ID: 1097221885

View in Genome Browser
Species Human (GRCh38)
Location 12:57455900-57455922
Sequence CAGGAGCAGCAGAGGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1347
Summary {0: 1, 1: 4, 2: 15, 3: 186, 4: 1141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097221885 Original CRISPR CAGGAGCAGCAGAGGGAGTG GGG Intronic
900162149 1:1228839-1228861 CAGGGGCAGAGGAGGAAGTGAGG + Exonic
900190237 1:1350005-1350027 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190253 1:1350045-1350067 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190269 1:1350085-1350107 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190285 1:1350125-1350147 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190301 1:1350165-1350187 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190317 1:1350205-1350227 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190333 1:1350245-1350267 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190349 1:1350285-1350307 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190365 1:1350325-1350347 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190397 1:1350405-1350427 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190413 1:1350445-1350467 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190429 1:1350485-1350507 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190445 1:1350525-1350547 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190461 1:1350565-1350587 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190477 1:1350605-1350627 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190493 1:1350645-1350667 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190509 1:1350685-1350707 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190525 1:1350725-1350747 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190541 1:1350765-1350787 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190557 1:1350805-1350827 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190573 1:1350845-1350867 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190589 1:1350885-1350907 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190605 1:1350925-1350947 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190621 1:1350965-1350987 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190637 1:1351005-1351027 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190653 1:1351045-1351067 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190669 1:1351085-1351107 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190685 1:1351125-1351147 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190717 1:1351205-1351227 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190733 1:1351245-1351267 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190749 1:1351285-1351307 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190765 1:1351325-1351347 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190781 1:1351365-1351387 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900190797 1:1351405-1351427 CAGGAGCGACGGGGGGAGTGAGG + Intergenic
900322226 1:2090495-2090517 AAGGAGCAGCTGAGGGTGAGGGG - Intronic
900400440 1:2470841-2470863 GAGGAGCTGCAGAGGGAGCCAGG - Intronic
900496661 1:2978875-2978897 CAGGTGCAGCTGAGGGAAAGGGG + Intergenic
900509821 1:3053379-3053401 CAGGAGCAAGAGAGAGAGCGGGG + Intergenic
900564213 1:3324414-3324436 CAGGAGCATCGCGGGGAGTGTGG - Intronic
900592771 1:3467385-3467407 AAGGAACAGCAGGGGGACTGTGG - Intronic
900648200 1:3718401-3718423 CCGGAGACCCAGAGGGAGTGGGG + Intronic
900741022 1:4330858-4330880 CAGGAGCTGCAAGGTGAGTGGGG - Intergenic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
900932829 1:5747619-5747641 AGGGAGGAGCAGAGGGAGGGAGG + Intergenic
901117046 1:6855457-6855479 CAGGAGCAAGAGAGAGAGAGAGG + Intronic
901144343 1:7054979-7055001 CAGGAGCAAGAGAGAGAGTGGGG + Intronic
901195089 1:7435940-7435962 CAGGAGCAGAGGAGGGAGCTGGG + Intronic
901288666 1:8104374-8104396 CGGCTGCAGAAGAGGGAGTGGGG - Intergenic
901744887 1:11365836-11365858 TAGAAGAAGCAGATGGAGTGAGG - Intergenic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
902295280 1:15462945-15462967 TAGAAGAAGCAGAGGGGGTGTGG - Intronic
902700767 1:18170218-18170240 CAGGGGCAGGGGAGGAAGTGAGG + Intronic
902703456 1:18188935-18188957 CTGCAGCAGCAGAGGGTTTGTGG - Intronic
902774662 1:18666949-18666971 CAGGATAGGCTGAGGGAGTGGGG + Intronic
903137591 1:21319525-21319547 TGGGGGCAGCAGAGGGAGTCTGG - Intronic
903373031 1:22849126-22849148 GTGCAGCAGCAGTGGGAGTGGGG - Intronic
904295636 1:29518000-29518022 CTGGAGCTGCCCAGGGAGTGGGG + Intergenic
904299209 1:29543273-29543295 CACCAGCAGCATATGGAGTGGGG - Intergenic
904396773 1:30227607-30227629 CAGGAGCTGCTGAGGGATGGAGG - Intergenic
904497240 1:30893808-30893830 GGGTAGCAGGAGAGGGAGTGTGG - Intronic
904909500 1:33923340-33923362 CAAGAGCAAGAGAGGGAGTGAGG - Intronic
905365864 1:37451229-37451251 CAGCAGCAGGAGAGGGTGTGGGG + Intergenic
905924402 1:41739578-41739600 CAAGAGAGGCAGAGGGGGTGGGG - Intronic
906400121 1:45498437-45498459 CAGGAGCTGCAGACTGAGTAAGG - Intronic
906588718 1:47003639-47003661 CAGGAGCAAGAGAGAGAGTAGGG + Intergenic
906860375 1:49352869-49352891 TAGTAGCAGCAGATGGAGTTGGG + Intronic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
907159667 1:52360933-52360955 CAGGAGCATCAGAGGCACAGGGG + Intronic
907298643 1:53471397-53471419 CAGGCGCAGCATGGGGAGTGTGG + Intergenic
907448022 1:54521808-54521830 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
907518666 1:55009140-55009162 CTGGAGGAGCAGAGAGAATGAGG - Exonic
907755192 1:57304192-57304214 CAGGAGCAGGAGAGAAGGTGGGG + Intronic
907844306 1:58189964-58189986 CAGGAGGGGAAGAGGGAGTGAGG - Intronic
907936743 1:59048510-59048532 CAGGAGCAAGAGAGGGAGTGGGG - Intergenic
907984666 1:59518670-59518692 CAGAAGCAAGAGAGAGAGTGGGG - Intronic
908076762 1:60528284-60528306 CAGGAACAAGAGAGAGAGTGAGG - Intergenic
908236529 1:62152362-62152384 AAGGAGCAGCAGTCTGAGTGCGG + Intronic
908416859 1:63921654-63921676 AAGGTGCGGCAGAGAGAGTGGGG + Intronic
908439667 1:64141346-64141368 CAGGAGCAAGAGAGTGAGTGGGG + Intronic
908586800 1:65578493-65578515 CAGGAGCTGCCCAGGGGGTGAGG + Intronic
908599054 1:65719311-65719333 CAGGGGCAGCTAAGGGAGTGTGG - Intergenic
908932548 1:69334412-69334434 CAGGATCAGCAGTGGCAGTGTGG + Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909528703 1:76657594-76657616 CAGGAGCAACAGAGAGAGAGGGG - Intergenic
909941996 1:81621891-81621913 CAGGAGCAGAGGAGGAAGTGAGG - Intronic
910138010 1:83995453-83995475 CAGGAGCAAGAGAGAGAGTGAGG - Intronic
910163227 1:84296592-84296614 GAGGAGCAGGAGAGGGAGAGAGG + Intergenic
910438700 1:87230869-87230891 CAGGAGCAGCTGGTGGAGTGAGG - Intergenic
910481201 1:87660298-87660320 CAGGAGCAAGAGAGAGAATGAGG + Intergenic
910512306 1:88021145-88021167 CAGGAGCAAGAGAGAGAGAGAGG + Intergenic
910696814 1:90027469-90027491 AAGAAGAAGCAGAGGAAGTGGGG + Exonic
910696843 1:90027592-90027614 TGGGAGAAGTAGAGGGAGTGGGG + Exonic
910725188 1:90330068-90330090 CAGGAGCAAAAGAGAGAGTTGGG - Intergenic
910747704 1:90591380-90591402 CAGGAGGAAGAGAGTGAGTGGGG + Intergenic
911630212 1:100174995-100175017 CAGGAGCAAAAGAGGGAGCAGGG - Intronic
912086506 1:106013122-106013144 CAGGAGCAGGAAACGAAGTGGGG + Intergenic
912464726 1:109864051-109864073 CAGGAGCTGGGGTGGGAGTGGGG - Intergenic
912502326 1:110130511-110130533 CAGGAGCAGCAGGGGGAGCCAGG + Intergenic
913037701 1:114988184-114988206 CAGAAGGAGAAGAGGGAGAGAGG + Intronic
913128065 1:115811666-115811688 CAGCAGTAGCATAGGTAGTGTGG - Intergenic
913216028 1:116621127-116621149 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
913458209 1:119055724-119055746 GAGGAGGAGAAGAGGGAGGGAGG + Intronic
914472432 1:147993418-147993440 CAGGATCAGAAGAGGAGGTGTGG - Intronic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
915403696 1:155643260-155643282 CAAAAGCAGGAAAGGGAGTGAGG - Intergenic
915444631 1:155967675-155967697 GCGGAGAAGCAGATGGAGTGTGG - Intronic
915461087 1:156070883-156070905 CAAGGGGAGAAGAGGGAGTGGGG + Intergenic
915461874 1:156075370-156075392 AAGGAGCAGGAAAGGGCGTGAGG - Exonic
915653399 1:157336432-157336454 CAGGAGCAAGAGAGAGAGAGGGG - Intergenic
915777344 1:158504474-158504496 CAGGAGCAAGAGACAGAGTGAGG + Intergenic
915835386 1:159171782-159171804 CAGGAGCAGGAGCAGGAGCGAGG - Exonic
916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG + Intronic
916851877 1:168712337-168712359 CAGGAGCAGGGGAAAGAGTGAGG - Intronic
917088037 1:171323324-171323346 CTTGAGCAGCAGCGGAAGTGAGG - Intronic
917199461 1:172499729-172499751 CAGGATCAACAGAGGGACTTAGG - Intergenic
917641519 1:176987560-176987582 CAGGAGAGGCAGAGAGGGTGAGG - Intronic
917967519 1:180187810-180187832 CAGTAGCAGCAGAGGCATCGGGG + Intronic
918315892 1:183322509-183322531 GAGGAGCAGGAGTAGGAGTGGGG - Intronic
918440192 1:184559274-184559296 CAGGAGCAGGAGAGAGAGTGGGG - Intronic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
918942974 1:191026209-191026231 CAGCAGCTGCAGAGGGGGCGCGG - Intergenic
919553953 1:199028574-199028596 CAAGAGCAGGAGAATGAGTGGGG - Intergenic
919674322 1:200366408-200366430 TAGGAGCAACAGGGGGAATGGGG + Intergenic
920162604 1:204010805-204010827 CAGGAGCAAGAGAGTGAGGGAGG - Intergenic
920185716 1:204158070-204158092 CAGAAGCAGAAGAGGAAGGGTGG - Intronic
920283050 1:204858636-204858658 GAGGGGGAGCGGAGGGAGTGAGG - Intronic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
920528947 1:206687767-206687789 CAGGAGAGGAAGATGGAGTGGGG + Intronic
920857597 1:209675627-209675649 CAGGAGGAGCAGCAGGAGAGGGG - Intronic
920936662 1:210441201-210441223 GAGGAACAGGAGAGGGACTGTGG + Intronic
920972501 1:210754609-210754631 CAGGAGCAATAGAGAGAGTTGGG - Intronic
920977492 1:210799868-210799890 CAGGGGCACCTGAGGGGGTGGGG - Intronic
920984450 1:210872650-210872672 TAGGAGCAAGAGAGAGAGTGGGG + Intronic
921369602 1:214407981-214408003 GAGAAGGAGCAGAGGCAGTGTGG - Intronic
921394482 1:214654068-214654090 CAGGAGGAGGAGGGGGAATGAGG - Intronic
921750124 1:218782533-218782555 CAGGAGCAAGAGAGAGAGAGGGG - Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921766595 1:218980068-218980090 CAGGAGGAAGAGAGAGAGTGGGG - Intergenic
921897392 1:220414621-220414643 CAGGAGTAAGAGAGAGAGTGTGG - Intergenic
922072050 1:222204291-222204313 GAGGAGCAGTAGAGGGAGAAAGG + Intergenic
922356291 1:224779521-224779543 CAGGAGCAGGAGAGAGAGGGTGG + Intergenic
922433697 1:225582161-225582183 CAGGAGCAAGAGAGAGAGAGGGG - Intronic
922571361 1:226636289-226636311 CAGGAGGAGCTGAGGGTCTGGGG + Intronic
922571746 1:226638439-226638461 CAGCAGCTGCAGAGCAAGTGGGG - Intronic
922660552 1:227426386-227426408 CAGGAGCAAGAGAGAGAGGGCGG + Intergenic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
922723102 1:227908887-227908909 CAGGAGCAGCACAGACCGTGAGG - Intergenic
922792069 1:228316265-228316287 CCGGAGCTGCAGAGGGGCTGAGG + Intronic
922800855 1:228364227-228364249 CAGAAGCAGCACAGGGACTATGG - Intronic
922987207 1:229874980-229875002 CAGGAGCTGGAGAGGAAGTGGGG + Intergenic
