ID: 1097218914

View in Genome Browser
Species Human (GRCh38)
Location 12:57435354-57435376
Sequence GAGTGACCCCAGAGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097218914_1097218919 2 Left 1097218914 12:57435354-57435376 CCCACATCCCTCTGGGGTCACTC 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1097218919 12:57435379-57435401 GTAGCTCAGACCTGACCAATAGG 0: 1
1: 0
2: 2
3: 11
4: 78
1097218914_1097218923 17 Left 1097218914 12:57435354-57435376 CCCACATCCCTCTGGGGTCACTC 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1097218923 12:57435394-57435416 CCAATAGGCAGCTGGAAAGCTGG 0: 1
1: 1
2: 3
3: 19
4: 166
1097218914_1097218920 9 Left 1097218914 12:57435354-57435376 CCCACATCCCTCTGGGGTCACTC 0: 1
1: 0
2: 1
3: 16
4: 155
Right 1097218920 12:57435386-57435408 AGACCTGACCAATAGGCAGCTGG 0: 1
1: 0
2: 2
3: 14
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097218914 Original CRISPR GAGTGACCCCAGAGGGATGT GGG (reversed) Intronic
900813857 1:4828314-4828336 CAGTGACCCTAGGAGGATGTTGG + Intergenic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
903660169 1:24972270-24972292 GAGTGAGCTCAGAGGGCTCTGGG - Intergenic
904927412 1:34059834-34059856 GATTCAGCCCAGAGGGATCTGGG - Intronic
905020652 1:34808630-34808652 GAATGACCCCAAAGGCATTTTGG - Intronic
907188664 1:52631648-52631670 GGCTCACCCCAGAGGGCTGTTGG + Intergenic
909465341 1:75967552-75967574 AAGTGACCTCAGAGGGGTGTGGG - Intergenic
909699447 1:78505673-78505695 GAGTGACTCCTGATGGATATAGG - Intronic
912427137 1:109604244-109604266 GAGTAAAGCCAGAGAGATGTGGG + Exonic
912863536 1:113236611-113236633 GAGAGAGGCCAGAGGGATGTGGG - Intergenic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
914932517 1:151947949-151947971 AACTGGCCCCAGAGTGATGTGGG - Intergenic
915346977 1:155202542-155202564 GAGGGAACCCCGAGGGAAGTGGG - Intronic
917651125 1:177078286-177078308 CAGTGACCCCACAGGGATGAAGG - Intronic
920257380 1:204664813-204664835 GACTGACCCCAGAGGGAGAATGG - Intronic
922619595 1:226981665-226981687 GTGGGAACCAAGAGGGATGTAGG - Intronic
922803605 1:228374887-228374909 GCCTGGCCCCATAGGGATGTGGG - Intronic
1064125866 10:12659349-12659371 GAGTGAGACCAGAGGGAGTTGGG + Intronic
1067524146 10:47028206-47028228 GAGTGACCCCATAGGGTTACTGG - Intergenic
1068919031 10:62463950-62463972 CACTGACACCAGCGGGATGTAGG + Intronic
1069495742 10:68901598-68901620 GAGCGACCCCAGAGGGCCGAGGG - Intronic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1070461796 10:76677720-76677742 GAGAGACCCCAGTGGGAAATTGG - Intergenic
1071500811 10:86203077-86203099 ATCTGACCTCAGAGGGATGTTGG + Intronic
1072019191 10:91381660-91381682 GCCTGACCCCAGAGGGCAGTTGG + Intergenic
1076730743 10:132437666-132437688 GGGTGCCCACAGAGGGAAGTGGG - Intergenic
1076930407 10:133528362-133528384 TAGAGAACCCAGAGGGACGTGGG - Intronic
1077386881 11:2273603-2273625 GAGTGACAACAGAGGGATGGGGG + Intergenic
1083309839 11:61778510-61778532 GAGGGAGCCCAGAGGCAAGTGGG + Intronic
1083633072 11:64105645-64105667 GAGTGACCCCACAGGCTTGAGGG + Intronic
1084276135 11:68051892-68051914 GAGTGGCCCCAGTGTGATTTAGG + Intergenic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084596685 11:70120785-70120807 GAGAGACGCCTGAGGGTTGTTGG + Intronic
