ID: 1097216826

View in Genome Browser
Species Human (GRCh38)
Location 12:57420659-57420681
Sequence CTAGTTTTCCATCTATCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 0, 3: 50, 4: 345}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097216821_1097216826 23 Left 1097216821 12:57420613-57420635 CCATAGTATTGGGATTACGGGCG 0: 1
1: 10
2: 619
3: 16587
4: 168005
Right 1097216826 12:57420659-57420681 CTAGTTTTCCATCTATCTTTAGG 0: 1
1: 0
2: 0
3: 50
4: 345
1097216817_1097216826 30 Left 1097216817 12:57420606-57420628 CCTAGGCCCATAGTATTGGGATT 0: 1
1: 0
2: 3
3: 11
4: 186
Right 1097216826 12:57420659-57420681 CTAGTTTTCCATCTATCTTTAGG 0: 1
1: 0
2: 0
3: 50
4: 345
1097216820_1097216826 24 Left 1097216820 12:57420612-57420634 CCCATAGTATTGGGATTACGGGC 0: 1
1: 20
2: 1216
3: 29147
4: 272957
Right 1097216826 12:57420659-57420681 CTAGTTTTCCATCTATCTTTAGG 0: 1
1: 0
2: 0
3: 50
4: 345
1097216823_1097216826 -4 Left 1097216823 12:57420640-57420662 CCACTGCGCCCAGGCTTTACTAG 0: 1
1: 0
2: 4
3: 97
4: 819
Right 1097216826 12:57420659-57420681 CTAGTTTTCCATCTATCTTTAGG 0: 1
1: 0
2: 0
3: 50
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097216826 Original CRISPR CTAGTTTTCCATCTATCTTT AGG Intronic
901408735 1:9067872-9067894 CTACTTTTCAATCATTCTTTAGG - Intronic
903309560 1:22443957-22443979 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
904748556 1:32726269-32726291 CTGGTTTCCCTTCTATCTTTTGG + Intergenic
905140023 1:35835937-35835959 CAAGTTTTGCATTTATCTTCAGG - Exonic
905161015 1:36034277-36034299 CGAGTTTAACATTTATCTTTAGG - Exonic
905748028 1:40436231-40436253 CTAGTTTTCCATCTGGCCCTGGG + Intergenic
906925831 1:50115393-50115415 CTAGTTTTGCATTTTACTTTTGG - Intronic
908672774 1:66566581-66566603 CTAGTTTTTCATCTGTCATGTGG + Intronic
909001905 1:70227559-70227581 CTAGCTTTCCAAATAACTTTTGG + Intronic
910128750 1:83877293-83877315 GGAGTTTTGCATCTATGTTTAGG + Intronic
911506133 1:98754280-98754302 GAAGTTTTGCATCTATGTTTAGG + Intronic
911695520 1:100886815-100886837 CTAGCTTTGCACCTATCTCTTGG + Intronic
912364809 1:109124628-109124650 CTATTTCTCCATTTATCTTTTGG + Intronic
912588106 1:110785437-110785459 CTAGTTCTCAATCTCTCTTTAGG - Intergenic
914949624 1:152101274-152101296 CATGTTTTCCATGTATCTCTTGG + Intergenic
915149122 1:153815668-153815690 CTAATCTATCATCTATCTTTCGG - Intronic
916989569 1:170227686-170227708 ATGGTTTTCCACCTATCTTTTGG - Intergenic
917103392 1:171468468-171468490 TTAGCTTTCAATTTATCTTTTGG - Intergenic
917463745 1:175255881-175255903 CTGGTTTTACATCTTCCTTTAGG - Intergenic
918437510 1:184531600-184531622 TTAGTTTTCCATTTTTCTTTTGG + Intronic
918530972 1:185522459-185522481 GAGGTTTTCCATGTATCTTTTGG + Intergenic
918802539 1:188990237-188990259 CTAGTTTTTCAGATTTCTTTGGG - Intergenic
920116858 1:203627660-203627682 TTTTTTTTCCATCTCTCTTTTGG - Intronic
920795284 1:209131047-209131069 CTAGTTTTCCAGGTTTCCTTGGG - Intergenic
920817284 1:209346476-209346498 CTAGTTGTCCTTCTGTCTCTTGG - Intergenic
920869202 1:209779548-209779570 CTAGTTAGCCTTCTATCTTGAGG + Exonic
921026947 1:211293347-211293369 TTAGGTTTCCTTCAATCTTTAGG + Intronic
921408828 1:214812681-214812703 CTCGTTTTCCATTCTTCTTTGGG - Intergenic
922640125 1:227221883-227221905 CTAGTTTTCCCTCAGCCTTTTGG + Intronic
923744203 1:236686098-236686120 CAAGTTTTCCAAATATCATTTGG - Intergenic
923779482 1:237009400-237009422 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
923803866 1:237237415-237237437 CTAGTTTTTCAGGTTTCTTTGGG - Intronic
923886197 1:238159358-238159380 CTATTTGTCCATCTTTCCTTTGG + Intergenic
924917385 1:248585672-248585694 GAAGTTTTCCCTCTATCTTGTGG + Intergenic