923041894 1:230325578-230325600 CAGGTGCTTCAGAGGGATTGAGG + Intronic
923042933 1:230332834-230332856 CCGGTGCAGCAGGGTGAGTGCGG - Exonic
923227036 1:231947959-231947981 CAGATGCTGGAGAGGGAGTGGGG + Intronic
923298157 1:232615169-232615191 CAGGGGCAGGAGATGGAGTGTGG - Intergenic
923653118 1:235892241-235892263 CAGGAGCTGCAGGGAGGGTGTGG - Intergenic
924331784 1:242946808-242946830 CAGAAGCAGCAGTGGCAGTATGG - Intergenic
924339679 1:243017099-243017121 CAGGAGGAGAAAAGTGAGTGAGG - Intergenic
924836377 1:247651823-247651845 CAGGAGCAACAGAGAGAGAGCGG - Intergenic
1062930006 10:1346693-1346715 CTGGAGCAGGAGACGGGGTGGGG - Intronic
1063470692 10:6282508-6282530 CCGTAGCAGCAGATGTAGTGAGG + Intergenic
1063659605 10:8025115-8025137 CGAGAGCTGCTGAGGGAGTGAGG + Intergenic
1065588362 10:27241441-27241463 GAGGAGCAGCCGAAGGAGAGAGG + Intronic
1065815642 10:29480255-29480277 CAGGGGCAGGGGAGGGAGAGAGG + Intronic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1065872932 10:29971480-29971502 CAGGAGCACGAGAGAGAGGGGGG + Intergenic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1065894927 10:30154815-30154837 CAGGAGGAAGAGAGGGAGTGGGG + Intergenic
1065957289 10:30704949-30704971 CAGGGGCAGGGGAGGGAGAGAGG - Intergenic
1065963866 10:30755048-30755070 CAGGAGGAGCACAGGGATGGAGG - Intergenic
1067099003 10:43321277-43321299 CAGGAGCAAGACAGGGAATGGGG - Intergenic
1067668714 10:48300688-48300710 CAGGAGCATCAGAGGGCCTCAGG + Intergenic
1067693629 10:48520114-48520136 CAGAAGAGGCAGTGGGAGTGCGG + Intronic
1067741382 10:48898254-48898276 CCTGAGCAGCAAAGGGAGTAGGG + Intronic
1068008681 10:51420883-51420905 TAGGAGTAAGAGAGGGAGTGGGG + Intronic
1068658949 10:59603676-59603698 CAGGAGCAAGAGAGTGAGGGGGG + Intergenic
1069038499 10:63670308-63670330 CAGGAGCCAAAGAGGGAGGGAGG - Intergenic
1069583047 10:69578108-69578130 CAGGAGCCGCGCAGGGAGCGGGG + Intergenic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069836072 10:71308958-71308980 GAGGAGGAGAAGAGGCAGTGTGG - Intergenic
1069910430 10:71755498-71755520 CAGGAGGAGCAATGGGAATGGGG - Intronic
1069994997 10:72336514-72336536 GAGAAGCAGCAGAGTGAGTGTGG - Exonic
1070328391 10:75402135-75402157 AAGGAGCACCGGTGGGAGTGTGG + Intergenic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1070480657 10:76879337-76879359 CCAGAGCAGGAGAGGGGGTGGGG - Intronic
1071086739 10:81874975-81874997 CAGCAGCAGCAGCGGGCGCGGGG + Intergenic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1072014709 10:91335418-91335440 CAGGAGAAAAAGAGAGAGTGGGG - Intergenic
1072197092 10:93125599-93125621 CAGGAGCGAGAGAGAGAGTGGGG + Intergenic
1072222342 10:93336985-93337007 CAGGAAGGGAAGAGGGAGTGAGG + Intronic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072806378 10:98426156-98426178 CAGGAGCAGCTGAGGGAGAGGGG - Intronic
1072887114 10:99287482-99287504 TGGGAGCAGCAGTGGGTGTGAGG + Intergenic
1073253905 10:102138959-102138981 AGGCAGCAGTAGAGGGAGTGGGG + Exonic
1073478037 10:103767233-103767255 CTGGAGCAGTGGAGTGAGTGGGG - Intronic
1073773274 10:106758857-106758879 CAAGAGCACCAGAGGGAGAGAGG + Intronic
1074214233 10:111368795-111368817 CAGGAGCAAGAGAGTGAATGGGG + Intergenic
1074540625 10:114362555-114362577 TAGAATCAGCAGAGGGAGCGCGG + Intronic
1074693898 10:116030476-116030498 CAGGAACAGAACAGGAAGTGAGG - Intergenic
1074737496 10:116451632-116451654 CAGGAGCAAGAGAGTAAGTGGGG - Intronic
1074881946 10:117666479-117666501 CAGGGACAGCAGAGGGTGTGTGG + Intergenic
1074905702 10:117861711-117861733 CAGGAGCAAGAGAGAGAGTCGGG + Intergenic
1075121681 10:119669255-119669277 CAGAGGCAGCATAGGGAGAGAGG - Intronic
1075206954 10:120456825-120456847 CAGGAGCTGCAGAGGGGCCGCGG + Intergenic
1075343016 10:121662192-121662214 CAGGCTCAGCAGAGGAATTGGGG + Intergenic
1075442886 10:122493811-122493833 GAGGAGGGGCAGAGAGAGTGAGG - Intronic
1075465946 10:122650210-122650232 GAGGAGCAGGAGAGGGAATTTGG - Intergenic
1075581158 10:123619619-123619641 CGGGAGCAGCACAGGGAGTGTGG - Intergenic
1075737924 10:124675406-124675428 CCAGAGCAGCAGAGGGTGTGGGG + Intronic
1075980742 10:126737030-126737052 AAGGAGCAGCAGAGAGAAGGAGG - Intergenic
1076128847 10:127997360-127997382 CAGCAGCAGCAGAGGGACTTGGG - Intronic
1076287318 10:129312876-129312898 AAGGAGCATGAGAGAGAGTGGGG + Intergenic
1076331794 10:129675704-129675726 CAGCAGCAGCAGTGGGTGTGTGG - Intronic
1076338663 10:129727965-129727987 CTGGAGCAGGGGAGGGTGTGAGG + Intronic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076532796 10:131155799-131155821 TGGGAGCAGCCCAGGGAGTGGGG - Intronic
1076546897 10:131251341-131251363 AGGAAGCAGCAGAGGGAGAGGGG - Intronic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1077012012 11:383219-383241 CAGGAGGAGATGAGGGAGAGAGG - Intergenic
1077061843 11:620992-621014 CAGGATCAGGAGAGGAAGGGCGG - Intronic
1077124611 11:926737-926759 CACGAGCAGCAGTCGGGGTGTGG + Intronic
1077131210 11:973677-973699 CTGGTGCAGGAGAGGGAGGGTGG + Intronic
1077162697 11:1120994-1121016 CAGGAGCAGGAGTGAGGGTGAGG - Intergenic
1077220585 11:1413767-1413789 CAGGAGGGGCTGATGGAGTGGGG - Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077332961 11:1991325-1991347 CAGGAGCAGGCCAGGGAGCGGGG + Intergenic
1077362207 11:2145703-2145725 GAGGAGCAGGTGGGGGAGTGGGG + Intronic
1077528144 11:3081088-3081110 CAGGAGCTGGAGAGGTGGTGAGG + Intergenic
1077529494 11:3088476-3088498 CAGGGGCAACAGAGCGGGTGGGG + Intronic
1077631982 11:3817153-3817175 CAGGAGCAGCAGAGACAGGCAGG - Intronic
1077782591 11:5347791-5347813 AGGGAGCAGAAGAGGGAGGGAGG + Intronic
1078376128 11:10794746-10794768 CAGGAGCAGCAAATCCAGTGTGG + Intergenic
1078473509 11:11610843-11610865 AAGGAGCTGCAGAGGAAGGGAGG - Intronic
1078758411 11:14232921-14232943 CAGAGGCCGCAGAGGTAGTGGGG + Intronic
1078759869 11:14243226-14243248 CAACAGCAGGTGAGGGAGTGGGG + Intronic
1078964502 11:16322333-16322355 CAGGAGGAAGAGAGAGAGTGGGG - Intronic
1079151000 11:17899004-17899026 CAGGAGCAGGAGAGAGAAGGAGG - Intronic
1079169702 11:18081140-18081162 CAGGAGGAGGGGAGGGAGAGAGG - Intronic
1079178758 11:18169652-18169674 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1079270076 11:18976265-18976287 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1079552361 11:21715538-21715560 CAGGAGCAGGAGAGTAAGGGGGG - Intergenic
1079739462 11:24038432-24038454 CAGGAGCAAGAGAGAGAGGGTGG + Intergenic
1080061096 11:27957672-27957694 CAGGAGCAAGAGAGAGAGAGTGG + Intergenic
1080180868 11:29424685-29424707 CAGGAGCAAGAGAGAAAGTGTGG + Intergenic
1080387110 11:31816794-31816816 CAGGAGCGCGAGTGGGAGTGGGG + Intronic
1080772583 11:35355548-35355570 CACCAGCTGTAGAGGGAGTGAGG + Intronic
1081424815 11:42914418-42914440 CAGGAGCAAGAGAGCGAGAGGGG + Intergenic
1081465804 11:43315728-43315750 AAGGAGTAGCAGAGGCAGAGTGG - Intronic
1081655280 11:44853207-44853229 GAGGGGCAGCAGAGAGACTGTGG + Intronic
1081868452 11:46372356-46372378 TGGGAGCAGCAGAGGGAGAGGGG - Intronic
1082176511 11:49066254-49066276 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1082779884 11:57278852-57278874 CAGGAGGAAGAGAGAGAGTGGGG + Intergenic
1083270421 11:61569500-61569522 CTGGGGCAGCAGAGGGAGCCAGG + Intronic
1083724087 11:64619364-64619386 CAAGAGCAGCTGGGGGAGGGTGG - Intronic
1083829137 11:65219923-65219945 TGGCAGCAGCAGAGGCAGTGAGG + Intergenic
1084026888 11:66456155-66456177 CTGGAGCAGGGGAGGGAGGGAGG + Intronic
1084045363 11:66564877-66564899 CAGAACGAGCAGAGTGAGTGAGG - Exonic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1085410714 11:76288790-76288812 CGGGAGGAGCAGAGGAAGTAAGG + Intergenic
1085417734 11:76330398-76330420 CAGGAACAGCAAAGGGCGTGAGG - Intergenic
1085837503 11:79972565-79972587 AATTAGCAGGAGAGGGAGTGAGG + Intergenic
1086365790 11:86109293-86109315 CAGGAGCAAGAGAGAGAGTTGGG + Intergenic
1086689202 11:89769621-89769643 CAGGAGCAGCAGAAGCTGTAAGG + Intergenic
1086716656 11:90070350-90070372 CAGGAGCAGCAGAAGCTGTAAGG - Intergenic
1087058362 11:93955185-93955207 CCAGAGCACCAGAGGGAGTGTGG + Intergenic
1087303071 11:96457875-96457897 CAGGGGCAAGAGAGAGAGTGGGG - Intronic
1088073745 11:105821529-105821551 CAGGAGCAAGAGAGAGAGGGCGG + Intronic
1088077098 11:105863613-105863635 CAGGGGCAGGAGTGGGAGGGAGG - Intronic
1088460410 11:110076451-110076473 CAGGAGCAAGAGAGAAAGTGGGG + Intergenic
1088757290 11:112896314-112896336 CAGGAGCAGGAGTGGGAGGTGGG - Intergenic
1089153880 11:116385855-116385877 CGGGGGCAGGAGTGGGAGTGGGG - Intergenic
1089175853 11:116548300-116548322 ATGGAGCAGCTGAGGGAGAGTGG - Intergenic
1089260074 11:117218220-117218242 AAGGAGCAGCAGAGCAACTGAGG - Intronic
1089283609 11:117391712-117391734 CTGGAGTAGAAGAGGGAGTATGG - Intronic
1089928159 11:122281028-122281050 CAGGAGCAGTCAAGGGGGTGGGG - Intergenic
1090627184 11:128617562-128617584 AAGGAGCAGCTGAGAGAATGTGG + Intergenic
1202815944 11_KI270721v1_random:46501-46523 CAGGAGCAGGCCAGGGAGCGGGG + Intergenic
1091586556 12:1820236-1820258 CAGGTGCAGCCGGGGGGGTGAGG + Intronic
1091696810 12:2633324-2633346 CAGGGGCAGGAGTGGGTGTGGGG - Intronic
1091780694 12:3212951-3212973 GTGGACAAGCAGAGGGAGTGGGG + Intronic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1091854534 12:3728745-3728767 GTGGAGCAGCAAAGGGAGGGAGG + Intronic
1092112098 12:5971116-5971138 CAGAAATAGCAGAGGGACTGTGG + Intronic
1092469452 12:8764959-8764981 CAGGAGGAGCAGGTGGAATGGGG - Intronic
1092564682 12:9651542-9651564 CAGGAGGAAGAGAGGAAGTGAGG + Intergenic
1092597242 12:10021051-10021073 CAGGAGCAGGAGAGAGGGTGTGG - Intergenic
1092776374 12:11948143-11948165 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1092811609 12:12276116-12276138 CAGGAGAAAGAGAGAGAGTGAGG + Intergenic
1092943949 12:13436036-13436058 GAGGAAGGGCAGAGGGAGTGGGG - Intergenic
1093092638 12:14938505-14938527 CAGGAGCAGGAGAGGGACAATGG - Exonic
1093465022 12:19440029-19440051 CAGCAGCAGCGGCGGGGGTGAGG + Exonic
1093465045 12:19440134-19440156 CAGCAGCAGCAGCGGGGATGGGG + Exonic
1093661170 12:21758608-21758630 CAGGAGCAGCAGGAGAAGTATGG - Intergenic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1094169937 12:27480706-27480728 CAGGAGCAAGAGAGAGAGAGGGG - Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1094408225 12:30141815-30141837 TAGGAGCAAGAGAGAGAGTGGGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094840119 12:34339344-34339366 CATGAGCGGCAGGGGGAGCGTGG - Intergenic
1095227446 12:39694763-39694785 CTGGGGCAGCTAAGGGAGTGTGG + Intronic
1095871258 12:47030652-47030674 CAGGAGGAATAGAGAGAGTGGGG - Intergenic
1095986912 12:48004911-48004933 AAGGAGCAGCGGAGGGCGAGGGG + Intergenic
1096028146 12:48386230-48386252 CAGGAACAGCACAAAGAGTGGGG + Intergenic
1096087367 12:48874726-48874748 CAGGAGCACCGGAGTGAGTTGGG + Intergenic
1096782549 12:53999536-53999558 CAGGAGCAGCAGGGGCGGTGAGG - Intronic
1097140617 12:56899970-56899992 CAGGAGCAGCAGTGGTGGTGGGG + Intergenic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097259360 12:57707452-57707474 CAGGAGCAAAAGAGAGAGGGGGG + Intronic
1097744083 12:63280527-63280549 AAGGAGGAGGAGAGGGAGAGAGG + Intergenic
1097928280 12:65155905-65155927 CAGGAGCAAGAGAGTGAGGGGGG + Intergenic
