAAATGG - Intergenic
1059827534 9:118048271-118048293 ATGTAGCTCCATGTCTTAAGTGG - Intergenic
1060959852 9:127672560-127672582 ATGAAGCTCTGCCTCCTAAAAGG + Intronic
1185776835 X:2809968-2809990 ATGCAGCTCCACCTCTGGATGGG + Intronic
1187742145 X:22367334-22367356 ATGTAACTGCACCTCTTAGCTGG + Intergenic
1188876161 X:35432596-35432618 ATGCAGCTTCACTTCTTATAGGG + Intergenic
1194149499 X:90306147-90306169 ATGTACCACAACCTCTTTAAAGG + Intergenic
1194563842 X:95456748-95456770 ATGTACTTGCAGCTCTTAAAAGG + Intergenic
1195835033 X:109104010-109104032 ATTTTGCTCCACCTCCTAATTGG + Intergenic
1197977763 X:132183352-132183374 AAAAAGCTCCACCTTTTAAAGGG + Intergenic
1198521077 X:137453141-137453163 ATTAGGCTCTACCTCTTAAAAGG + Intergenic
1198590114 X:138170154-138170176 ATGTAGCCCAACATCTTAACAGG - Intergenic
1198799854 X:140437717-140437739 AGGTAGGTCCACCTGTTAACAGG - Intergenic
1200046453 X:153405353-153405375 ATCCAGCTACACCTCTTGAAAGG - Intergenic
1200495876 Y:3882882-3882904 ATGTACCACAACCTCTTTAAAGG + Intergenic
1201293159 Y:12441498-12441520 ATGCAGCTCCACCTCTGGACGGG - Intergenic
1202019123 Y:20446570-20446592 ATGTTGCTCCACATCTCATATGG - Intergenic