1062789594 10:293527-293549 TTAATTTCCCCTCTATCTTTGGG - Intronic
1063019190 10:2109312-2109334 CGCTTTTTCCATTTATCTTTAGG + Intergenic
1065373201 10:25011205-25011227 CCATTTTTTCATCTGTCTTTTGG + Intronic
1066526608 10:36286666-36286688 CTACTTTTCCTCCTCTCTTTTGG + Intergenic
1067187417 10:44042841-44042863 TCAGTTTTCCCTGTATCTTTAGG - Intergenic
1067915670 10:50395662-50395684 CTAATTTTGCAGCAATCTTTTGG - Intronic
1068227243 10:54121407-54121429 CTTATTTTCCTTCTAGCTTTGGG - Intronic
1068359641 10:55960377-55960399 CAAGATTTCCATCAATCTCTCGG - Intergenic
1068558753 10:58488032-58488054 CTATTTTTCTATTTATATTTTGG - Intergenic
1070701340 10:78603819-78603841 CAAGATTCCCATGTATCTTTTGG + Intergenic
1071133821 10:82430200-82430222 CTATTTTTCCACATATGTTTAGG + Intronic
1073236983 10:102025067-102025089 CTCTTTTTCCTTCTATCTTTGGG + Intronic
1073543739 10:104332499-104332521 CTAGTTTTTCATCTTTCTTCAGG + Intronic
1075125168 10:119693661-119693683 TTAGTTTTCCTCCTATATTTTGG + Intergenic
1077880065 11:6342027-6342049 ATAGTTTTCCCTGTATCTTTGGG + Intergenic
1078587862 11:12609815-12609837 ACAGTTTTCCAGCTGTCTTTTGG - Intergenic
1078935418 11:15945266-15945288 ATAGTTTCCCATTTATCTTCAGG - Intergenic
1079293106 11:19206673-19206695 CTGGTTTTTCAACTATATTTGGG + Intronic
1079732929 11:23958793-23958815 TTAGTTTTCTCTGTATCTTTGGG - Intergenic
1080104152 11:28494370-28494392 ATACTTTTCAATCTTTCTTTTGG + Intergenic
1080636533 11:34129027-34129049 TTATTTTTCCATTTATCTGTTGG + Intronic
1082300046 11:50494170-50494192 TTATGTTTCCATCAATCTTTGGG - Intergenic
1082866403 11:57903655-57903677 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1083289417 11:61681388-61681410 CTAGCTTTTCATCTAGCTTTGGG + Intronic
1085021143 11:73209196-73209218 CTAGTTTGTCATTTGTCTTTAGG - Intergenic
1085931717 11:81091494-81091516 CACGTTTTCCACATATCTTTGGG + Intergenic
1086266379 11:85003687-85003709 CTAATTATCCATCTATCTATAGG - Intronic
1086288361 11:85274990-85275012 ATAGTTTTCCCTGTATCTTCGGG + Intronic
1088177024 11:107065226-107065248 CAAGGTTTCCATTTATCTTTTGG + Intergenic
1088209020 11:107432211-107432233 ATTGTTTTCCATTTTTCTTTTGG - Intronic
1088888422 11:114025864-114025886 CTCCTTTTCCATCTCTCTCTTGG + Intergenic
1091983524 12:4886813-4886835 TTAATTTTTAATCTATCTTTTGG - Intergenic
1093812205 12:23504780-23504802 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1094212367 12:27905946-27905968 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1095460513 12:42439162-42439184 ATAGTTTTGCATTTATATTTAGG + Intronic
1095507311 12:42911284-42911306 ATTGTTTTCCCTGTATCTTTGGG - Intergenic
1097216826 12:57420659-57420681 CTAGTTTTCCATCTATCTTTAGG + Intronic
1097696509 12:62780298-62780320 CTAGTTTTCTTTCTTTTTTTTGG + Intronic
1098678253 12:73317951-73317973 ATAATTTTCCTTGTATCTTTGGG + Intergenic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1099585799 12:84511310-84511332 CTCATTTTCTAGCTATCTTTGGG + Intergenic
1099799646 12:87441456-87441478 ACAGTTTTCCCTGTATCTTTTGG - Intergenic
1100873075 12:98932580-98932602 ATAGTATTTCATCTGTCTTTGGG + Intronic
1100974501 12:100108319-100108341 CATGTTTTCCTTCTATATTTTGG - Intronic
1101609421 12:106277040-106277062 CTAGTTTTTCAGGTTTCTTTGGG - Intronic
1101684787 12:107008267-107008289 CTAGATTTTCATTTTTCTTTTGG - Intronic
1102210622 12:111124280-111124302 ATAGTTTTCCCTGTATCTTTGGG - Intronic
1102444424 12:112990892-112990914 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1102515588 12:113444201-113444223 CTAATTTTCCATCCATCTTAGGG + Intergenic
1102614226 12:114139060-114139082 CTGGTTTTCCATCAAGCTTCAGG + Intergenic
1103809088 12:123599782-123599804 ATAGTTTTCCCTGTAACTTTGGG - Intergenic