1098142983 12:67469607-67469629 CTGGGGCAGCCAAGGGAGTGTGG - Intergenic
1098435239 12:70461512-70461534 CAGGGGGAAGAGAGGGAGTGGGG - Intergenic
1098644268 12:72879525-72879547 CAGGAGCAAGAGAGAGAGAGGGG + Intergenic
1098991383 12:77067707-77067729 CAAGAGCCCCAGAGGGAGTGTGG - Intergenic
1099714515 12:86274105-86274127 AAGGAGCAACAAAGAGAGTGAGG + Intronic
1100026619 12:90136728-90136750 CAGGAGCAGTAAAGAGAGAGAGG + Intergenic
1100142637 12:91636929-91636951 CAGGAGCAAGAGAGAGAGAGGGG - Intergenic
1100199098 12:92279337-92279359 CAGGAGGATCAGAGGGAATCAGG + Intergenic
1100226450 12:92561251-92561273 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1100737045 12:97546950-97546972 CAGGAGCTGGAGAGGGTGAGAGG - Intergenic
1100915934 12:99421925-99421947 CAGGAGCAAGAGAGAGAGTGGGG - Intronic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101286039 12:103313717-103313739 CAGGAGCTACAGAGGGAGAGAGG - Intronic
1101755344 12:107617072-107617094 GAGGAGCTGCAGAGGAAGAGCGG - Exonic
1101791728 12:107933773-107933795 CAGGAGCAAGAGGGAGAGTGGGG + Intergenic
1102028427 12:109726626-109726648 CAGGAGCAGCAGGGGGGCTCAGG + Intronic
1102734110 12:115142757-115142779 CAGGAGAAGCAGGGGAAGAGAGG - Intergenic
1102781690 12:115571077-115571099 CAGGAGGTCCAAAGGGAGTGGGG + Intergenic
1102893639 12:116581136-116581158 CAGGAGCAAGAGAGAGAGTGAGG - Intergenic
1103221898 12:119253169-119253191 GTGCAGCAGCAGAGGGAATGAGG - Intergenic
1103281114 12:119758740-119758762 CAGGAGTAACAGGGGCAGTGCGG + Intronic
1103613514 12:122138112-122138134 CAGGATCAGCGTAGGGGGTGAGG + Intronic
1103635033 12:122297675-122297697 CAGGAGCAGAAGTCGGTGTGTGG - Intronic
1103857595 12:123984271-123984293 CAGAAGGAGCCAAGGGAGTGTGG + Intronic
1103900847 12:124302967-124302989 CAGGAGCAGCAACGGGGGAGGGG + Intronic
1104063475 12:125287171-125287193 CAGAAGCAGAGGAGGGAGGGAGG - Intronic
1104370071 12:128216553-128216575 CAGGAGCAAGAGCGTGAGTGGGG - Intergenic
1104620845 12:130311872-130311894 CAAGGGCAGGAGAGGGACTGGGG - Intergenic
1104900847 12:132188863-132188885 CAGGAGCAGGAGGGAGGGTGGGG + Intergenic
1104926659 12:132317355-132317377 AAGGAGCAGGAGAGAGGGTGTGG - Intronic
1105602780 13:21901942-21901964 CAGGAGCAGCATGGGGCATGTGG + Intergenic
1105705678 13:22966221-22966243 GTGCTGCAGCAGAGGGAGTGGGG + Intergenic
1105858581 13:24391206-24391228 GTGCTGCAGCAGAGGGAGTGGGG + Intergenic
1107018254 13:35726098-35726120 CAGGAGAAGAACAGGGGGTGGGG + Intergenic
1107230867 13:38108705-38108727 CAGGAGCAAGAGGGAGAGTGAGG + Intergenic
1107343673 13:39437410-39437432 CAAGAGGAAAAGAGGGAGTGGGG - Intronic
1107649874 13:42534535-42534557 CAGCAGCATCAGATGGATTGTGG + Intergenic
1107709964 13:43141864-43141886 GAGGAGCAGCAAGGGGAGTCAGG + Intergenic
1107945998 13:45418246-45418268 CAGGAGCCGCAGAGAAAGCGGGG + Intronic
1108030618 13:46225398-46225420 CAGTAGCAGAAGTGGGTGTGTGG + Intronic
1108076078 13:46680930-46680952 CAGGAGTAGCTGGGGGTGTGTGG + Intronic
1108271223 13:48761392-48761414 CAGAAGCACCAAAGGGAATGGGG - Intergenic
1108956545 13:56165884-56165906 CAGGAGAAAGAGATGGAGTGGGG + Intergenic
1109037799 13:57287114-57287136 GAGGAGGTGCAGAGGGAGCGAGG + Intergenic
1109252313 13:60033545-60033567 CAGGAGCAAGAAAGAGAGTGTGG + Intronic
1109311494 13:60699717-60699739 CAGAAACAGCAGAATGAGTGGGG - Intergenic
1109711161 13:66162476-66162498 CAGGAGCAAGAAAGAGAGTGGGG - Intergenic
1109856223 13:68131395-68131417 CAGGAGCAGGAGGAAGAGTGGGG + Intergenic
1110448939 13:75619217-75619239 CAGGAGCAAGAGAGAGGGTGAGG + Intergenic
1110574199 13:77037369-77037391 CAGGAGAAACAGACTGAGTGGGG - Intergenic
1110628227 13:77675958-77675980 CAGAAGCAGCAGAAGCAGTAAGG + Intergenic
1110848539 13:80217920-80217942 CAGGAGGAGTAGGGGGATTGAGG + Intergenic
1110852200 13:80258646-80258668 CAGGAGAAAAAGAGGGAGAGTGG + Intergenic
1110901710 13:80833301-80833323 CAGGAGAAGGAGAGAGAGTGGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111746018 13:92270413-92270435 CAGGAGCAGGAGAAAGAGAGAGG - Intronic
1112201865 13:97284257-97284279 CAGGGGCTTCAGAGGGAGCGTGG - Intronic
1112343532 13:98572030-98572052 CTGGAGCTGAAGAGGCAGTGGGG - Intronic
1113409325 13:110070642-110070664 CAGGAGCAGCAGATGCTCTGTGG + Intergenic
1113447240 13:110378944-110378966 CAGGAGCCGGAGAGTGCGTGAGG - Intronic
1114188627 14:20423408-20423430 CAGGAGCAAGAAAGAGAGTGAGG + Intergenic
1114191690 14:20444014-20444036 CAGTGGCAGCAGTGGAAGTGAGG + Intergenic
1114266754 14:21076822-21076844 GAGGAGCTGCAGTGGGAGTTAGG + Exonic
1114277254 14:21158027-21158049 GGGGAGCAGAAGAGAGAGTGTGG - Intergenic
1114664404 14:24369464-24369486 GAAGAGGAGCAGAGGGAGAGGGG - Intronic
1114672130 14:24416965-24416987 CAGGTGCAGCAAAGGCAGGGAGG - Exonic
1115374091 14:32653458-32653480 CAGGAGCAAGTGAGAGAGTGAGG - Intronic
1115399379 14:32939706-32939728 CGGGAGCAGCAGCGAGGGTGGGG + Intronic
1115594674 14:34897917-34897939 AAGGGGCAGGAGAAGGAGTGGGG - Intergenic
1116475344 14:45332794-45332816 CAGGAGCAGTAGAGGGAGATTGG + Intergenic
1116524775 14:45891121-45891143 GAGGAGCAGGAGAGAGAGGGAGG - Intergenic
1117021290 14:51573391-51573413 AAGGAGCAGGAGAGAGAGAGGGG + Intronic
1117050037 14:51850780-51850802 CAGGAGCAAGAGAGAGAGAGTGG + Intronic
1117497518 14:56320128-56320150 CAGAAGCAAGAGAGGGAGCGGGG - Intergenic
1117656395 14:57960831-57960853 CAGGAGCTGCAGAGGGACCTGGG - Intronic
1117794640 14:59379714-59379736 CAGGAGAGTCAGAGGGAGAGAGG + Intergenic
1118116780 14:62786918-62786940 CAGGAGAGGAAGAGGGAGTTGGG - Intronic
1118686020 14:68292028-68292050 CAGGAGGTGGAGAGGCAGTGGGG - Intronic
1119188226 14:72660036-72660058 CAGGAGCTGGGGAGGGAATGGGG + Intronic
1119252781 14:73171178-73171200 CAGGAGCAGTTGAGAGAGCGAGG + Intronic
1119402370 14:74371961-74371983 CAGCTGCAGCACAGGGAGAGTGG - Intergenic
1119474069 14:74917105-74917127 CAGGAGAAGCAGCTGGAGTAAGG + Intronic
1119616225 14:76100743-76100765 CAGGGGCAGGAGAGGGGGTGCGG + Intergenic
1119633529 14:76255230-76255252 CAGGAGCAAGAGAGTGAGTGGGG - Intergenic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120464078 14:84833693-84833715 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1120886347 14:89454889-89454911 CTGGAGAAGGAGAGGGAGTGGGG + Intronic
1120902520 14:89588160-89588182 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1120993291 14:90397194-90397216 GAGGAAGAGCAGAGGGAGCGAGG - Exonic
1121008640 14:90506738-90506760 CAGCAGCAGCTGAGTGATTGGGG + Intergenic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1121481226 14:94276538-94276560 CAGGAGCAGGAGAGAGAAAGTGG + Intronic
1121720885 14:96107934-96107956 CAGGTGCACCTGAGGGACTGGGG - Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122027690 14:98889449-98889471 CAGGAGCAGGAAAGCCAGTGGGG + Intergenic
1122059910 14:99130126-99130148 CAGGGGAAGGAGAGGGCGTGGGG - Intergenic
1122419053 14:101564024-101564046 TAGGAGCCGCAGCTGGAGTGAGG - Intergenic
1122794649 14:104200116-104200138 CAGGAGCTGCGGTGGGGGTGAGG + Intergenic
1122977837 14:105178255-105178277 CAGGAGCAGATGAGGAAGGGTGG + Intronic
1123168511 14:106349181-106349203 CAGGACCAGCAGGGGGCGCGCGG - Intergenic
1123176197 14:106421607-106421629 CAGGGCCAGCAGGGGGCGTGCGG - Intergenic
1123222828 14:106872728-106872750 CAGGACCAGCAGGGGGCGCGCGG - Intergenic
1123222891 14:106873024-106873046 CAGGTGCAGCTGCAGGAGTGGGG - Intergenic
1123440798 15:20289719-20289741 CAGGGGCAGCAGGTGGAGAGCGG + Intergenic
1123579430 15:21703251-21703273 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123584153 15:21742262-21742284 CAGGACCAGCAGGGGGCGCGGGG - Intergenic
1123616057 15:22145762-22145784 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123620803 15:22184865-22184887 CAGGACCAGCAGGGGGCGCGGGG - Intergenic
1123961359 15:25404807-25404829 TAGAAGCAGCATAGGGAGTAGGG - Intronic
1123962592 15:25421205-25421227 CAGGAGCAAGAGAGAGGGTGGGG - Intronic
1124126171 15:26939609-26939631 CAGAAGCAGGCGAGGGAGTGGGG + Intronic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124180818 15:27471899-27471921 CAGGAGAAGTACAGTGAGTGGGG - Intronic
1124203640 15:27699081-27699103 CAGGAGTTACAGAGAGAGTGTGG - Intergenic
1124427441 15:29573701-29573723 CAGGAGAAGGAGAGGAAGAGGGG - Intergenic
1124971179 15:34490678-34490700 GAGGAGCAGCAGAGGCGGTCGGG - Intergenic
1125263635 15:37854706-37854728 CAGGAGCAACAGAGAGAGTGGGG - Intergenic
1125510414 15:40289675-40289697 CAGGGGATGAAGAGGGAGTGAGG - Intronic
1125720269 15:41841991-41842013 GAGGAGGTGCAGAGGGAGGGAGG - Intronic
1125795793 15:42403095-42403117 CAGGAGCAGCAGAAGGACCCTGG - Intronic
1126179792 15:45773958-45773980 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
1126851321 15:52798774-52798796 GAGGAGAAACAGAGGGGGTGGGG + Intergenic
1126955965 15:53934086-53934108 CAAGAGCAAGAGAGAGAGTGAGG + Intergenic
1128081024 15:64856990-64857012 CTGGAGAAGCAGGGGGAGAGGGG - Intronic
1128211093 15:65903036-65903058 CAGGAAGAGAAGAGGCAGTGTGG - Intronic
1128311063 15:66632043-66632065 CAGGAGCCCCAGTGGGGGTGGGG + Intronic
1128530422 15:68441465-68441487 CAGGAGCAGCTGGGGTAGTCTGG - Intergenic
1128684270 15:69672032-69672054 GAGGGGCAGCAGCAGGAGTGTGG + Intergenic
1128712086 15:69879595-69879617 CAGAAGGAGCACAGGGATTGGGG - Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128850888 15:70954858-70954880 CAGGGGCAGCAGGGGCACTGTGG + Intronic
1129461365 15:75701614-75701636 AAGGAGGGCCAGAGGGAGTGTGG - Intronic
1129685355 15:77683146-77683168 GGGGAGAAGCAGAGTGAGTGTGG + Intronic
1129723469 15:77890193-77890215 AAGGAGGGCCAGAGGGAGTGTGG + Intergenic
1130109185 15:80950603-80950625 GAGGCCCAGCAGAGGGAGTAGGG + Exonic
1131135702 15:89933518-89933540 CAGGGGCAGGAGTGGGAGGGAGG + Intergenic
1131261525 15:90890398-90890420 CAGGAGCAGGAGCGAGAGGGGGG + Exonic
1131291654 15:91111855-91111877 CAGGAGCAAGAGAGAGAGAGGGG + Intronic
1131327613 15:91463487-91463509 CAGGAGCAAGAGAGAGAGCGAGG - Intergenic
1131439747 15:92450578-92450600 CAGGAGCAAGAGAGAGAGGGAGG + Intronic
1131654426 15:94440907-94440929 CAGGAGCAGGAGAGTCAGAGTGG - Intronic
1131946180 15:97624417-97624439 CAGGAGAAATAGAGCGAGTGGGG - Intergenic
1132373104 15:101311425-101311447 CAGGAGCAAGAGAGGGAAGGAGG - Intronic
1132400292 15:101501078-101501100 CAGGAGGAGAAGAGGCAGAGGGG + Intronic
1202988300 15_KI270727v1_random:437496-437518 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1132550831 16:553245-553267 CAGGGGCAGGAGCAGGAGTGGGG - Intronic
1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG + Intergenic
1132681309 16:1143190-1143212 TAGCAGCAGCAGTGGCAGTGAGG - Intergenic
1132684887 16:1158198-1158220 CAGGATCAGCTGTGGGGGTGGGG - Intronic
1133436484 16:5784472-5784494 CAGGAGCAGCAGAGAGACGGGGG + Intergenic
1133531998 16:6663830-6663852 CAGGTGCAGAGGAGGGAGTCTGG + Intronic
1133646908 16:7773266-7773288 CAGGAGCAAGAGAAAGAGTGGGG + Intergenic
1133662224 16:7929316-7929338 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
1133771009 16:8867274-8867296 CAGGGGTCACAGAGGGAGTGGGG - Intronic
1133781188 16:8940648-8940670 CAGGAGCTTCTTAGGGAGTGTGG - Intronic
1133893939 16:9907807-9907829 ATGGAGCTGCAGAGGAAGTGAGG - Intronic