1089559507 11:119336715-119336737 GGGTAACCCCAGAGGCATCTGGG - Exonic
1090762551 11:129849876-129849898 GAATGACCCCAAAGGCATTTGGG - Intronic
1091584998 12:1811067-1811089 GAGTGAATCGAGAGGGATGGAGG - Intronic
1091626305 12:2123468-2123490 AAGTGACCTCAGAGGGTTCTAGG + Intronic
1097218914 12:57435354-57435376 GAGTGACCCCAGAGGGATGTGGG - Intronic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102576488 12:113859179-113859201 TAGTTACCCCACAGGGAAGTGGG - Intronic
1104312147 12:127663217-127663239 CAGTGCCCTCAGAGGGATGATGG - Intergenic
1106346666 13:28886130-28886152 GAGTGAGGTCAGAGGGATGTAGG + Intronic
1108156768 13:47592898-47592920 GAATGACTCCAGAGGCATTTTGG - Intergenic
1109721722 13:66283681-66283703 GAGTGACCCCACAGGCATTTTGG - Intergenic
1111482530 13:88850263-88850285 GAGTGACATCAGGGAGATGTTGG + Intergenic
1112100907 13:96188115-96188137 AAGTGACACCCCAGGGATGTGGG - Intronic
1113823599 13:113232773-113232795 GAGTGTACCCTGAGGGCTGTTGG + Intronic
1114524409 14:23359267-23359289 GAGGGACCCCAGAGGGACCAAGG - Intronic
1118347990 14:64953666-64953688 GAGTGACAACAGAGAGATGAGGG + Intronic
1118758908 14:68865883-68865905 GAGTGACCCCAGCTGGAGGCAGG - Intergenic
1121382969 14:93490194-93490216 GAATGACCCCAGAGGCACTTCGG - Intronic
1122133768 14:99620820-99620842 GGGTGTCCCCAGAGGGAAATGGG - Intergenic
1122300288 14:100727374-100727396 AAGTGGCGCCAGAGGGGTGTCGG + Intronic
1124066107 15:26345631-26345653 GAGTGACTGAAGAGGGATGTGGG + Intergenic
1125080320 15:35665016-35665038 GAGTGGCTCCAGAAGTATGTAGG - Intergenic
1127303430 15:57679826-57679848 GAGTGTGCCCAGAAGGCTGTGGG - Intronic
1127904416 15:63365728-63365750 AAGGGAGACCAGAGGGATGTAGG - Intronic
1128310625 15:66629935-66629957 CAGTCAGCCCAGAGGGATGTGGG + Intronic
1129493400 15:75952209-75952231 GAGTGACGGCTAAGGGATGTGGG - Intronic
1130675609 15:85949337-85949359 TAGTAACCCAAGAGTGATGTGGG + Intergenic
1132275333 15:100558894-100558916 GAGCGACCCCCGAGAGGTGTGGG - Intergenic
1135942905 16:26838342-26838364 GAGTGACCTCAGATGAAGGTAGG - Intergenic
1136061082 16:27726887-27726909 GAGAGGTCCCAGAGGGAGGTGGG + Intronic
1136393418 16:29979334-29979356 GAGAGACCTCCCAGGGATGTTGG + Intronic
1137423607 16:48357593-48357615 GACTGACCCCCCAGGTATGTTGG + Intronic
1138275121 16:55728797-55728819 AAGTTACCCCAGATGGATGTTGG - Intergenic
1138553161 16:57758098-57758120 GACAGATCCCAGAGGGCTGTGGG + Intergenic
1139625674 16:68186969-68186991 AAGTGGCCCCAGAGGGCTGTGGG - Intronic
1145999083 17:29120820-29120842 GAGCTACCCCAGAGGTATGAAGG + Intronic
1146689729 17:34865135-34865157 GAGTGATCGCAGAGGGAGGATGG - Intergenic
1147459544 17:40559469-40559491 GAGTGTCTCCTGAGGGAGGTGGG + Intronic
1148622211 17:49043328-49043350 GAGTAGCCCCAGAGGCAAGTGGG - Intronic
1149272375 17:54994214-54994236 GATTGACCCCAGATAGATATGGG - Intronic
1150007693 17:61479769-61479791 GAGCGACCCCTGAGGGAGGGAGG + Intronic
1160667582 19:339831-339853 GAGTGACCACTAAGGGGTGTGGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164695228 19:30238986-30239008 GAGTCACCCAAGAGAGAGGTGGG + Intronic