1104465317 12:128985113-128985135 CTGGTTTTACATCTATACTTGGG - Intergenic
1105710019 13:22998588-22998610 CTAGTTTTCCATCTTTCTGCAGG + Intergenic
1106059668 13:26276512-26276534 CAAGTTTTCCAGCTATCATAAGG + Intronic
1109306725 13:60649340-60649362 CTAATTTTCCCTCTGCCTTTCGG + Intergenic
1110660359 13:78053511-78053533 CAAGTTTTCCCTGGATCTTTGGG + Intergenic
1110703232 13:78574242-78574264 CCTGTTCTCCGTCTATCTTTAGG + Intergenic
1111034784 13:82657932-82657954 CTAGTTTTTCAGGTATCTTTGGG + Intergenic
1111639923 13:90955103-90955125 CTAGTTTTCCTTCTATAAATAGG + Intergenic
1111923835 13:94441757-94441779 CTTGGTTTGCATCTACCTTTTGG + Intronic
1111929014 13:94494411-94494433 CTAGTTTCTCCTCTATCTTCAGG + Intergenic
1112598673 13:100833376-100833398 GTAGTTTGCCAGCAATCTTTTGG - Intergenic
1112875499 13:104033333-104033355 CTATTTTTTCTTCTATCATTTGG + Intergenic
1114135171 14:19839904-19839926 GTATTTTTTCATATATCTTTTGG - Intergenic
1115725629 14:36213292-36213314 CTAGTTATACTTCTTTCTTTTGG + Intergenic
1116039747 14:39671298-39671320 CTCCATTTTCATCTATCTTTTGG - Intergenic
1116530006 14:45958833-45958855 TTAGTTTTCCATATACATTTGGG + Intergenic
1117903202 14:60557331-60557353 TTTGTTTTTCATCTACCTTTGGG + Intergenic
1118105742 14:62657471-62657493 CTAGTTTTTCAGATATATTTAGG - Intergenic
1118136875 14:63038496-63038518 ATAGATTTCCCTCTCTCTTTGGG - Intronic
1119966255 14:78919024-78919046 CTAGTTTACCAATTATATTTGGG - Intronic
1120370263 14:83625194-83625216 GCAGTTTTCCCTCTTTCTTTGGG - Intergenic
1120392024 14:83921232-83921254 CAAGGTTTCCTTCTATTTTTAGG - Intergenic
1120767957 14:88347951-88347973 CCAGTTTTACTTCTATCCTTGGG - Intergenic
1123668809 15:22632343-22632365 ATAGGTTTCCAAATATCTTTTGG + Intergenic
1124174466 15:27409579-27409601 CTACCTTTCCATATAACTTTTGG + Intronic
1124524779 15:30438822-30438844 ATAGGTTTCCAAATATCTTTTGG + Intergenic
1124773874 15:32568891-32568913 ATAGGTTTCCAAATATCTTTTGG - Intergenic
1125435199 15:39636860-39636882 CTATTTTTCAATCCATCCTTAGG + Intronic
1126140627 15:45435134-45435156 ACAGTTTTCCCTATATCTTTGGG - Intronic
1127219196 15:56860145-56860167 CTATTTTTCCATATACCTGTCGG - Intronic
1127462960 15:59216606-59216628 CTATCTATCTATCTATCTTTTGG + Intronic
1127930148 15:63590381-63590403 CTAGTTTTCCATGTTTCCGTAGG + Intronic
1129532889 15:76283122-76283144 CTGGTTTTTCATCTTTTTTTTGG - Intronic
1130248797 15:82281460-82281482 CTAGATGGCCCTCTATCTTTTGG + Intronic
1130361481 15:83191062-83191084 CAAGAATTCCATCTATCTGTGGG + Intronic
1130451262 15:84054692-84054714 CTAGATGGCCCTCTATCTTTTGG - Intergenic
1130686953 15:86046443-86046465 GTAGTCTTCCCTGTATCTTTGGG + Intergenic
1131765962 15:95676340-95676362 CTAGTTTCTCATATTTCTTTAGG + Intergenic
1134338686 16:13325439-13325461 CTAGTTTTTCAGGTTTCTTTAGG + Intergenic
1135358330 16:21789537-21789559 CTAAATTTCCATACATCTTTTGG + Intergenic
1135456833 16:22605662-22605684 CTAAATTTCCATACATCTTTTGG + Intergenic
1135896071 16:26404165-26404187 CTAGTTTTCTATCTATTCTTAGG + Intergenic
1137353833 16:47738773-47738795 ATAGTTTTCCCTGTATCTTTGGG - Intergenic
1140243997 16:73231914-73231936 CTATTTTTTTTTCTATCTTTTGG + Intergenic
1140334353 16:74090576-74090598 CTAGTTTTGTATTTTTCTTTGGG + Intergenic
1143197890 17:5090339-5090361 CTAAATATCCATCTATATTTGGG - Intronic
1143558937 17:7680399-7680421 ATAGTTATCCCTCTATCTGTAGG - Intronic
1143916665 17:10298821-10298843 CTAGTTTCACATCTCTCTCTCGG - Intronic
1144083402 17:11784865-11784887 ATAGTTTTCTTTCTTTCTTTTGG - Intronic
1144219503 17:13087257-13087279 ATATTTTTCCATGTATATTTAGG + Intergenic
1146247408 17:31301079-31301101 CCAGTTTGCCATTTGTCTTTTGG + Intronic
1148725956 17:49790052-49790074 CCAGTTTTCCAAGTATCTTAAGG - Intronic