1134753143 16:16642378-16642400 CAGGAGCGAGAGAGAGAGTGTGG + Intergenic
1135784897 16:25340041-25340063 GAGGAGCAAGAGAGGGAGGGGGG - Intergenic
1135815341 16:25627463-25627485 CAGGAGCAAGAGAGGGAGGGAGG + Intergenic
1135937521 16:26793668-26793690 AAGGAGCAGAAGAGGGAGGGAGG - Intergenic
1136030051 16:27496113-27496135 CAGGAGCAAGAGAGAGAGTTGGG - Intronic
1136405083 16:30040601-30040623 TAGGAGAGGCAGAAGGAGTGAGG + Intronic
1136406468 16:30050793-30050815 CAGGAGCAGCAGCTGTGGTGAGG + Intronic
1136455487 16:30377725-30377747 CCGGAGCAGCAAAGGGGCTGGGG + Intronic
1136714923 16:32271073-32271095 CAGGAGCAACACAGAGAGCGAGG + Intergenic
1136726057 16:32358671-32358693 CAGGGGCAGCAGGTGGAGAGTGG - Intergenic
1136752992 16:32658656-32658678 CAGGAGCAACACAGAGAGCGGGG - Intergenic
1136815121 16:33211708-33211730 CAGGAGCAACACAGAGAGCGGGG + Intronic
1136821597 16:33321788-33321810 CAGGAGCAACACAGAGAGCGGGG + Intergenic
1136828160 16:33378327-33378349 CAGGAGCAACACAGAGAGCGGGG + Intergenic
1136833226 16:33477098-33477120 CAGGAGCAACACAGAGAGCGGGG + Intergenic
1137343760 16:47636316-47636338 CAGCTGCAGCAGGGGAAGTGTGG + Intronic
1137385665 16:48040481-48040503 CAGGAGCAAGAAAGAGAGTGGGG + Intergenic
1138169243 16:54833530-54833552 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
1138193616 16:55036263-55036285 CAAGTGGAGCAGTGGGAGTGTGG + Intergenic
1138461587 16:57151546-57151568 GAGGAGCAGCAGAAACAGTGGGG + Intergenic
1138510415 16:57505437-57505459 CATGGGCAGCAGATGCAGTGGGG + Intergenic
1139373847 16:66484660-66484682 CAGGAGTACCAGATGGAGTGAGG + Intronic
1139613060 16:68072689-68072711 CTAGAGCAGCATAGGGGGTGGGG + Intronic
1139653345 16:68373552-68373574 CAGGAGGAGGAGAGGGTGTGGGG - Intronic
1140220888 16:73043043-73043065 CAGGAGTAGGGGTGGGAGTGCGG + Intronic
1140523554 16:75603076-75603098 CAGCATCACCTGAGGGAGTGTGG + Exonic
1140686473 16:77438306-77438328 TAAGAGGAGCAGAGGGAGGGAGG + Intergenic
1140775838 16:78248275-78248297 CAGGAGCAAGAGAGGGAGCAAGG + Intronic
1140916798 16:79501116-79501138 CAGGGTCTCCAGAGGGAGTGTGG - Intergenic
1141188686 16:81807832-81807854 CAGGAGCAAGAGAGAGAGGGAGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141578474 16:84981162-84981184 CAGGAGCAGAAAAAGGAGTCAGG + Intronic
1141703857 16:85654289-85654311 CAGGAGCAGCAGTGGAGGTCGGG + Exonic
1141980951 16:87550390-87550412 CAGGGGCCGAAGAGGGAGTCAGG - Intergenic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1142265542 16:89062572-89062594 CAGGGGCAGGGGAGGGAGTGAGG + Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142280909 16:89147137-89147159 GAGGAGCCACAGAGTGAGTGAGG + Intronic
1142305677 16:89283603-89283625 CGGGAGGAGCTGAAGGAGTGTGG - Exonic
1202993698 16_KI270728v1_random:34683-34705 CAGGAGCAACACAGAGAGCGGGG + Intergenic
1203000374 16_KI270728v1_random:159085-159107 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1203055129 16_KI270728v1_random:918696-918718 CAGGAGCAACACAGAGAGCGAGG - Intergenic
1203131976 16_KI270728v1_random:1695488-1695510 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1203154556 16_KI270728v1_random:1865015-1865037 CAGGGGCAGCAGGTGGAGAGTGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142899614 17:3003998-3004020 CTGGAGGAGGAGGGGGAGTGGGG + Intronic
1143141982 17:4745906-4745928 CAGGAGGAGCAGAGGGAGTTGGG - Exonic
1143364382 17:6396336-6396358 AAGGAGCAGCTGAGAGAGTACGG + Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143387929 17:6543183-6543205 CGGGGCCAGGAGAGGGAGTGGGG - Intronic
1143432385 17:6896531-6896553 CTAGAGCAGGAGAGAGAGTGGGG - Intronic
1143629597 17:8130460-8130482 CAGGAAAACCAGGGGGAGTGGGG + Intergenic
1143730822 17:8881778-8881800 CAGGAGGAGCTGGGTGAGTGGGG - Exonic
1143964522 17:10747482-10747504 AAGCAGCAGCAGAGGGAGCGAGG - Intergenic
1144424187 17:15125917-15125939 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
1144550902 17:16240167-16240189 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
1144591498 17:16527958-16527980 CAGGTGCAGCAAGGGCAGTGAGG + Intergenic
1144728885 17:17515414-17515436 GAGGAGCAGCTGGGGGACTGAGG - Intronic
1144763048 17:17718127-17718149 CAGGGGAAGCAGGGGGAGAGGGG - Intronic
1144785107 17:17827150-17827172 TAGGAGGAGCGGAGGCAGTGAGG + Intronic
1145006457 17:19341350-19341372 CAGGAGCAGCTGAGGGTGCTGGG + Intronic
1145741134 17:27275617-27275639 CAGGAGCGGAAGTGGGAGAGAGG + Intergenic
1145826207 17:27878941-27878963 CAGGAGCAGAGGAGGGGGCGGGG + Exonic
1145840530 17:27990433-27990455 CAGGAGCAAGAGAGGGAGAGTGG - Intergenic
1145971993 17:28961578-28961600 CAGGAACGGCAGTGGTAGTGAGG - Intronic
1146175134 17:30661264-30661286 CAGGAGCAGGAGAGAGAATGGGG + Intergenic
1146348585 17:32077298-32077320 CAGGAGCAGGAGAGAGAGTGGGG + Intergenic
1146624393 17:34424670-34424692 GACGAGCAGCAGAGGGAATGTGG - Intergenic
1146685298 17:34837397-34837419 CAGGCCCAGCAGAGAGATTGAGG + Intergenic
1146828562 17:36046613-36046635 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
1146927564 17:36755475-36755497 GAGGGGGTGCAGAGGGAGTGGGG + Intergenic
1146966772 17:37037911-37037933 CAGGAGCAAGAGAGAGAGTGGGG - Intronic
1147340525 17:39750975-39750997 CAGGGGTCGCAGAGGGAGTTCGG + Intergenic
1147463823 17:40594667-40594689 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
1147535659 17:41320880-41320902 CAGGAGGAAGAGAGAGAGTGGGG + Intergenic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148087130 17:45001046-45001068 CAGGAGCAGCAAAGGGAGTGGGG + Intergenic
1148227992 17:45912551-45912573 TTGGAGCTCCAGAGGGAGTGTGG + Intronic
1148673604 17:49431925-49431947 CAGGAGCTCCAGAGGGCCTGTGG + Intronic
1149062948 17:52445693-52445715 CAGGAGCAAGAGAGTGAGAGAGG - Intergenic
1149239052 17:54627120-54627142 CAGCAGCCGCAGAGTGAGGGTGG - Intergenic
1149298640 17:55284384-55284406 CAGCAGTAGCAGAGGAAGTCAGG - Intronic
1149386077 17:56144631-56144653 CAGGAGGAGGTGAGTGAGTGAGG + Intronic
1149484113 17:57028610-57028632 CAGGAGCAAGAGAGAGACTGAGG - Intergenic
1149530105 17:57388435-57388457 CAGGAGCAAGAGAGCAAGTGGGG - Intronic
1149594152 17:57853956-57853978 AAGGAGCAGGAGAGGGACGGTGG - Intergenic
1150001022 17:61440065-61440087 GAGGAGGAGCAGTGGGACTGGGG + Intergenic
1150318310 17:64188335-64188357 CAGCAGCAGCAAAGGCAGTGTGG - Exonic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1150578499 17:66451679-66451701 TGGGTGGAGCAGAGGGAGTGGGG + Intronic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151679046 17:75614378-75614400 CAGGAGCAGGCCAGGGAGAGGGG - Intergenic
1151693586 17:75702453-75702475 GAAGAGGAGCAGAGGGGGTGGGG - Intronic
1151824030 17:76513573-76513595 CAGAGGCTTCAGAGGGAGTGTGG + Intergenic
1151903950 17:77035707-77035729 GAGGGGCAGCAGTGGGAGTGGGG - Intergenic
1151960229 17:77401966-77401988 AAGGAGCAGCAGAGGAAGGCAGG - Intronic
1151961959 17:77410232-77410254 CAGTAGCAGCAGTGGGATGGGGG - Intronic
1152089989 17:78241101-78241123 CCAGATCAGCACAGGGAGTGGGG + Intergenic
1152121815 17:78423521-78423543 CAGGAGCAGCATGTGGGGTGAGG - Intronic
1152604159 17:81280728-81280750 CACGATCTGCAGAGGGAGAGGGG + Exonic
1152661966 17:81546659-81546681 CAGGAGCAGCTGGGAGAGGGAGG + Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152999790 18:443908-443930 CAGGAGCAAGATAGAGAGTGGGG - Intronic
1153461483 18:5338672-5338694 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
1153506488 18:5804394-5804416 CAGGAGAAAGAGAGGGAGAGAGG - Intergenic
1153618081 18:6952329-6952351 CAAGAGCAGCTGGGGGTGTGCGG + Intronic
1153839597 18:8994415-8994437 CAGGAGGAAGAGAGAGAGTGGGG + Intergenic
1153954016 18:10080841-10080863 CAAGAGCAAGAGAGGGAGAGTGG - Intergenic
1154000876 18:10481522-10481544 CAGGGGCAGGAGAGAGAATGAGG + Intronic
1154161052 18:11981273-11981295 CAGGAGCAGCAACGGGTGCGGGG + Intronic
1154219517 18:12440100-12440122 CAGGTGCAGCAGCTGCAGTGAGG - Intergenic
1154472852 18:14721847-14721869 CTGGTGCAGCAGAGAGAGGGAGG + Intergenic
1154490906 18:14921483-14921505 CAGGGGCAGCAGACAGGGTGGGG - Intergenic
1154496314 18:14963782-14963804 GAGGTGCAGCAGATGGAGTCAGG - Intergenic
1155084226 18:22440801-22440823 CACGAGCAAGAGAGTGAGTGGGG + Intergenic
1155185502 18:23383529-23383551 CAGGAGCAGCAGAAGGTGACAGG + Intronic
1155484190 18:26323979-26324001 CATAAGAAGCAGAGGAAGTGAGG - Intronic
1155621763 18:27787380-27787402 CTGGAGCTCCAGAGGGAGTTTGG + Intergenic
1156445332 18:37232490-37232512 CAGGGGCAGGTGTGGGAGTGAGG + Intergenic
1156460359 18:37318270-37318292 CAGGAGGAGGAGGGGGAGCGAGG - Intronic
1156814949 18:41298478-41298500 CAGGACCAAGAGAGAGAGTGGGG - Intergenic
1156819841 18:41359095-41359117 CAGAAGCAAGAGAGAGAGTGGGG - Intergenic
1157118022 18:44880692-44880714 CAGGAGCAAGAGAGCGAGTAGGG + Intronic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157702247 18:49769187-49769209 CAGCTGGAGCAGAGTGAGTGGGG - Intergenic
1158441542 18:57479104-57479126 CAGGGGAAGGAAAGGGAGTGAGG + Exonic
1158446782 18:57529030-57529052 CACGAGCAAGAGAGCGAGTGGGG + Intergenic
1158790853 18:60778769-60778791 CAGGAGGAAGAGAGAGAGTGGGG - Intergenic
1159114881 18:64102756-64102778 CAGGAGAAAGAGAGAGAGTGGGG + Intergenic
1159607197 18:70487209-70487231 CAAGAGCAACAGAGAGTGTGAGG - Intergenic
1159765456 18:72482696-72482718 TAGGAGCAAGAGAGAGAGTGGGG + Intergenic
1160663866 19:313778-313800 CAGGAGGAGCACAGGGATGGCGG - Intronic
1160825073 19:1075939-1075961 CAGGAGCAGAACAGGGCATGAGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161298634 19:3532299-3532321 AGGGAGCAGCAGGAGGAGTGTGG + Intronic
1161502294 19:4623003-4623025 CACGGGCAGCAGAGGGAGCGAGG - Intergenic
1161552754 19:4923267-4923289 CAGGAGGAGCAGACGGAGCCAGG - Intronic
1161585850 19:5105071-5105093 CAGGGGCAGCTCAGGGAGCGGGG - Intronic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1162264080 19:9555922-9555944 CAGGAGCAGGAGAGAGGGGGAGG + Intergenic
1162289536 19:9768560-9768582 CCGGAGCAGCAGCGGGAGGCCGG + Exonic
1162306766 19:9879465-9879487 CAGGAGCAAGAGAGAGACTGGGG - Intronic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1162851494 19:13434588-13434610 CAGGAGGAAGAGAGAGAGTGGGG - Intronic
1162992475 19:14312485-14312507 CAGGAGCCGCAGCCGGGGTGGGG + Intergenic
1163108764 19:15144086-15144108 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
1163157140 19:15445739-15445761 CAGGAGCTGCAGAGGGGGTGTGG + Intronic
1163166393 19:15500917-15500939 AAGCTGCAGCAGAGTGAGTGAGG - Intergenic
1163276763 19:16289658-16289680 CAGGTGCGTCCGAGGGAGTGTGG - Intergenic
1163307495 19:16490447-16490469 CATGAGCAGAAGATGGACTGTGG - Exonic
1163547970 19:17950598-17950620 CAGGAGGAGCCGCGGGAGTGGGG + Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1164788026 19:30952243-30952265 AAGGAGCAAAAGAGGGAGGGAGG - Intergenic
1164820130 19:31243608-31243630 TAGCAGAAGCAGAGGGGGTGGGG + Intergenic
1164820224 19:31244297-31244319 CAGGAGGAAGAGAGAGAGTGGGG - Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165432392 19:35780368-35780390 CAGAAGGAGCAGGGGGTGTGGGG - Intronic
1165557591 19:36648217-36648239 CAGGAGCAAGAGAGAGAGTGGGG - Intronic
1166232457 19:41433195-41433217 CAGATGCAGGAGAGGAAGTGGGG - Intronic