1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG + Intronic
1165798993 19:38536234-38536256 GGGAGACCCCAGGGGGATGGAGG - Intronic
1166557867 19:43713456-43713478 GGGGGACCCCAGAGGGCTGTGGG - Intergenic
1166591220 19:44001218-44001240 GAATGACCCCAAAGGCATCTAGG + Intergenic
1166791777 19:45402942-45402964 GTGTGACCCGACAGGGCTGTAGG - Intronic
1166838090 19:45679569-45679591 GAGTGTCCACTGAGGGATGGGGG + Intronic
1167622397 19:50567314-50567336 GGGTGACCCCAGAGGGAGAAGGG + Intronic
1168105745 19:54164817-54164839 GATTGACCGCGGAGGGATGGGGG - Intronic
926994915 2:18724415-18724437 GAGCTTCCACAGAGGGATGTGGG + Intergenic
928118219 2:28563354-28563376 GAGGGACCCCAGAGGGAGTGTGG + Intronic
928198846 2:29234066-29234088 GCATGAGCCCAGAGGGAAGTGGG + Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
935593456 2:104862272-104862294 AAGTGACCTCAGAGGGGTCTGGG + Intergenic
936022663 2:109006590-109006612 GAGTGACCTCAGTGGGATGTGGG + Intergenic
936090290 2:109497736-109497758 TAATGAGCCCAGATGGATGTGGG - Intronic
936948624 2:117954350-117954372 GACTTACCCCAGATGGATCTTGG + Intronic
938230599 2:129655323-129655345 GAGTGACCCCAGAGACATTGTGG + Intergenic
940372381 2:152917877-152917899 GAATGACCCCAAAGGCATTTTGG + Intergenic
941086978 2:161129329-161129351 GCATGACTCCAGGGGGATGTTGG - Intergenic
942609492 2:177728146-177728168 TTCTGACACCAGAGGGATGTTGG + Exonic
946562937 2:220933582-220933604 GAGTGAAACCATAAGGATGTGGG - Intergenic
947117762 2:226790667-226790689 CAGTGATGCAAGAGGGATGTTGG + Intronic
947749579 2:232525411-232525433 GAGGGACCCTGGATGGATGTAGG + Exonic
948219675 2:236259682-236259704 CAGTGAGCCCAGCAGGATGTTGG + Intronic
948281457 2:236750489-236750511 CAGTGAGCACAGAGAGATGTAGG + Intergenic
1170457557 20:16547597-16547619 GAGTGAGACCAGAGGCAGGTGGG - Intronic
1170521643 20:17192076-17192098 CAGTGACCCCTGAGAGATGAGGG + Intergenic
1170775081 20:19368165-19368187 GACAGAACCTAGAGGGATGTTGG + Intronic
1170827797 20:19811175-19811197 GAGTGATTCCAGAAGGATGGAGG + Intergenic
1173575575 20:44111188-44111210 CAGGGACCCCAAAGGGATGGAGG - Intergenic
1174270277 20:49363424-49363446 TTGTTACCCCATAGGGATGTGGG - Intergenic
1176681224 21:9820342-9820364 GAGTGTCACCGGAGGGATATGGG + Intergenic
1179271303 21:39853232-39853254 GAGTGACCCCAGAGCTATCCTGG + Intergenic
1180001388 21:44997022-44997044 GGGTGCCCCCAGAGGAAGGTGGG + Intergenic
1180049455 21:45324670-45324692 GTGAGTCCCAAGAGGGATGTAGG + Intergenic
1180633168 22:17243866-17243888 GAGTGCTCCCAAAGGGCTGTGGG - Intergenic
1184197200 22:42937799-42937821 GTGTGACCCCCTAGGGATGCTGG - Intronic
952255104 3:31688205-31688227 GTGTGAGACCAGAGGGAGGTGGG - Intronic
953548870 3:43884995-43885017 GAGTAACCTCAGAGTGATGCTGG - Intergenic
954660696 3:52225403-52225425 GAGTGTCCCCAGGGCCATGTGGG + Intronic
955486399 3:59438887-59438909 GAGTGGTCCAAGAGGGATCTCGG - Intergenic
960950986 3:122998249-122998271 GAGCGACCCCAGAGTGAAGTGGG - Intronic
962741577 3:138366095-138366117 ATGTGACCCCAGAGGGGTCTAGG - Intronic
966311795 3:178602249-178602271 GCATGAACCCAGAGGGATATAGG + Intronic
968951625 4:3697886-3697908 GAGTGACCTCAGAGGGTTCTTGG + Intergenic
968962486 4:3752671-3752693 AAGGGACCCCATAGGGAAGTCGG + Intergenic