1149702922 17:58670321-58670343 CTATCTATCCATCTATCTATAGG + Intronic
1150335458 17:64327427-64327449 CCAGCTTTCCAGCTGTCTTTTGG - Intronic
1151432042 17:74070238-74070260 CTGATTTCCCATCTATCTTTGGG + Intergenic
1152096640 17:78276406-78276428 CTAGGGTTGCTTCTATCTTTTGG - Intergenic
1153717748 18:7868427-7868449 TTAGTTTTCCTTCTAACATTCGG + Intronic
1154019316 18:10648604-10648626 CTTATTTTCCTTCAATCTTTAGG - Intergenic
1156020768 18:32597376-32597398 ACAGTTTTTCATCTATCTTATGG - Intergenic
1157524176 18:48366487-48366509 CTATTTTGTCATTTATCTTTTGG - Intronic
1157560634 18:48643290-48643312 ATAATTTTCCCTGTATCTTTGGG - Intronic
1159555947 18:69944928-69944950 TTAGTTTTCCCTTTCTCTTTAGG - Intronic
1159677949 18:71309425-71309447 ATAGTTTTACCTGTATCTTTGGG + Intergenic
1159964488 18:74581827-74581849 CTGCTTTTCCACCTAGCTTTGGG - Intronic
1159992711 18:74928798-74928820 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1160337182 18:78053147-78053169 TTAGACTTCCATTTATCTTTTGG + Intergenic
1163216587 19:15883356-15883378 GCATTTTTCCATCTATCTGTTGG - Intronic
1163332513 19:16649735-16649757 CCAGTTTTCCATCTGTCAGTTGG - Intronic
1164472932 19:28550819-28550841 CTAGTTTTCCAGATTTCTCTGGG - Intergenic
1164696658 19:30249855-30249877 CTAGGTTTGCAGCTATCTCTTGG - Intronic
1166136680 19:40781605-40781627 CCATTTCTCCATCTCTCTTTTGG - Intronic
926779042 2:16450322-16450344 TTAACTTTCCAACTATCTTTTGG - Intergenic
927355283 2:22165893-22165915 ATAGTTTTTCATATATCTGTTGG + Intergenic
927664607 2:25021921-25021943 CTAGTTTTCCTTCCCTCTTCTGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928315749 2:30244034-30244056 CTAGTTTTCCATTTATGTAGTGG + Intronic
930213970 2:48673678-48673700 ATAGTTTTCCCTGTTTCTTTGGG - Intronic
930521122 2:52468959-52468981 GTAGTTTTCTATGTATCTTGAGG + Intergenic
931964137 2:67514609-67514631 CAAGTTTTCCCTCTATCTCCTGG - Intergenic
932390634 2:71387922-71387944 CTATTTTCCAATTTATCTTTTGG - Intronic
932744364 2:74320195-74320217 CTATTTTTTTATCTCTCTTTTGG - Intronic
934743169 2:96740447-96740469 ATAGTTTTCCAGCTATTTTACGG - Intergenic
935471726 2:103468652-103468674 CTATTTCTCCATCTTGCTTTAGG - Intergenic
937002176 2:118477767-118477789 TTTTTTTTCCAGCTATCTTTTGG - Intergenic
937439938 2:121907037-121907059 CTAGGTTTCTATCTAACTTTGGG - Intergenic
937747148 2:125427832-125427854 CTATTTTAGCATCTATCTCTTGG + Intergenic
937763912 2:125637156-125637178 CTATCTTTCCATTTATTTTTTGG + Intergenic
938036149 2:128036664-128036686 CTAGTTTTTCAGGTGTCTTTGGG + Intergenic
938050969 2:128171189-128171211 CTGGTTTTCCTTCTAGGTTTTGG + Exonic
939737991 2:145873289-145873311 CTAGATTTCCACCTATCTTCTGG - Intergenic
941771559 2:169350833-169350855 CTATTTTTCCTTCTTTCTTCAGG + Intronic
942370221 2:175276021-175276043 CAAGTTTTCCAAGTCTCTTTAGG + Intergenic
942497274 2:176552972-176552994 CTAGTTTGCATTCCATCTTTTGG + Intergenic
943403142 2:187441880-187441902 GTAATTTTCCATCTGTCTTTTGG - Intronic
946776824 2:223151459-223151481 TTAATTTTTCATCCATCTTTGGG - Intronic
947573495 2:231253761-231253783 CTAGGTATACATCTATCCTTAGG - Intronic
1170787993 20:19484088-19484110 TTATTTATCCATTTATCTTTTGG - Intronic
1171911613 20:30965481-30965503 ACAGTTTTGCATCTCTCTTTTGG - Intergenic
1173052676 20:39579534-39579556 ATTGGTTTCCATCTTTCTTTTGG - Intergenic
1173353014 20:42262231-42262253 CTGCTTTTCCATCCATCCTTTGG - Intronic
1173441538 20:43081313-43081335 CAAGTTTTCCATTTATCAATTGG + Intronic
1174523835 20:51155603-51155625 TTAGCTTTCCTTTTATCTTTTGG + Intergenic
1174581609 20:51576142-51576164 CTAGTTTTCCCTCTAGAGTTGGG - Intergenic
1174792366 20:53491678-53491700 CTAGTTTTCCCTGAAGCTTTGGG - Exonic