1166287943 19:41844015-41844037 GAGGACCAGCAGAGAGAGGGAGG + Exonic
1166312505 19:41970586-41970608 GAGGAGGGGCAGAGGGAGTGGGG - Intronic
1166748336 19:45152500-45152522 CAGCAGCAGCAGGGGGACTTTGG - Exonic
1167285900 19:48598901-48598923 CTGCAGTAGCAGAGGCAGTGAGG + Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167697898 19:51025742-51025764 CGGGAGCAGGTGAGGGAGAGAGG - Intronic
1168085872 19:54046262-54046284 AGGGAGCAGCAAAAGGAGTGGGG + Intronic
1168153152 19:54459774-54459796 CAGGAGCAGACGAGGATGTGGGG + Intronic
1168246994 19:55117455-55117477 CGGGAGCAGCTGCGGCAGTGGGG - Exonic
1168312028 19:55465208-55465230 CCTGAGCAGCAGAGTGAGGGAGG + Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168713942 19:58516521-58516543 TGGGAGCAGCAGAGGGAGCCGGG + Exonic
924971162 2:128198-128220 CAGGGGCAGCAGAGGCCCTGGGG + Intergenic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925035817 2:684862-684884 CAGGAGAAAGAGAGAGAGTGAGG - Intergenic
925270863 2:2606485-2606507 CAGGAGCAAGAGAGAGAGAGAGG - Intergenic
925427459 2:3762572-3762594 CAGGAGCAAGAGAGAGAGTCGGG + Intronic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
925828273 2:7872010-7872032 GAGAAGCAGCAGAGGAACTGAGG - Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
925933697 2:8732864-8732886 CAGGAGGAGTAGCGGGAGTGAGG - Intronic
926279273 2:11431789-11431811 CAGGAGTAGGGGAGAGAGTGGGG - Intergenic
926283961 2:11472702-11472724 CAGGAGAAAGAGAGTGAGTGAGG + Intergenic
926560837 2:14415670-14415692 CAGGAGCAAGAGAAAGAGTGGGG - Intergenic
926606709 2:14905494-14905516 CAGGGGCACCAGAGAGAGTTGGG - Intergenic
926781706 2:16478560-16478582 CAGATGCTGCAGTGGGAGTGTGG - Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927690488 2:25204609-25204631 CCAGAGCAGCAGAGGCCGTGAGG - Intergenic
927702493 2:25277041-25277063 CGGGAGCACCAGGGGGAGGGAGG + Intronic
928224543 2:29436941-29436963 CAGGAGTGACAGAGGTAGTGAGG + Intronic
928536287 2:32244831-32244853 GAGGAGGAGGAGAGGGAGAGAGG + Intronic
928905733 2:36365483-36365505 AATGAGCAGGAGAGGGTGTGAGG + Intronic
929406623 2:41649916-41649938 AAGGAGGAAGAGAGGGAGTGAGG + Intergenic
929463964 2:42128231-42128253 CAGGAGCTGCAGTGTGGGTGAGG + Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929918817 2:46157764-46157786 CGGGAGGAGCTGAGGAAGTGAGG + Intronic
929939982 2:46326222-46326244 TGGGAGAAGCAGGGGGAGTGGGG + Intronic
930489983 2:52057514-52057536 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
930626883 2:53708244-53708266 CAGGAGCAAGAGAGTGAGTGTGG - Intronic
931163888 2:59724493-59724515 CAGGAGAAGCAGAGGGAGTGAGG + Intergenic
931209285 2:60177405-60177427 CCTGAGAAGCAGAGGGACTGTGG - Intergenic
931516941 2:63055534-63055556 CAGCAGCAGCAGAGCGGGAGCGG + Exonic
931628288 2:64276663-64276685 CAGGAGCAGCAGAGCAGATGAGG - Intergenic
931889971 2:66661351-66661373 CAGCAGCTGCAGTGGCAGTGAGG + Intergenic
931982399 2:67707952-67707974 CAGCAACAGCAGAGGGAAAGGGG - Intergenic
932188690 2:69720450-69720472 GGGGAGGAGCAGAGGCAGTGAGG + Intronic
932597739 2:73104663-73104685 CTGGGCCAGGAGAGGGAGTGAGG - Intronic
932765269 2:74465197-74465219 CAGTGCCGGCAGAGGGAGTGCGG - Exonic
932842733 2:75098954-75098976 CAGAACCAGCAGGTGGAGTGAGG + Intronic
933635238 2:84701641-84701663 CAGGAGCAAGAGAGAGAGGGGGG + Intronic
933748099 2:85585222-85585244 CAGGATCTGCAGCAGGAGTGGGG - Intronic
934184287 2:89657913-89657935 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
934294572 2:91732051-91732073 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
934319830 2:91961910-91961932 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934565952 2:95341247-95341269 CAGGAGCAAGAAAGAGAGTGAGG - Intronic
934611410 2:95739657-95739679 CAGGTGCAAGAGAGGGAGTGTGG - Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935702184 2:105822257-105822279 CAGGAGCAGCAGAGGCCCTCGGG - Intronic
935720120 2:105972611-105972633 CAGGTGCAGCAAAGGGAGCCAGG - Intergenic
935821187 2:106894536-106894558 CAGGAGCACGAGAGAGAGTTGGG - Intergenic
936147067 2:109987243-109987265 TGGGAGCAGCAGAGGGAGCCGGG + Intergenic
936197625 2:110384240-110384262 TGGGAGCAGCAGAGGGAGCCGGG - Intergenic
936492694 2:112986200-112986222 CAGGAGCAACAGAGAGAGTGAGG - Intergenic
936508239 2:113124981-113125003 CAGGAGCCGCAGTGTGGGTGGGG + Intronic
936516293 2:113183435-113183457 GAGGCCCAGCAGATGGAGTGTGG - Exonic
936544741 2:113381223-113381245 CAGGTGCAAGAAAGGGAGTGTGG - Intergenic
936720998 2:115253156-115253178 CAGGAGCAGGAGAGGGAGTGGGG + Intronic
936721592 2:115257476-115257498 CAGGAGCAAAAGAGGGAGTGAGG + Intronic
936957704 2:118040086-118040108 CAGGAGGAAGAGAGAGAGTGGGG + Intergenic
937334531 2:121053900-121053922 CAGGAGCAAGAGAGTGGGTGGGG - Intergenic
937344378 2:121115389-121115411 CGTCAGCAGCAGAGGGAGTGAGG + Intergenic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
937447035 2:121967129-121967151 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
937856927 2:126678887-126678909 CAGGAGCAGCAGAGCCCGTGTGG - Intronic
937921795 2:127136527-127136549 CAGGAGCAGAGAAGGGTGTGGGG + Intergenic
938081822 2:128374252-128374274 CAGGAGCACCAAGGGCAGTGAGG + Intergenic
938096697 2:128468616-128468638 CAGCAGCTGCAGGGGGAATGGGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938184705 2:129219751-129219773 CAGGAACAAGAGTGGGAGTGAGG - Intergenic
938199592 2:129362082-129362104 CTGGAGGAGCAGAGGCTGTGGGG - Intergenic
938257132 2:129868264-129868286 CAGGAGCAGCAGCAGGACAGAGG + Intergenic
938422352 2:131155265-131155287 CAGTAGCAACAGAGGGCGCGGGG + Intronic
938718021 2:134038909-134038931 GTGGAGCAGGAGAGAGAGTGAGG + Intergenic
938864999 2:135409156-135409178 TAGGAGCAAGAGAGTGAGTGGGG + Intronic
938987311 2:136590382-136590404 GAGAAGCAGCAGAGAGAGAGAGG + Intergenic
939311635 2:140485938-140485960 CAAGAGCAGTAGAGAGAGTGAGG - Intronic
939600831 2:144188060-144188082 CTAGAGCCTCAGAGGGAGTGTGG + Intronic
940878342 2:158921446-158921468 TAGGGGAAGGAGAGGGAGTGGGG - Intergenic
941319633 2:164038985-164039007 CAGGAGCAAGAGAGGGAGGGTGG + Intergenic
941442425 2:165554934-165554956 GAGGAGCAAGTGAGGGAGTGAGG - Intronic
942211773 2:173678299-173678321 AAGGAGGAGGAGAGGGAGGGAGG + Intergenic
942375132 2:175328894-175328916 CAGGAGCAAGTGACGGAGTGGGG + Intergenic
942970205 2:181949480-181949502 CAGGAGCAAGAGAGTGAGTCGGG + Intergenic
942970457 2:181951849-181951871 CAGTTGCAGAAGAGGGAGTAAGG - Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943299492 2:186180159-186180181 CAGGGGCAGTAGAGGGAGACAGG - Intergenic
944095168 2:195958169-195958191 CAGAAGCAGAAGAGGGGGAGAGG - Intronic
944306323 2:198183956-198183978 CAGGATCACGAGAGAGAGTGGGG - Intronic
945052412 2:205836575-205836597 CAGCAGAAGCAGCGGGGGTGGGG - Intergenic
945810904 2:214549126-214549148 CAGGTGGATCAGAGGAAGTGTGG - Intronic
946154159 2:217796284-217796306 CAGGAGGGGCAGAGGGATGGCGG - Intergenic
946714447 2:222538749-222538771 CAGGAGCAAGAAAGAGAGTGGGG + Intronic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947096094 2:226568538-226568560 CAGGAGCAAGAGAGGGAGAGAGG - Intergenic
947288979 2:228550555-228550577 CAGGAGCAACAGCGAGAGAGTGG - Intergenic
947567799 2:231205937-231205959 CAGTCACAGCAGAGGGAGGGGGG - Intronic
948075078 2:235159603-235159625 CAGGAGAAGAAAAGAGAGTGTGG + Intergenic
948219058 2:236254980-236255002 CAGGAGCAGGAGAAAGAGTGGGG - Intronic
948599160 2:239098386-239098408 CAGGAGCAGCAGCGAGAGGATGG - Intronic
948742008 2:240054337-240054359 CAGGAGCAAGAGAGGCAGTGAGG - Intergenic
948838298 2:240636793-240636815 CAGGAACAGAAGGGGGAGGGTGG - Intergenic
948861537 2:240755015-240755037 CAGGAGCTGCAGAGAGAGCAGGG - Intronic
948904465 2:240971896-240971918 CAGGAGCAGCAGACGAGATGCGG - Intronic
1168943921 20:1735883-1735905 CCGCAGCAGGAGAGGGAGGGAGG - Intergenic
1169111775 20:3038779-3038801 CAGGAGGAGCTGGGGGACTGTGG - Intronic
1169467225 20:5852007-5852029 TAGGAGCAAGAGAGAGAGTGGGG - Intronic
1169597987 20:7222676-7222698 CAGGAGCTGAAAAGGGTGTGTGG - Intergenic
1169811397 20:9612509-9612531 CAGGAGCAAGAGAGAGAGTGGGG + Intronic
1170064376 20:12294577-12294599 GAGGAGAAGCAGAGAGTGTGGGG + Intergenic
1170370794 20:15646038-15646060 CAGGAGCTGTTGAGGCAGTGTGG - Intronic
1170532411 20:17307998-17308020 CAGGAGCAAAAGAAAGAGTGAGG + Intronic
1170532424 20:17308100-17308122 CAGGAGCAAAAGAAAGAGTGAGG + Intronic
1170560039 20:17549444-17549466 CAGGAGCAAGAGAGAGAGTGGGG + Intronic
1170625131 20:18024634-18024656 GAGGAGGAGGAGAGGAAGTGAGG - Exonic
1170638290 20:18128752-18128774 CAGGAGGAAGAGAGGAAGTGGGG + Intergenic
1170747884 20:19116833-19116855 AAGGAGTAGCAGAGGAAGTGAGG - Intergenic
1171012960 20:21518442-21518464 CCAGAGCAGCAGAGAGAGCGAGG - Intergenic
1171146983 20:22793335-22793357 CAGGAGCAAGAGAGCCAGTGGGG - Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172005355 20:31815811-31815833 CAGGGGCAGGACAGGAAGTGGGG - Intergenic
1172849422 20:37950003-37950025 CAGGAGCAAGAGAGCGAGTGGGG + Intergenic
1172973103 20:38887935-38887957 CAGGAGCAGTGGATGGGGTGGGG - Intronic
1173032872 20:39378612-39378634 AAGGAGCAGCCGTGGGGGTGAGG - Intergenic
1173199496 20:40944162-40944184 CAGGAGAGGCGGAGGGAGGGAGG - Intergenic
1173456497 20:43206618-43206640 CTGGAGCAGGAAAGAGAGTGGGG + Intergenic
1173503827 20:43571862-43571884 CAGGAGCAGCACAGGGGGCCGGG - Intronic
1173637731 20:44575641-44575663 CAGGAGCAGCAGTTAGACTGAGG + Intronic
1173909202 20:46651528-46651550 CAGGAGGAGCAGGGAGAGGGCGG - Intronic
1173953272 20:47010305-47010327 CAGCAGCATGAGAGGGACTGTGG - Intronic
1173966220 20:47114853-47114875 CAGGAGCAAGAGGGGGAGAGTGG - Intronic
1174029593 20:47611820-47611842 CTGGAGGGGCAGAAGGAGTGGGG - Intronic
1174361069 20:50029315-50029337 CAGGCGCAGCTGGGGGAGTCAGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175134516 20:56812959-56812981 CAGGAGCAAGAGAGAGAGAGTGG + Intergenic
1175269445 20:57723534-57723556 CAGGAGCTGCAGAGGCAGGTGGG + Intergenic
1175315114 20:58041695-58041717 GGGGAGCAGAAGAGGGAGTGTGG + Intergenic
1175383903 20:58582085-58582107 AATGAGTAGCAAAGGGAGTGAGG + Intergenic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1175997172 20:62817087-62817109 CAGGAGCAGGAGCAGGAGCGGGG - Exonic
1176021556 20:62964830-62964852 CTGGAGCAGCAGAGGAAGTGGGG + Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176064434 20:63187387-63187409 CAGGAGCAGGCGAGGGCATGGGG - Intergenic
1176228778 20:64019724-64019746 CAGGAGCATCTGAGGGGGTCAGG - Intronic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176411504 21:6451702-6451724 GGGAAGCAGCAGAGGGAGTCAGG + Intergenic
1176673921 21:9759203-9759225 CAGGAGCACCGGAGGGAGCCTGG - Intergenic
1176709384 21:10136409-10136431 CAGGAGCTGCAAAAGGAGAGAGG - Intergenic
1176801633 21:13436002-13436024 CTGGTGCAGCAGAGAGAGGGAGG - Intergenic
1176886771 21:14265807-14265829 CAGGAGAAACAGAGAGAGAGCGG - Intergenic
1176963611 21:15187636-15187658 CAGGAGGAAGAGAGGGAGTGGGG + Intergenic
1177147776 21:17425174-17425196 CAGGAGCAAGAAAGTGAGTGGGG - Intergenic
1177214710 21:18113562-18113584 CAGGAGGAAGAGAGAGAGTGGGG + Intronic