969681937 4:8647991-8648013 GAGCCACCCCAGAGGGCTGCTGG + Intergenic
969845873 4:9919638-9919660 GAGTGACCTCAGAGGCAGTTTGG + Intronic
971098357 4:23434584-23434606 GAATGACCCCAAAGGCATTTTGG + Intergenic
972811753 4:42596288-42596310 GAGTGACTTCAGAAGGCTGTAGG - Intronic
973348361 4:49081645-49081667 GAGTGTGCCCTGAGGGAGGTAGG + Intergenic
978549833 4:109913509-109913531 GATTGAACCAACAGGGATGTGGG - Intronic
979565763 4:122152541-122152563 GAGAGAGGCCAGAGGGATTTCGG + Exonic
987372035 5:17202361-17202383 GTGGGACCGCAGAAGGATGTAGG - Intronic
990294434 5:54386253-54386275 GAGTGACAGCAGAGGCATCTGGG - Intergenic
994403157 5:99308336-99308358 GAGTGGCTTCAGAGGGATATTGG + Intergenic
995458286 5:112375193-112375215 GAGTGAGCCCAGAGTGGTGCAGG + Intronic
997527817 5:134564718-134564740 GATGGGCCCCAGAGGGGTGTGGG + Intronic
1000819250 5:165963361-165963383 GAGGGACCCAAGAGGGAGGGAGG - Intergenic
1003877823 6:10453809-10453831 GAGTCACCACAAAGGGATGTTGG - Intergenic
1006803919 6:36776566-36776588 GGGTGGTCCCAGAGGGATGGGGG + Intronic
1007378781 6:41473378-41473400 GAGTGACCCCAGTGCTCTGTGGG - Intergenic
1010915098 6:81606161-81606183 GAGTGAGGACAGAGAGATGTAGG + Intronic
1011277262 6:85643175-85643197 GAGCGACCGCAGAGGGGAGTGGG - Exonic
1013225217 6:108115801-108115823 GTGTGACCCGGGAGGGTTGTGGG + Intronic
1015924066 6:138292104-138292126 GACTGAAACCAGATGGATGTGGG - Intronic
1016718705 6:147266691-147266713 GAATCTCACCAGAGGGATGTAGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018503926 6:164443661-164443683 GAATGACCCCAAAGGCATTTTGG + Intergenic
1019152413 6:170017551-170017573 GAGAGGCCCCTGAGGGAAGTTGG + Intergenic
1029403234 7:100358171-100358193 GAGGCTCCCCAGAGGGCTGTGGG - Intronic
1032450741 7:132028812-132028834 CACTGACCCCTGAGGGATGAGGG + Intergenic
1035760044 8:2062248-2062270 GGGAGACCCCAGAGGGCTGAGGG + Intronic
1040582191 8:48707214-48707236 GTGTGACCCGGGTGGGATGTAGG + Intergenic
1044475404 8:92619319-92619341 GGGTGACTGCAGAGGGATGGTGG - Intergenic
1047868745 8:129059064-129059086 AAGTGACCCTAGAGGTATGAAGG - Intergenic
1049786090 8:144451527-144451549 GACTGTGCCCAGCGGGATGTGGG - Intronic
1049825158 8:144663036-144663058 GAGTGACCCAAGATGGATAATGG - Intergenic
1057298475 9:93862828-93862850 AATTGACCCCAGAGGGTTGCCGG + Intergenic
1060289776 9:122290869-122290891 GAGAAACCCCTGAAGGATGTTGG + Intronic
1060641383 9:125241709-125241731 GAGTGACCCCCCGGGGCTGTGGG + Intergenic
1062174294 9:135152482-135152504 GAGGGAGCACAGAGGGATGTAGG - Intergenic
1185867440 X:3636500-3636522 GGGAGGCCCCAGAGGGCTGTGGG + Intronic
1189254169 X:39624355-39624377 GAATGACCCCAAAGGCATTTTGG - Intergenic
1189973217 X:46438609-46438631 GAATGACCCCAAAGGGATTTCGG - Intergenic
1192051079 X:67724533-67724555 GAGTGACCCCAGAGCTGAGTTGG + Exonic
1192229255 X:69253840-69253862 GAGAGACCCCACATTGATGTAGG + Intergenic
1193129548 X:77905230-77905252 GAGTTACCCCAAAGGAATGGAGG + Exonic
1196733471 X:118963869-118963891 CAGTGACCCCCATGGGATGTGGG - Intergenic
1197262552 X:124333801-124333823 GAATGACCCCTGAAGGATTTTGG - Intronic
1200856369 Y:7942901-7942923 GAGTGACCTCAGAGGGGGGCTGG + Intergenic