1174994010 20:55545302-55545324 CTCTTTTTCAATCTATCTGTGGG - Intergenic
1177436352 21:21058358-21058380 CTAGTTTCACATTTATCTGTTGG + Intronic
1178756419 21:35354390-35354412 CTAGGGTTCCTTCCATCTTTTGG + Intronic
1179104712 21:38388611-38388633 CTTTCTCTCCATCTATCTTTAGG - Intronic
1180018931 21:45107534-45107556 CTAGATTTCCATCTATATATGGG - Intronic
1180508580 22:16047569-16047591 GGAGTTTTCAATCTCTCTTTTGG - Intergenic
1180526818 22:16273763-16273785 CTGGAGTTCCATCTTTCTTTAGG + Intergenic
1180884744 22:19233622-19233644 CTATTTTTCCATTTATTATTAGG - Exonic
1181271494 22:21661316-21661338 CTGGTTTTCCACCTGTCCTTTGG - Intronic
1182935563 22:34218703-34218725 AAAGTTTTCCCTGTATCTTTGGG + Intergenic
1184392092 22:44208974-44208996 TTTTTTTTCCAGCTATCTTTTGG + Intronic
950133324 3:10562586-10562608 CTAGTCCTCCATCTCTTTTTAGG + Intronic
950337369 3:12207118-12207140 CTTGTTTTCCTTCTAACTTTTGG + Intergenic
950920651 3:16690686-16690708 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
950931402 3:16792488-16792510 ACAGTTTTCCATGTGTCTTTGGG + Intergenic
951096289 3:18634889-18634911 CTAGTTTTCCCTCTGTCAGTGGG - Intergenic
951142082 3:19174422-19174444 TTAGTATTCTGTCTATCTTTAGG + Intronic
951516650 3:23567149-23567171 CTTGTTTTCCATCTTTCTGCTGG - Intronic
951620502 3:24596460-24596482 CTAGTATTCTATTAATCTTTTGG + Intergenic
953240793 3:41147789-41147811 TTAGTTTTCAGTCTATTTTTTGG - Intergenic
953276555 3:41506306-41506328 CTATCTTTCAATCCATCTTTTGG + Intronic
956235325 3:67063545-67063567 CAAATTTTCAATCTCTCTTTTGG + Intergenic
957204383 3:77176104-77176126 CTAGTTCTCCCTCAATCTTTTGG - Intronic
957307068 3:78470790-78470812 ATACTTTTCCCTATATCTTTGGG + Intergenic
957378581 3:79393121-79393143 ATACTTGTCCATCTATCATTTGG + Intronic
957513054 3:81214756-81214778 CTAGTTCTCCATCAATACTTTGG + Intergenic
959642839 3:108660865-108660887 GTATTTTTTCATCTGTCTTTTGG - Intronic
959655409 3:108798840-108798862 CTAGTTTCACATTTTTCTTTTGG + Intergenic
960425988 3:117508498-117508520 CCAGTTTTTCATGTTTCTTTGGG + Intergenic
960878956 3:122325943-122325965 CTATTTTTCCATATATAATTTGG - Intronic
963385803 3:144592367-144592389 CTGGTTTTCCGTCTTTCATTCGG - Intergenic
963541296 3:146592988-146593010 CTAATTCTCCAACTATTTTTAGG - Intronic
963817141 3:149844001-149844023 CTAAATTTCCAGCTAACTTTGGG - Intronic
964296238 3:155236850-155236872 AGAGTTTTCCATATATCTGTGGG + Intergenic
964842425 3:161008432-161008454 ATAGTTTCCCCTGTATCTTTGGG + Intronic
965033791 3:163408099-163408121 TTACTTTTCTATCTTTCTTTGGG - Intergenic
965892311 3:173529617-173529639 CCATTTGTCCATCTATCTCTAGG + Intronic
967288880 3:187900175-187900197 CTATTTTTTCATCTGTCATTTGG - Intergenic
969967023 4:11007464-11007486 TTTGTTTTCCCTCTCTCTTTGGG - Intergenic
970220312 4:13803780-13803802 GCATTTTTCCATCTGTCTTTTGG - Intergenic
970710722 4:18859219-18859241 CTGGTTTTGCATTTATTTTTTGG - Intergenic
972046651 4:34673216-34673238 ATAGTTTTTCACCTATCTGTAGG - Intergenic
972091931 4:35297530-35297552 CTATTTTTCCTTGTATATTTTGG - Intergenic
972146108 4:36027740-36027762 CTAATTATCCATTTATCTTTGGG - Intronic
973990001 4:56395548-56395570 TTATTTTTCCCTCTTTCTTTAGG - Exonic
974376384 4:61082140-61082162 CTATATTTCCATCAATTTTTTGG + Intergenic
974414270 4:61584364-61584386 CAAATTTTCCATGTATCTTTTGG - Intronic
974772812 4:66437600-66437622 CTAGTTTTTCAGATTTCTTTGGG - Intergenic
975408398 4:74018725-74018747 CTATTTTTACACCTATTTTTTGG + Intergenic
976322837 4:83734900-83734922 ATAGTTTTCCCTTTATCTTTGGG + Intergenic
977578202 4:98697077-98697099 CTAGTTTTTCAGGTTTCTTTAGG - Intergenic
978538561 4:109790322-109790344 CTATTTTTTCTTCTAGCTTTGGG + Intronic
979482522 4:121236370-121236392 CTAGTTTTACTTTTGTCTTTTGG + Intergenic