1177722820 21:24929043-24929065 CAGGAGCAACAGAGAGACAGGGG - Intergenic
1178326287 21:31647836-31647858 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
1178431505 21:32522211-32522233 AAGGAGCAGCAGGCTGAGTGTGG - Intergenic
1178679707 21:34663363-34663385 CAGAGGCTGCAAAGGGAGTGTGG + Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179030971 21:37719111-37719133 CAGGAGGAGGAGAGGGTGTGGGG + Intronic
1179686998 21:43060024-43060046 GGGAAGCAGCAGAGGGAGTCAGG + Intronic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1179775889 21:43661840-43661862 CAGGAGAAGCAAAGGCAGAGAGG - Intronic
1179795869 21:43783096-43783118 CAGGCGCTGCAGGGGGACTGTGG + Intergenic
1179930485 21:44568203-44568225 CAGGAGCAGGAGGAGGGGTGGGG - Intronic
1179979148 21:44887506-44887528 CAGGAGGGGTACAGGGAGTGAGG - Intronic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180030910 21:45206960-45206982 CAGCAGCAGCAGAGAGAGCCTGG + Intronic
1180031382 21:45210860-45210882 GGGGAGCAGCCGGGGGAGTGGGG - Intronic
1180211035 21:46295647-46295669 CACAGGCAGCACAGGGAGTGCGG - Intronic
1180308080 22:11145954-11145976 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1180546556 22:16507767-16507789 CAGGGGCAGCAGGTGGAGAGTGG + Intergenic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1180657421 22:17434640-17434662 GGGGAGCAGCAGGGGGGGTGCGG - Intronic
1180740853 22:18052400-18052422 CAGCAGCAGCAGAGGCACCGGGG + Intergenic
1180785398 22:18544273-18544295 CAGGAGCTGCAAAGGCAGTCTGG + Intergenic
1180817370 22:18799495-18799517 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181203560 22:21233816-21233838 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
1181242301 22:21483626-21483648 CAGGAGCTGCAAAGGCAGTCTGG + Intergenic
1181487611 22:23241475-23241497 TGGGAGCAGCATGGGGAGTGAGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182056239 22:27357434-27357456 CAGGAGGAAGAGAGGGAGAGAGG - Intergenic
1182089083 22:27581791-27581813 CAGAAGAGGCAGAGGGAGCGCGG + Intergenic
1182212627 22:28689587-28689609 CAGGGGCAGCAGGTGGAGAGTGG - Intronic
1182298922 22:29327324-29327346 CAGGGGCAGCCGTGGGAGAGGGG - Intergenic
1182321509 22:29480923-29480945 CAGGCGCTGCAGGAGGAGTGCGG + Exonic
1182549142 22:31091628-31091650 CAGGAGGATCAGGTGGAGTGAGG - Intronic
1183001091 22:34859825-34859847 CTGGAGGAGCAGAGGAAGCGCGG - Intergenic
1183002033 22:34868578-34868600 CAGGTGAAGCAGAGGGAGTGAGG - Intergenic
1183104615 22:35607155-35607177 CAGGAGGAGCTGAGGGGCTGGGG - Exonic
1183396873 22:37576741-37576763 CAGGAGCTGCAAGGGGAGTGTGG - Intronic
1183585852 22:38752550-38752572 CAGCAGCAGCGGAGGGAGCTCGG - Exonic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1183827042 22:40396738-40396760 CAGGAGGACCAGAGTGAATGGGG + Intronic
1183948740 22:41340961-41340983 CAGGAGTAGGAGAGGATGTGTGG + Intronic
1184102662 22:42348976-42348998 CAATAGAGGCAGAGGGAGTGGGG + Intergenic
1184357799 22:43994256-43994278 CAGGAACAGAAGGGGGAGTGGGG + Intronic
1184500101 22:44866273-44866295 CAGGAGCAAGAGAGAGTGTGGGG + Intergenic
1184645170 22:45891450-45891472 GAGGAGCAGCAGAGGATGAGGGG - Intergenic
1184676380 22:46045411-46045433 CAGGGGCAGCACAGGAGGTGAGG + Intergenic
1184744997 22:46451043-46451065 GGGGAGGAGGAGAGGGAGTGGGG - Intronic
1184921800 22:47610443-47610465 CAGGAGCAGCTGAGGAAGGCAGG - Intergenic
1185246833 22:49777168-49777190 GAGGAAGAGCAGAGGGAGTCAGG + Intronic
1185363019 22:50420443-50420465 CAGCAGCAGAAGAGTGAGTTCGG + Intronic
1203223361 22_KI270731v1_random:61598-61620 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
1203267468 22_KI270734v1_random:25222-25244 CAGGAGCAAGAGAGAGAGGGGGG - Intergenic
1203296105 22_KI270736v1_random:44445-44467 CAGAAGCAGCACAGGCAGAGGGG - Intergenic
949611417 3:5707581-5707603 AAGGAGAAGCAGAGAGAGAGAGG - Intergenic
949772815 3:7597215-7597237 GAGGAGCAAAAGAGAGAGTGGGG + Intronic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
950134714 3:10572592-10572614 TAGGAGCAGGAGGGGGTGTGTGG + Intronic
950542569 3:13621067-13621089 CATGAGCAGCACAGGCAGAGGGG - Intronic
950660100 3:14461870-14461892 CAGCAGCAGCAGGGGGAGCCAGG - Intronic
951026975 3:17840851-17840873 CAGGTGGAGCAGAGGGTGTGAGG + Intronic
951375914 3:21916948-21916970 AACCAGCAGCAGTGGGAGTGTGG - Intronic
952333517 3:32385806-32385828 GAGGCCCAGCAGAGGGAGAGCGG - Intergenic
952346051 3:32486870-32486892 CAGGAGGAATAGAGAGAGTGGGG - Intronic
952577173 3:34789477-34789499 CTGGAACAGCAGAGGGACAGTGG - Intergenic
952644648 3:35640087-35640109 CAGCAGCAGCAGGGGCAGCGGGG + Intronic
953042423 3:39267191-39267213 CATGAGCAGGAGGGGGAGGGGGG + Intronic
953228329 3:41041545-41041567 CAGGACCAGCACAGTCAGTGAGG + Intergenic
953543353 3:43841896-43841918 CAGGAGGAGCAGAGGGAGTGGGG + Intergenic
953850105 3:46459553-46459575 CAGGTGAAGCAGAGGAAGTAAGG + Intronic
953887486 3:46723729-46723751 CAGGAGCACCAGAGAGTGGGGGG + Intronic
954143374 3:48621718-48621740 CAGGAGCAGCAAAGGCAGCGAGG + Exonic
954377532 3:50203011-50203033 CAGGAGCTGCAGGGGGTCTGAGG + Intergenic
954984093 3:54774389-54774411 CAGGAGGAAGAGAGAGAGTGGGG + Intronic
955510977 3:59679935-59679957 CAGGGGCAGCAGGGGCAGGGAGG - Intergenic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
955795577 3:62633308-62633330 CATGAGCAGCAATGGGAGTGGGG - Intronic
955977403 3:64491669-64491691 CAGGGGAAGAAGAGGGAGTTGGG - Intergenic
956052005 3:65257965-65257987 CAGGAGCAAGGGAGAGAGTGGGG + Intergenic
956527341 3:70179462-70179484 CAAGAGCAGCTGAGGGAGCAGGG - Intergenic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956953035 3:74304296-74304318 TAGGAGAAGGAGAGGGAGAGAGG - Intronic
958444200 3:94194835-94194857 CAGAAGCAAGAGAGAGAGTGGGG - Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
958819731 3:98959390-98959412 CAGTGGCAGCATGGGGAGTGGGG - Intergenic
958841236 3:99208481-99208503 CAGGAGCAAGATAGAGAGTGAGG + Intergenic
958913678 3:100024099-100024121 AAGGAGCTGAAGACGGAGTGTGG - Intronic
958970109 3:100601627-100601649 CTGGGGCAGCAGAGGAAGTCAGG - Intergenic
959037318 3:101383225-101383247 CAGGAGCAAGAGAAAGAGTGGGG - Intronic
959202056 3:103259689-103259711 CAGAAGCAAGAGAGAGAGTGAGG + Intergenic
960190401 3:114697734-114697756 AAGGAGCAGGAGAGGGAGGGAGG + Intronic
960465845 3:117996495-117996517 GAGGAGGAGAAGAGGGAGGGAGG - Intergenic
961138147 3:124531622-124531644 CAGGAGCAAGAGAGAGAGTGAGG + Intronic
961306500 3:125961420-125961442 CAGGAGGGCCTGAGGGAGTGGGG - Intergenic
961381788 3:126500255-126500277 CAGGAGCAGTCCAGGCAGTGGGG - Intronic
961434300 3:126906102-126906124 CAGCAGCTGGAGTGGGAGTGAGG - Intronic
961602525 3:128072580-128072602 CAGCAGGTGCAGAGGGAGCGCGG - Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961828050 3:129608793-129608815 GAGGGGCTGGAGAGGGAGTGGGG - Intergenic
962028230 3:131571606-131571628 CAGCAGCAGGAGAGGTACTGTGG - Intronic
962271229 3:133979399-133979421 CAGGAGAAGCAGAGGAACAGGGG - Intronic
962324532 3:134422462-134422484 CAGGAGCAAGAGAAGGAGAGGGG - Intergenic
962716218 3:138128451-138128473 CAGGAGCAAGAGAGAGAGTGGGG + Intronic
962865990 3:139448389-139448411 CAGCAGTGGCAGAGGGAGAGGGG - Intergenic
963096333 3:141545426-141545448 CAGGAACAGGAGAGAGAGTGGGG + Intronic
963117020 3:141738672-141738694 CAGGAGCCGCAGCAGGAGCGTGG - Intronic
963138387 3:141928532-141928554 CAGGTTGAGCTGAGGGAGTGTGG + Intergenic
963652926 3:148006928-148006950 GAGGAGGAGGAGAGGGAGGGAGG - Intergenic
963707870 3:148710897-148710919 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
963900211 3:150726406-150726428 CAGGAGAAGCAGACTGAATGTGG + Intergenic
964021562 3:152019685-152019707 CACAAGCAGGAGAGAGAGTGAGG - Intergenic
964073422 3:152663970-152663992 CAGGAGCAAGAGAGCAAGTGGGG + Intergenic
964108364 3:153063165-153063187 AAGAAGCAGCAGAGGGAGAGGGG - Intergenic
964342115 3:155718630-155718652 CAGGAGCAAGAGGGTGAGTGCGG + Intronic
965587013 3:170327703-170327725 CAGGAGCAGGAGCGGGAGGTGGG - Intergenic
965870234 3:173255717-173255739 GAGGAGCAAGAGAGAGAGTGGGG + Intergenic
966223853 3:177577329-177577351 CTGGAGCAGCAGAGGTGGTGTGG - Intergenic
966882699 3:184359132-184359154 CTGGAGCAACAGAGGGGATGGGG + Intronic
966942637 3:184756608-184756630 CAGGGGCAGCACAGGGAGAACGG - Intergenic
967390350 3:188948513-188948535 CAGGAGGAGTTAAGGGAGTGGGG + Intronic
967418368 3:189244560-189244582 CAGGAGCAAGAGAGAAAGTGGGG + Intronic
967613440 3:191536246-191536268 CAGGAGCAAGAGAGAGAGAGGGG + Intergenic
967874751 3:194260202-194260224 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
968137113 3:196227627-196227649 CAGGAGCAGGTGAGGGCGGGAGG - Intronic
968423911 4:508358-508380 CCGGAGCAGCAAAGGATGTGTGG + Intronic
968565325 4:1309574-1309596 GAGGAGGAGCAGAGGCAGGGAGG + Intronic
968698078 4:2042332-2042354 CATGGCCAGCAGAGGGAGCGGGG - Exonic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
969160739 4:5256487-5256509 CAGGGGAAGCAGTGGGAGAGTGG - Intronic
969175211 4:5393594-5393616 CAGGAGCAAGAGAGACAGTGGGG + Intronic
969184311 4:5464094-5464116 CAGGAACAGCAGTGGGGGTGGGG + Intronic
969220038 4:5753342-5753364 CAGGAACTGCAGAGGGACAGAGG + Intronic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969293412 4:6254922-6254944 GAGGAGTGGCAGAGGGTGTGTGG + Intergenic
969402420 4:6964345-6964367 CAGGAGCTGCAGAGGGTGTAAGG - Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969515856 4:7648017-7648039 CAGGAGCAGCCGAGGTGGAGTGG + Intronic
969552983 4:7884112-7884134 CAGGAGCAAGAGAGGGAGTGGGG - Intronic
969597982 4:8159532-8159554 CGGGTGCAGGAGAGGGAGTCAGG + Intergenic
969617124 4:8260180-8260202 GAGGAGCAGGAGAGGGAAGGAGG - Intergenic
969659323 4:8517395-8517417 AGGGAGCAGAAGAGGGAGGGGGG + Intergenic
969671547 4:8592841-8592863 AAGGAGCAGCAGCGGCAGCGGGG - Exonic
970015483 4:11507844-11507866 CAGGAGAAAGAGAGAGAGTGGGG + Intergenic
970235534 4:13954771-13954793 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
970281084 4:14456431-14456453 CAGGAGCAAGAGAGAGAGGGGGG + Intergenic
970352401 4:15216040-15216062 CAGGAGCAAGAGAGGGAGCAGGG - Intergenic
970421449 4:15909102-15909124 CAGGAGCAAAAGAGTGAGGGAGG + Intergenic
970907445 4:21232877-21232899 CAGGGACAGCAGAGAGAATGAGG + Intronic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
972227119 4:37026297-37026319 CAGGAGGAGGAGAGAGAGAGTGG + Intergenic
972385474 4:38561577-38561599 CAGGAGCAAGAGAGAGAGTGTGG - Intergenic
972568178 4:40287364-40287386 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
973142090 4:46781825-46781847 CAGCAGCTGCAGAGGATGTGCGG + Intronic
973607164 4:52599402-52599424 CCAGAGCAGCAGAGTGAGCGAGG + Intronic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974086402 4:57265360-57265382 CAGGAGCCAGAGAGGGAGGGAGG + Intergenic
974110624 4:57521204-57521226 CAGGAGAAAGAGAGAGAGTGGGG + Intergenic
974441615 4:61925625-61925647 CAGGAGCAAGAGAGAGAGAGTGG + Intronic
974457278 4:62144612-62144634 CAGGAGCAAGAGAGAGAGTTGGG - Intergenic
974579640 4:63779507-63779529 CTGGGGCAGGAGTGGGAGTGAGG - Intergenic
975029778 4:69600768-69600790 CAGGAGCAAGAGAGAGAGTGAGG + Intronic
975252299 4:72194201-72194223 CAGGAGCAACAGAGAGAAGGAGG - Intergenic