979664864 4:123300049-123300071 ATAGTTTTAAATCTTTCTTTAGG + Intronic
979684686 4:123498585-123498607 CTATCTCTCTATCTATCTTTTGG - Intergenic
979912813 4:126391209-126391231 CTGTTTTTCCATTTTTCTTTTGG + Intergenic
980869662 4:138596030-138596052 CTACTTTTACATCTATCTTGAGG - Intergenic
981601734 4:146496706-146496728 ATAGTTTTCCCTGTCTCTTTGGG + Intronic
982666447 4:158269953-158269975 ATAGTTTTCCCTGTATCTTTGGG + Intergenic
983778852 4:171643024-171643046 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
984116239 4:175684232-175684254 CTAGTTTGCCATTTGTCTTTTGG + Intronic
985804123 5:2028005-2028027 ATAGTTTTCTTTCTTTCTTTTGG + Intergenic
987144894 5:14982520-14982542 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
987562801 5:19546006-19546028 CCAGTTTTCCCTCTCTCCTTTGG - Intronic
987647027 5:20686877-20686899 CTAGTTTTTCCTCCCTCTTTCGG + Intergenic
987794094 5:22605801-22605823 CTTGTTTTCCATCTTGCTCTTGG + Intronic
988114272 5:26864303-26864325 CTACTTGTTCATTTATCTTTAGG - Intergenic
988165339 5:27581941-27581963 TTAGTTTTCCATTTTTATTTGGG + Intergenic
988343749 5:30010730-30010752 ATAATTTTCCATATATGTTTGGG - Intergenic
988541071 5:32110428-32110450 ATAGCTTTCTATCTATCTTAGGG - Exonic
989758523 5:44985528-44985550 CTAGTTTGCCATATAAGTTTTGG - Intergenic
990750390 5:59009862-59009884 TTTGTTTTGCATTTATCTTTGGG - Intronic
990864385 5:60365041-60365063 CTACTTATCCCTCTATCATTTGG - Intronic
992956098 5:81909937-81909959 CTAGTTTTTCCACTGTCTTTGGG + Intergenic
993195031 5:84731161-84731183 CTTGGGTTCCTTCTATCTTTCGG - Intergenic
993559155 5:89382404-89382426 CTAGTTTTCCATTTATGGTGGGG - Intergenic
993577221 5:89616985-89617007 TTAGCTTTCCAGCTTTCTTTTGG - Intergenic
994960347 5:106594205-106594227 CTTTTTTTCCATATATTTTTTGG - Intergenic
995536679 5:113143572-113143594 CTAGCACTCCATCTCTCTTTGGG + Intronic
995738068 5:115324773-115324795 TTTGTTTTCCACCTTTCTTTTGG + Intergenic
996078708 5:119230525-119230547 ATAGTTTTCCTTCTAAATTTTGG + Intronic
996601464 5:125269115-125269137 AGAGTTTTCCATGTATTTTTTGG - Intergenic
997147027 5:131446273-131446295 CTACTTATCCCTCTATTTTTTGG + Intronic
997238811 5:132292670-132292692 CTAATTTTCCATTTATTCTTAGG + Intronic
998708649 5:144795064-144795086 ACAGTTTTACATCTGTCTTTTGG + Intergenic
999469592 5:151841213-151841235 TGAGTTTTCCAACTTTCTTTTGG - Intronic
999861147 5:155647929-155647951 CTATTATTCCTTCTATCTCTTGG - Intergenic
1000602246 5:163288665-163288687 TTACTTCTCCATCTATCTTTTGG + Intergenic
1000630458 5:163585138-163585160 CTCTTTTTCCTCCTATCTTTAGG - Intergenic
1002869614 6:1155188-1155210 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1003195186 6:3908189-3908211 CTAGTTCACCTTCTACCTTTAGG + Intergenic
1003681866 6:8264964-8264986 CAACATTTCCATCTTTCTTTTGG - Intergenic
1003692373 6:8367208-8367230 CGAGTTGTCCATCTGTCTTCTGG + Intergenic
1005162185 6:22876619-22876641 ACAGTTTTCCCTGTATCTTTAGG + Intergenic
1005279335 6:24255668-24255690 ATACTTTTTCATGTATCTTTTGG - Intronic
1006580625 6:35075349-35075371 CCAGTTTGCTATTTATCTTTTGG - Intronic
1010787233 6:80018270-80018292 ATAGTTTTCCATGCATTTTTTGG + Intronic
1012133347 6:95522948-95522970 TTTGTTTTCCATCCATGTTTGGG + Intergenic
1012482555 6:99683630-99683652 CTATTTTTCCATCTTCCTTAAGG - Intergenic
1013746586 6:113353238-113353260 ATAGTTTTCCCTGTTTCTTTGGG + Intergenic
1013837521 6:114350072-114350094 CAACTTTTACATCTATCTTTAGG + Intergenic
1014417884 6:121206257-121206279 CTGCTTTTACATATATCTTTGGG + Intronic
1015370474 6:132445678-132445700 CTTCTTCTCCATCTATATTTTGG + Intergenic
1015836487 6:137425911-137425933 ATAGTTTTCCCTGGATCTTTGGG - Intergenic
1016149751 6:140725469-140725491 GGAATTTTCCATCTCTCTTTAGG - Intergenic
1016293786 6:142552198-142552220 CTAGTTTTTCAGGTCTCTTTGGG - Intergenic
1018081120 6:160259995-160260017 CCAGTTTTCCCTGTATCTGTGGG + Intronic
1018242763 6:161794574-161794596 CAGGTTTTTCTTCTATCTTTTGG + Intronic
1018310263 6:162501207-162501229 CTAGTTTAGAATTTATCTTTTGG - Intronic
1018621336 6:165732279-165732301 CTATTTTACCACCTCTCTTTCGG + Intronic
1020932963 7:14423146-14423168 ATAGTTTTCCATCTATAATTTGG - Intronic
1021103821 7:16614460-16614482 CTAGTTTGTCATCTCTCTTAAGG + Intronic
1021169941 7:17386976-17386998 CTTGTTTTCCATCAATGTTGAGG - Intergenic
1021532313 7:21661466-21661488 ATATTTTTCCATTTATCTTATGG + Intronic
1021563740 7:21995693-21995715 CTACATTTCCATATATCCTTAGG - Intergenic
1023955240 7:44881032-44881054 CTACTCTTCCTTCTATGTTTTGG - Exonic
1024567052 7:50689858-50689880 CTAGTTTGACATCTTCCTTTGGG + Intronic
1025164559 7:56701462-56701484 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1025705718 7:63860614-63860636 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1026726936 7:72877334-72877356 TTAGTTTTCCATGTTTATTTTGG - Intergenic
1026800353 7:73396402-73396424 CCAGTTTTCCAGCTGTCTCTAGG - Intergenic
1027116897 7:75488285-75488307 TTAGTTTTCCATGTTTATTTTGG + Intergenic
1027274907 7:76547313-76547335 TTAGTTTTCCATGTTTATTTTGG - Intergenic
1027766812 7:82354180-82354202 ATAGTTTTCCATAGGTCTTTGGG + Intronic
1027915299 7:84310286-84310308 TGAGTTTTTCACCTATCTTTGGG + Intronic
1028093429 7:86731144-86731166 CTGTATTTCCATCTATCTTTTGG + Intronic
1029720604 7:102361776-102361798 TTAGTTTTCCATGTTTATTTTGG - Intergenic
1030493165 7:110264732-110264754 GTTGTTTTCCCTCTATCTTTGGG - Intergenic
1030726661 7:112934328-112934350 TTAGTTTGCAATCTATCCTTTGG - Intronic
1030848471 7:114453611-114453633 CTAGTTGTCAATGTATCTCTTGG - Intronic
1031188839 7:118519830-118519852 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1031710361 7:125037369-125037391 CTAGTTTACCACTTATCTGTAGG + Intergenic
1032648314 7:133850534-133850556 CTAATATTCCATTTCTCTTTGGG + Intronic
1033983785 7:147198046-147198068 CAAGTTTTTCATTTGTCTTTAGG - Intronic
1034679884 7:152920534-152920556 CTGGTTTTCCATCTTTCTATTGG - Intergenic
1035360220 7:158307540-158307562 CATGTTTTCCATCTAGTTTTGGG - Intronic
1035973033 8:4273118-4273140 GTAATTTTCCCTCTATCATTTGG - Intronic
1036072584 8:5457728-5457750 CCAGTTGTCCATGTATCTTTTGG + Intergenic
1037152916 8:15659964-15659986 ATAATTTTTAATCTATCTTTTGG + Intronic
1038050104 8:23800952-23800974 TTAGCTTTCCATCAATCCTTTGG - Intergenic
1038342046 8:26694434-26694456 ATAGTTTTGCATTTATATTTGGG + Intergenic
1038520042 8:28223853-28223875 CTTGTTTTCTATCTAGTTTTGGG + Intergenic
1039006845 8:33048302-33048324 CTATTTTTCCTTCTTTTTTTAGG - Intergenic
1039301564 8:36214828-36214850 CTAGTTTTCCTGCTAGCTTTTGG + Intergenic
1039309592 8:36301988-36302010 CTATTTATCCATCTATCTATTGG + Intergenic
1041033065 8:53757504-53757526 GAAGTTTTCCATCTATTTCTAGG - Intronic
1041593589 8:59620140-59620162 ATTGTTTTCCCTGTATCTTTGGG + Intergenic
1041609962 8:59834109-59834131 CTAATTTTCCATCTAACTCTCGG - Intergenic
1041853345 8:62419050-62419072 CCAGTCTTACTTCTATCTTTTGG + Intronic
1042487369 8:69361382-69361404 ATAGTTTTCCCTGTATCTTTGGG - Intergenic
1042555741 8:70032830-70032852 CTCCCTCTCCATCTATCTTTCGG - Intergenic
1043924535 8:86022014-86022036 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1044364140 8:91323719-91323741 TTGGTTTTCCCTCTTTCTTTTGG + Intronic
1044469397 8:92549042-92549064 TTGATTTTCCATCTATGTTTTGG + Intergenic
1046109723 8:109708155-109708177 CTAGTCTTCCCTCTTCCTTTTGG + Intergenic