975511117 4:75194415-75194437 CAGCGGCAGCAGTGGCAGTGTGG - Intergenic
976141001 4:81991497-81991519 CAGCAGCAGCAGTGGGGGTGGGG + Intronic
976547925 4:86359403-86359425 GAGGGGTAGCAGAGGGAGGGAGG - Intronic
976741131 4:88358608-88358630 CAGGAGCAAGAGAGAGAGAGAGG - Intergenic
977061177 4:92258499-92258521 CAGGAACAAGAGAGGGAGTAGGG + Intergenic
978100779 4:104838946-104838968 CAGGAGCAAGAGAGTGAGAGGGG - Intergenic
978269920 4:106876663-106876685 GTGGAGCAGGAGAGGGAGAGGGG - Intergenic
978480998 4:109190540-109190562 CAGGAGCAGGTGAGAGATTGAGG + Intronic
978923777 4:114217731-114217753 CAGCAGCAGCATAGGCAGTGTGG - Intergenic
978926044 4:114246087-114246109 CAGGAGCAAGAGAGAGAATGGGG + Intergenic
979140800 4:117171600-117171622 CAGGAGCAAGAGAAAGAGTGAGG - Intergenic
979149819 4:117297149-117297171 CAGGAGCAAAAGAGAGAGTGGGG - Intergenic
979543849 4:121917340-121917362 CAGGAGCAGAAGTGGAAGTTTGG - Intronic
979806146 4:124973656-124973678 CAGGGGAAGCATAGGGAATGAGG + Intergenic
980658028 4:135815324-135815346 CAGGAGGAGGAGAGAGACTGGGG - Intergenic
980700968 4:136429385-136429407 CAGGAACAAGAGAGGGGGTGAGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981385288 4:144123302-144123324 CAAGAGCAAGAGAGAGAGTGGGG - Intronic
981550436 4:145937147-145937169 GGGGAGCTGGAGAGGGAGTGGGG + Intronic
981632496 4:146836451-146836473 CATGAGCTGCAGTGGGAGAGAGG + Intronic
981780219 4:148420822-148420844 CAGGAGCAAGAGAAGGAGTGGGG - Intronic
982207815 4:153010374-153010396 CAGGAGCAAGAAAGAGAGTGGGG + Intergenic
982256842 4:153459172-153459194 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
982567001 4:156998038-156998060 CAGGAGCACGAGAAAGAGTGAGG + Intergenic
982582502 4:157196446-157196468 AAGGGGCAGCAGTGGGAGTGAGG - Intergenic
983524706 4:168749141-168749163 CAGGAGCAAGAGAGAGAGAGTGG - Intronic
983557160 4:169068824-169068846 GAGGAGGAGATGAGGGAGTGTGG + Intergenic
984028226 4:174570708-174570730 CAGGAGCAAGAGAGTGAGAGGGG - Intergenic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
984841307 4:184070209-184070231 CAGGGGCAAGAGAGTGAGTGAGG - Intergenic
985056070 4:186036575-186036597 CAGGAGCAAGAGAGAGAGTAGGG - Intergenic
985089708 4:186350606-186350628 GAGGGGCTGGAGAGGGAGTGCGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985789005 5:1915469-1915491 TGGGGGCAGCAGTGGGAGTGGGG - Intergenic
985861624 5:2476030-2476052 CAGCAGAAGCAGAGGGGGTCTGG + Intergenic
986731298 5:10636758-10636780 AGGGTGCAGCAGAGGGAGAGAGG + Intronic
986745003 5:10736160-10736182 CAGCGCCTGCAGAGGGAGTGTGG + Intronic
987026997 5:13937459-13937481 CAGGAGTAGAAGATGGGGTGAGG - Intronic
987304040 5:16621260-16621282 CAGGACCATCAAAGGGGGTGGGG - Intergenic
988600640 5:32636828-32636850 CAAGTGCAGAAGAGAGAGTGAGG - Intergenic
988833144 5:35006494-35006516 CAGGAGCAAGAGAGGGAGTTAGG + Intronic
988877127 5:35458657-35458679 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
988928375 5:36012037-36012059 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
988928971 5:36016715-36016737 CAGGAGCAGGAGAGAGACTGGGG - Intergenic
988961835 5:36378601-36378623 CAGGAGCAGGAGAGGGACTTTGG - Intergenic
989677177 5:43985496-43985518 CAGGAGCCACAGAGCGAGGGGGG + Intergenic
990670455 5:58123627-58123649 AAGGAGCAGCCCAGGGAGAGAGG + Intergenic
990791359 5:59483662-59483684 GAGGAGCAGGAGAGTAAGTGGGG + Intronic
991042939 5:62194226-62194248 CAGGAGCAAGAGAGAGAGAGTGG - Intergenic
991136460 5:63187372-63187394 CAGGAGCAAGGGAGAGAGTGGGG + Intergenic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
991316277 5:65310111-65310133 CAGGAGCAAGAGAGAGAGGGAGG - Intronic
991340138 5:65600052-65600074 CAGGAGCAAGAGAGAGGGTGGGG + Intronic
991562809 5:67972418-67972440 CAGGAGTAGGAGAGAGAGAGAGG - Intergenic
991605952 5:68401391-68401413 CAGGAGCAAGAGAGAGAGAGGGG + Intergenic
992312036 5:75511238-75511260 CCGGCGCAGCTGAGGGAGCGGGG - Exonic
992313595 5:75529255-75529277 CAGGAGCAAAAGAGAGAGGGGGG + Intronic
992334247 5:75749063-75749085 CAGGAGCAAGAGAGAGAATGGGG - Intergenic
992792754 5:80228207-80228229 CCTGGGCAGCAGAGTGAGTGAGG + Intronic
992867661 5:80973811-80973833 CAGGAGGAGATGAGGGAGAGAGG + Intronic
993871288 5:93257253-93257275 CAGAAGCAGCAGAAGGCTTGGGG - Intergenic
994060884 5:95475427-95475449 CAGGAGCAAGAGAGAGAGGGGGG - Intronic
994073936 5:95630283-95630305 CCGGAGCAAGAGAGAGAGTGGGG + Intergenic
994215117 5:97129102-97129124 CATAAGAAGCATAGGGAGTGAGG - Intronic
994314207 5:98313363-98313385 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
994449047 5:99917355-99917377 CAGGAGCAAGAGAGAAAGTGTGG - Intergenic
994948161 5:106423243-106423265 CAGCACCAGCAGAGGGTGAGAGG - Intergenic
995831668 5:116361478-116361500 CAGGACCTGCGGAGGGAGGGAGG - Intronic
995973797 5:118006447-118006469 TAAGTGGAGCAGAGGGAGTGGGG - Intergenic
996441719 5:123498838-123498860 CAGGAGCAAGAGAGAGAGAGAGG - Intergenic
997260829 5:132464496-132464518 AAGAAGCAGGAGTGGGAGTGGGG + Exonic
997451076 5:133983871-133983893 CAGGAGCAAGAGAGAGAGAGTGG - Intronic
997569815 5:134917705-134917727 CTGGAGCTGCAGCGGGAGGGAGG + Intronic
997604771 5:135166825-135166847 CAGCAGCAGTGGAGGGTGTGAGG + Intronic
997658699 5:135574063-135574085 TCTGGGCAGCAGAGGGAGTGGGG + Intronic
997847877 5:137304500-137304522 CAGGAACTGCAGAGTGTGTGGGG + Intronic
997989688 5:138533899-138533921 TGGTAGTAGCAGAGGGAGTGGGG - Intronic
998093477 5:139384088-139384110 CAGGAGCATTAGATGGAGCGTGG + Intronic
998186368 5:139982836-139982858 CAGGGGCAGCAGAATGAATGGGG + Intronic
998351631 5:141505651-141505673 AAGGAACAGCAGAGGGGTTGGGG + Intronic
998368457 5:141646019-141646041 AAAGAGGAGTAGAGGGAGTGGGG + Intronic
998957607 5:147453618-147453640 CCGGAGCAGAAGAAGGAGGGAGG - Intronic
999277277 5:150339559-150339581 CATGAGCAGAGGAGTGAGTGAGG - Intergenic
999756869 5:154670994-154671016 CAGGGGCTGATGAGGGAGTGAGG + Intergenic
1000071533 5:157744422-157744444 TAGGAGCAACAGAGGGAGAGTGG + Intronic
1000971875 5:167723664-167723686 CAGCAGCAGCAGAGGTCTTGAGG - Intronic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1001339919 5:170833874-170833896 TAGGACAAGCAGAGGGACTGGGG - Intergenic
1001401357 5:171448369-171448391 CAGGAAGGGCACAGGGAGTGAGG - Intronic
1001571335 5:172732462-172732484 CAGATGCTGCAGAGGGAGGGAGG + Intergenic
1002026310 5:176398091-176398113 CAGGGGCAGCAGAGACAGCGGGG - Intronic
1002317149 5:178350604-178350626 CAAGAGCCACAGAGGAAGTGTGG + Intronic
1002461325 5:179375421-179375443 AAGGGGGAGCAGAGTGAGTGGGG - Intergenic
1002517470 5:179770111-179770133 CAGGAGCTGGAGAGGCAGGGTGG - Intronic
1002858346 6:1057653-1057675 AGGGAGCAGCAGCGGGACTGGGG - Intergenic
1003008122 6:2400562-2400584 TGGGAGCAAGAGAGGGAGTGGGG + Intergenic
1003422260 6:5969063-5969085 AAGGACCAGCACAGGGAGGGAGG + Intergenic
1003440658 6:6138371-6138393 CAAGGGCAGGAGAGGGAATGTGG + Intergenic
1003494614 6:6653387-6653409 CAAGCGGAGCAGAGGGACTGTGG - Intronic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003570056 6:7250040-7250062 CAGGAGCAGCTCAGAGAGGGTGG + Exonic
1003924095 6:10860667-10860689 CAGGAGCAAGAGAGGGAGTTGGG + Intronic
1004176402 6:13343990-13344012 TAGGAGGAAGAGAGGGAGTGGGG - Intergenic
1004205696 6:13589775-13589797 TAGCAGCAGCAGAGGGTGGGAGG + Intronic
1004753298 6:18585359-18585381 CAGGAGCAGGTGGGGGAGGGTGG - Intergenic
1004843722 6:19615083-19615105 CAGCAGCAGAAGTGGGTGTGTGG - Intergenic
1005022464 6:21431390-21431412 CAGGAGCAACAAAGAGAGTAGGG - Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005734278 6:28731174-28731196 AAGGAGCAGGAGAGGGAGCAAGG + Intergenic
1005911944 6:30318426-30318448 TAGGAGCAAGAGAGAGAGTGGGG + Intergenic
1006248188 6:32758395-32758417 CAGAAGGAAAAGAGGGAGTGAGG - Intronic
1006664760 6:35684682-35684704 AAGGTCCACCAGAGGGAGTGTGG - Intronic
1007151847 6:39701298-39701320 CATGAGCAGAAGTGGCAGTGTGG - Intronic
1007309548 6:40934633-40934655 CTGGAGGAGGAGAGGGAATGGGG + Intergenic
1007656631 6:43454950-43454972 CAGGAGCCGACGAGGGAGAGGGG + Intronic
1007985053 6:46199041-46199063 CATGGGCCCCAGAGGGAGTGCGG + Intergenic
1008054821 6:46935684-46935706 CAGGAGCAGGAGAGGGACTTGGG - Intronic
1008418569 6:51271350-51271372 CAGAAGCAACAGAGAGAGTGTGG - Intergenic
1008522318 6:52374034-52374056 CAGGAGTAAGAGAGGGAGTGGGG - Intronic
1008933691 6:56966790-56966812 GAGGAGCAACAGAGGGACTCTGG + Intronic
1008978871 6:57459947-57459969 CTGCAGCAGAAGAGGGTGTGAGG + Intronic
1009398727 6:63230213-63230235 CAGGAGCAGCAGGGTGAGCCCGG + Intergenic
1009401293 6:63259233-63259255 CAGGAGCAGATGAGAGAGAGTGG + Intergenic
1010706944 6:79125840-79125862 AAGGAACAGCTGAGGGTGTGGGG + Intergenic
1010988150 6:82449782-82449804 AAGGAGCAAGAGAGGGAGAGGGG + Intergenic
1011519040 6:88184085-88184107 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG + Intergenic
1012525009 6:100166875-100166897 CAGGAGCAGCACCAGGAATGTGG - Intergenic
1012763672 6:103335622-103335644 CAGGAGCAACAGAGTGAAGGAGG + Intergenic
1012867983 6:104641023-104641045 CAGGAGCAAGAGAGGGTGGGAGG - Intergenic
1013178120 6:107694515-107694537 CAGGAGCAAGAGAGGGTGGGAGG + Intergenic
1013322280 6:109005910-109005932 CAGAAGTAGCAGAGGAAGAGAGG + Intronic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013413209 6:109900515-109900537 CAGGAGTGGCAGAGGGATTCAGG - Intergenic
1013437210 6:110122519-110122541 CAGGAGTAGCAGAGGCAGAGAGG - Intronic
1013570345 6:111417488-111417510 CAGGAACAGCACAGTGAGAGCGG - Intronic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1014612975 6:123567616-123567638 GAGGAGCAAGAGAGAGAGTGGGG + Intronic
1014635598 6:123843084-123843106 CTGGAGCCCCAGAGGGTGTGTGG + Intronic
1014707317 6:124763435-124763457 CAGGAGCAAGAGATGGAGGGAGG + Intronic
1014722185 6:124930726-124930748 CAGGAGCGAGAGAGAGAGTGGGG - Intergenic
1015227080 6:130869922-130869944 CAGCAGCAGCAGTGAGAGTGAGG - Exonic
1015280947 6:131433534-131433556 CAGGAGCAAGAGAGAGAGTGAGG - Intergenic
1015442834 6:133268796-133268818 CAGGAGGAGAAGAGGGAGAGTGG + Intronic
1015454519 6:133410937-133410959 GAGGAACAGCAGAGGGGCTGAGG - Intronic
1015713474 6:136166553-136166575 CAGGAGCAAGAGAGAGAGTGAGG + Intronic
1015786054 6:136922348-136922370 CGGGAGCAGCGGAGTGAGGGCGG - Exonic
1017080801 6:150666420-150666442 CAGCCGAAGCAGAGGGAGTGTGG - Intronic
1017148667 6:151258147-151258169 CAGGAGCGGCAGAGAGTTTGAGG - Intronic
1018662472 6:166101150-166101172 CAGGAGCAAGAGAGAAAGTGGGG + Intergenic
1018700096 6:166419591-166419613 CAGGTGCAGCAGAGAGAATGGGG + Intronic
1018830097 6:167435518-167435540 CAGGAGCAGCCCAGTGAGCGGGG + Intergenic
1019394578 7:810626-810648 CAGGAGCAAGAGAGGCCGTGAGG + Intergenic
1019664351 7:2243957-2243979 CAGCAGGAGCAGAGTGGGTGGGG + Intronic
1019698894 7:2463077-2463099 CAGGGGCAGGGGAGGGAATGGGG + Intergenic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019783498 7:2958789-2958811 CAGGGGCTGCAGGGGGAGAGGGG + Intronic
1019931194 7:4224377-4224399 CAGGAGGAAGAGAGTGAGTGGGG + Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1019998483 7:4740809-4740831 CAGGAGGAGGAGCGGGTGTGAGG - Intronic