1046350282 8:113000640-113000662 CTAGTTTTCAATCTACCTTATGG + Intronic
1047246806 8:123153095-123153117 CTAGTTTTCCATACGTTTTTAGG + Intergenic
1047544827 8:125805336-125805358 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1047672384 8:127162387-127162409 CAACATTTCCATCTCTCTTTTGG - Intergenic
1048022381 8:130551403-130551425 GCATTTTTTCATCTATCTTTTGG + Intergenic
1050069228 9:1792934-1792956 CTGGTTTCCCATCTTTATTTTGG + Intergenic
1050759810 9:9053872-9053894 CTAGTTATCCATTTAGATTTTGG - Intronic
1050919017 9:11175558-11175580 CATGTTTTCCATCTGTCTATTGG - Intergenic
1051069138 9:13141695-13141717 CTAGTGTTACATATATTTTTAGG - Intronic
1051168060 9:14287074-14287096 CTAGGTTCAAATCTATCTTTGGG + Intronic
1051802965 9:20957633-20957655 CTATCTATCTATCTATCTTTGGG - Intronic
1051875821 9:21792188-21792210 ATAGTTTTTCATGTATCTGTTGG - Intergenic
1051897556 9:22004734-22004756 CTACTTTTTCAGCAATCTTTTGG + Exonic
1052219763 9:26005649-26005671 TTACTTTTCCCTCTTTCTTTAGG - Intergenic
1052808031 9:33030589-33030611 CAGCTTTTACATCTATCTTTAGG - Exonic
1054752259 9:68919659-68919681 CAATTTTTCCATTTATATTTAGG + Exonic
1054866642 9:70009306-70009328 CTAGTTTTGCAACTCTCTCTGGG + Intergenic
1055108737 9:72538963-72538985 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1055224480 9:73977911-73977933 CTAGTGTTCTATTTGTCTTTTGG - Intergenic
1055230345 9:74056220-74056242 CTATTTTTCCACCTATCTTGTGG + Intergenic
1055233598 9:74091720-74091742 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1055719234 9:79153218-79153240 CTGGTTTTCCTTCTACCTGTTGG + Intergenic
1055760015 9:79597309-79597331 CTACTTTTATATCTACCTTTTGG + Intronic
1059815809 9:117912289-117912311 ATAATTTTCCATCTATTTATTGG - Intergenic
1060200626 9:121650173-121650195 CTGGTTTTCCATCTTCCTGTGGG + Intronic
1060434735 9:123583688-123583710 CTACTTGCCCATCTCTCTTTTGG + Intronic
1185480462 X:442394-442416 CTATCTATCCATCTATCTTTTGG + Intergenic
1186231476 X:7459588-7459610 CTATCTATCCATCTATCTATTGG + Intergenic
1186328523 X:8507230-8507252 CTAGTTTTCCAGGTAAATTTTGG + Intergenic
1186579377 X:10800917-10800939 CTAGTTTTACATCTCTATTTAGG - Intronic
1186627208 X:11307052-11307074 TTTGTTTTCCATCCATCCTTTGG - Intronic
1186938654 X:14479353-14479375 CTAGTTTTCAATGGATCTTTTGG + Intergenic
1187879620 X:23834566-23834588 CTACATTTCCATCTATCTGCTGG + Intronic
1188824303 X:34811298-34811320 TCTGTTTCCCATCTATCTTTTGG - Intergenic
1189649428 X:43173360-43173382 ACAGTTTTCCCTGTATCTTTGGG + Intergenic
1190422819 X:50302359-50302381 CTAGTTTTCCTACTATTATTAGG - Intronic
1190469213 X:50760501-50760523 CTAATTTTCTATCTTTCTTTAGG + Intronic
1190893179 X:54589221-54589243 CTATTTTTCCGTCTATTTATAGG - Intergenic
1190893185 X:54589318-54589340 CTATTTTTCCATCTGTTTATAGG - Intergenic
1194578931 X:95647157-95647179 CTCATTTTCCATTTATATTTGGG - Intergenic
1194627726 X:96245017-96245039 CAAATTTTCCATCTGTCCTTTGG + Intergenic
1195418390 X:104645170-104645192 CTTATTTTGCCTCTATCTTTTGG + Intronic
1195660196 X:107370538-107370560 CTGTTTTTCCATCTTTCTTATGG + Intergenic
1196630444 X:117932974-117932996 GTAATTTTCCATATATCTGTTGG + Intronic
1197474765 X:126907768-126907790 CTGGTTTTCTAGTTATCTTTTGG - Intergenic
1198528636 X:137526958-137526980 TTTGTTTTCCATCTATCTTATGG + Intergenic
1198597760 X:138255509-138255531 ATAGTTTTCCCTGTATCTTTGGG + Intergenic
1198622460 X:138528925-138528947 CTAGTTTTCAAGCTACTTTTAGG + Intergenic
1200419938 Y:2954258-2954280 CTAGTTTTCTATTTTTCTATTGG + Intronic
1200740606 Y:6849932-6849954 TTTGTTTTCCATCCATCCTTTGG + Intergenic
1201360148 Y:13137886-13137908 ATAGTTTTCAATCTATCTCAAGG + Intergenic
1201433780 Y:13933699-13933721 CTAGTTTTCCAGGTAAATTTTGG - Intergenic