1020150913 7:5680997-5681019 CAGCAGCATGAGAGGGAGTGAGG - Intronic
1020214008 7:6175222-6175244 CAAGTGAAGCAGTGGGAGTGGGG + Intronic
1020747442 7:12094863-12094885 CAGGAGCAGAGGAGGGAGATAGG + Intergenic
1020850817 7:13350458-13350480 TAGGAGCAGGAGAGGAAGTGGGG + Intergenic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021787382 7:24165173-24165195 CAGTAGCAACAGAGGGTGGGAGG + Intergenic
1021825283 7:24544774-24544796 CAGCCGCAGCAGAGGGGCTGAGG + Intergenic
1022048517 7:26643200-26643222 CAGCAGGAACAGACGGAGTGGGG - Intronic
1022289069 7:28983936-28983958 CAGGAGGAGGAGAGAGAGGGAGG + Intergenic
1022342908 7:29485818-29485840 CAGAAGCAGCAGGCTGAGTGGGG - Intronic
1022348165 7:29538729-29538751 CTGGAGCAACTAAGGGAGTGCGG + Intergenic
1022416589 7:30183358-30183380 CAGGAGCAAGAGAGAGAGAGGGG + Intergenic
1022437440 7:30403038-30403060 CAGGAGCAACAGAGGGCGAGGGG - Intronic
1022521425 7:31009937-31009959 CAGGAGCAAGAGAGACAGTGGGG + Intergenic
1022528098 7:31051332-31051354 CAGGAGCAGCTGTGGGATGGGGG + Intergenic
1022753022 7:33252109-33252131 CAGGAGCAAGAGAGGGAGGGGGG + Intronic
1022910298 7:34894495-34894517 CAGGAGCAAGAGAGAGAGTCGGG - Intergenic
1023037335 7:36143630-36143652 CAGAAGCAGGAGAGGAAGTGAGG - Intergenic
1023543311 7:41289473-41289495 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
1023583598 7:41706329-41706351 CAGGACCAGAAAAGGGAGTGGGG + Intergenic
1023857077 7:44190419-44190441 GAGGTCCAGCAGAGGGGGTGAGG + Intronic
1023885278 7:44349638-44349660 CAGGAGCAGCTGAGGGGGCAGGG - Intergenic
1024153778 7:46599736-46599758 CAGAAGCAGAAGAGAGAGAGAGG + Intergenic
1024293830 7:47827266-47827288 CAGGAGGACCAGCGGCAGTGGGG + Intronic
1024589385 7:50867956-50867978 CAGATGCAGCAAAGGCAGTGAGG + Intergenic
1024708161 7:51984632-51984654 CAGGAGCAAGAGAGTGACTGTGG + Intergenic
1024797717 7:53037839-53037861 CAGGAGCAGCAGGGACACTGAGG + Intergenic
1024817001 7:53283003-53283025 CAGGTGCTGGAGAGGAAGTGGGG - Intergenic
1025049298 7:55721031-55721053 CAGGAGCAAGAGAGAGAGGGTGG - Intergenic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1025608174 7:63054321-63054343 CCGGCGCGGCAGAGGGAGCGGGG - Intergenic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1026524638 7:71143505-71143527 CATGAGCAGAAGAGTGTGTGGGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1026767068 7:73166830-73166852 GAGGAGGAGGAGAGGGAGGGGGG - Intergenic
1026905470 7:74060499-74060521 CAGGTGCAGATGAGGGAGTTAGG + Exonic
1026953626 7:74363430-74363452 CAGGGGCAGCCCTGGGAGTGGGG + Intronic
1026955841 7:74376061-74376083 AAGGAACACCAGAGGGAGAGTGG + Exonic
1027837741 7:83266787-83266809 CAGGAGAAGAGGAGGGAGGGAGG + Intergenic
1028915184 7:96251258-96251280 AAAGAGCAGCAGATGAAGTGAGG + Intronic
1028927767 7:96378159-96378181 CAGGAGCAGGAGAGACAGAGAGG + Intergenic
1029488771 7:100859022-100859044 GAGGGGGAGCAGAGGGAGTGAGG - Intronic
1029495546 7:100894167-100894189 GAGGAGGAGGAGAAGGAGTGGGG + Exonic
1029502275 7:100939289-100939311 CAGGAGGAAGAGAGAGAGTGGGG + Intergenic
1029540124 7:101177926-101177948 CTGGAGCTGCAGATGGAGTCAGG - Intronic
1029563803 7:101321636-101321658 CCGGCGCGGCAGAGGGAGCGGGG - Intronic
1029678722 7:102092450-102092472 GAGGAGAGGCACAGGGAGTGAGG - Intronic
1029746326 7:102517538-102517560 CAAGAGCAGCGGAGAGGGTGCGG - Intronic
1029764264 7:102616517-102616539 CAAGAGCAGCGGAGAGGGTGCGG - Intronic
1029874862 7:103739715-103739737 CAGCAGCCGCTGGGGGAGTGGGG + Intronic
1030913947 7:115289125-115289147 CAGGAACAAGAGAGTGAGTGAGG + Intergenic
1031702780 7:124945467-124945489 CAGCAGCAACAGTGGCAGTGTGG - Intergenic
1031878069 7:127164140-127164162 CAGGAGCAAGAGAGTGAGGGGGG - Intronic
1032091914 7:128915405-128915427 CGGGAGCAGAGGCGGGAGTGGGG - Intergenic
1032331427 7:130984443-130984465 AAAGAACTGCAGAGGGAGTGTGG - Intergenic
1032428118 7:131838111-131838133 AAGGAGAAGTGGAGGGAGTGGGG + Intergenic
1032464011 7:132132229-132132251 CAGGAGCAGCTGGGAGAGAGAGG - Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1032553170 7:132804893-132804915 CGGGAGCAGCAGTGGGAGGAGGG + Intronic
1032794969 7:135269794-135269816 GAGGAGGGGCAGAAGGAGTGGGG + Intergenic
1032891555 7:136200118-136200140 CAGGAGCCACAGAGAGAATGTGG + Intergenic
1032903146 7:136333989-136334011 TAGAAGCAGCATAGGGTGTGTGG - Intergenic
1032947419 7:136869757-136869779 CAGCAACAGTAGAGGGAATGGGG - Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033300392 7:140179475-140179497 CAGGAGCAAAAGAGAGAGGGAGG - Intergenic
1033599900 7:142881817-142881839 GAGGAGCAGATGAGGGTGTGGGG - Intronic
1033763418 7:144461617-144461639 CAGGAGCAAGAGAGAGATTGTGG - Intronic
1033828317 7:145219699-145219721 AAGGAGCAGCAGAGAGAAGGGGG - Intergenic
1033931331 7:146526460-146526482 CAGGAGCAAGAGTGAGAGTGAGG + Intronic
1034365047 7:150539173-150539195 CAGTAGCAAGAGAGAGAGTGGGG + Intergenic
1034783693 7:153905337-153905359 GAAGAGCAGGAGGGGGAGTGGGG + Intronic
1034925293 7:155116353-155116375 CAGGAGCTGCACAGGCTGTGTGG - Intergenic
1035057537 7:156046097-156046119 CAGGAGCAGGAGCAGGAGAGAGG + Intergenic
1035117203 7:156534360-156534382 CAGGTGCAGCAAAGCCAGTGTGG + Intergenic
1035279427 7:157768235-157768257 CAGGAGATGCAGAGAGAGTGAGG + Intronic
1035285647 7:157804960-157804982 CAGGGGCAGCAAGGGCAGTGAGG - Intronic
1035311613 7:157973160-157973182 CTGGAGCAGCAGTGGGTGGGAGG + Intronic
1036813542 8:11884771-11884793 AAAGAGCAGCTGAGGGAGGGAGG + Intergenic
1037026155 8:14040619-14040641 GAGGAGAAGCAGAGGGAGCAGGG + Intergenic
1037150026 8:15626066-15626088 CAGGAGCAGCAGTGGCAGTGGGG + Intronic
1037172066 8:15904946-15904968 TAGGAGCAAGAGAGAGAGTGAGG + Intergenic
1037514954 8:19620870-19620892 CAGGAGCATCAGAGGGAACATGG + Intronic
1037821469 8:22137226-22137248 CAGGTGCAGCAGTGGCAGAGGGG + Intergenic
1038214031 8:25545362-25545384 CAGGAGCAAGAAAGAGAGTGAGG + Intergenic
1038423017 8:27445680-27445702 CATGAGCACCACAGGGAATGGGG - Intronic
1038659637 8:29486131-29486153 CAGGAGCTGGTGATGGAGTGAGG + Intergenic
1038959397 8:32502225-32502247 CAGGAGCAACAGAGGGTAAGGGG + Intronic
1039092114 8:33843334-33843356 AAGGAGCATCAGAGGGAGACTGG + Intergenic
1039156466 8:34564227-34564249 CAGGAGCAGGAGTGAGAGAGAGG - Intergenic
1039840014 8:41286446-41286468 CAAGGGAGGCAGAGGGAGTGTGG + Intronic
1041280767 8:56210062-56210084 CAAGAGAAGCAGGGGGAGCGAGG - Intronic
1041315950 8:56562731-56562753 CAGGAGCAAGAGAGAGAGTGAGG - Intergenic
1041393298 8:57367049-57367071 CAGCGGGAGCAGAGGCAGTGTGG - Intergenic
1041522198 8:58769157-58769179 CAGGAGCAACAGAGGCGGAGTGG + Intergenic
1041659990 8:60392069-60392091 CAGAAGGAGGCGAGGGAGTGAGG - Intergenic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1042609131 8:70578008-70578030 GTGGAGCAGCAGGGGGTGTGTGG - Intronic
1042737066 8:72001299-72001321 CAGGGGCAGCACACTGAGTGTGG + Intronic
1042749222 8:72139948-72139970 CAGGAGGAGGAGAAAGAGTGGGG - Intergenic
1042764747 8:72308761-72308783 CAGCAGCAGCAGTGGGGGTGTGG + Intergenic
1043334346 8:79155650-79155672 CAGGAGCAAGAGAGAGGGTGGGG - Intergenic
1043622481 8:82212837-82212859 CAAGAGCAGGAGAGTGAGAGAGG + Intergenic
1043956109 8:86361350-86361372 AAGAAGCAGCAGAGGTATTGAGG - Intronic
1045481177 8:102593455-102593477 CTGGAGCGGGAGAGGGAGGGGGG + Intergenic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045859797 8:106803274-106803296 AAGGAGTAGCAGAGGGACTGGGG - Intergenic
1047189169 8:122662180-122662202 CAGGAGCATAAGAGTGAGGGGGG - Intergenic
1048270207 8:133022225-133022247 GAGGAGGAGCAGGGGCAGTGAGG - Intronic
1048392097 8:133976796-133976818 CAGGAGCAGGAGAGAGAGATGGG - Intergenic
1048574216 8:135678282-135678304 CAGGAGGAGAGGAGGGAGAGAGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1048899217 8:139021964-139021986 CAGGGCCAGGAGAGGGAGAGGGG + Intergenic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049579557 8:143405117-143405139 CAGGAGCAGCAGGCAGGGTGGGG - Intergenic
1049734902 8:144199676-144199698 GAGGGGCAGCAGATGGTGTGAGG + Intronic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1050284352 9:4085771-4085793 CAGGAGCAAGAGAGAGAGTGGGG - Intronic
1051554228 9:18364825-18364847 CAGGAGGGAGAGAGGGAGTGGGG + Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052649632 9:31285328-31285350 CAGGAGCAGTTGAGGTAATGGGG - Intergenic
1052823825 9:33161068-33161090 CTGGAGAAGCAGCGGGTGTGGGG + Intronic
1053107690 9:35426212-35426234 CAGGAGGAGAAGAGGAATTGGGG - Intergenic
1053392807 9:37747879-37747901 CAGGAGCACCAGAGGGACAAGGG - Intronic
1053470245 9:38341127-38341149 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1054701734 9:68419590-68419612 GAGGATCAGCAGAGGAATTGTGG - Intronic
1055055783 9:72022538-72022560 CAGGAGGAAGAGAGAGAGTGGGG - Intergenic
1055110836 9:72557671-72557693 CAGGGACAGCAGTGGGAGTAGGG + Intronic
1055498760 9:76882611-76882633 CAGGAGCAAGAGAGAGAGAGGGG + Intronic
1056056101 9:82825766-82825788 CAGGAGCAAAAGAGAGAGTGAGG + Intergenic
1056226568 9:84501307-84501329 TGGTAGCAGCAGAGGGAGTGGGG - Intergenic
1056666746 9:88587476-88587498 AAGGAGCAGCAGAGGAAGGGTGG + Intergenic
1056766201 9:89446216-89446238 CAGAGGCAGCAGAGGGAGATCGG - Intronic
1056954573 9:91072053-91072075 GAAGAGAAGCAGAGGGAGGGAGG + Intergenic
1057176566 9:93004563-93004585 CAGAAGCAGCAGTGGGACAGAGG - Intronic
1057180100 9:93025153-93025175 CAGGGGAAGTAAAGGGAGTGGGG - Intronic
1057211048 9:93201315-93201337 CTGGAGGAGCAGGGGGAGTGGGG + Intronic
1057782942 9:98064751-98064773 CAGCAGCAGCTGAGGGACTGTGG - Intronic
1057855076 9:98595424-98595446 AAGGGGCAGCAGAGAGTGTGGGG + Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058498893 9:105590948-105590970 CAGGAGGAAAAGAGAGAGTGGGG + Intronic
1058561863 9:106238872-106238894 AAGGAGCAACAGAGGAAGTAAGG - Intergenic
1058636577 9:107044041-107044063 CGGGAGCAGCAGATGGAGCCGGG + Intergenic
1058843574 9:108934104-108934126 CAGCCGCAGCACTGGGAGTGCGG + Exonic
1058923954 9:109643513-109643535 CAGGAGACTCAGAGGGAATGTGG - Intronic
1059411802 9:114137205-114137227 CAGGAGCAAGAGAGAGAGTTGGG - Intergenic
1059736338 9:117103619-117103641 CAAGAGCAGGAGATGGAGTGTGG - Intronic
1060521490 9:124296552-124296574 CAGGAGCAGAAGAGGCAGGCAGG + Intronic
1060549052 9:124476625-124476647 AAGGGGCAGCAGAAGGAGTGGGG + Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060628975 9:125139004-125139026 AAGGTGGAGCAGAGGGAGGGTGG + Intronic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061091239 9:128427840-128427862 GAGGAGCCCCAGAGGGTGTGAGG + Intronic
1061309122 9:129750928-129750950 CAGGAGCAGCCCAAGGAGTGGGG + Intronic
1061808136 9:133147866-133147888 CAGGACCAGCAGAGGGAAAGAGG - Intronic
1061893640 9:133635712-133635734 CGAGAGCATCATAGGGAGTGGGG - Intergenic
1061953838 9:133951341-133951363 CAGGAGTAGAACAGGGACTGTGG + Intronic
1062042069 9:134408762-134408784 TCGGAGGAGCAGAGAGAGTGAGG + Intronic
1062107234 9:134762384-134762406 GAGGAGCAGAAGAGGGTGGGGGG + Intronic
1062274958 9:135726199-135726221 CAGGGGCAGCTGAGGGCCTGCGG + Intronic
1062318363 9:135978840-135978862 CTGGAGAAGCACAGAGAGTGAGG - Intergenic
1062349661 9:136132734-136132756 CAGGAGCCGCACAGGGAGGATGG - Intergenic
1062388014 9:136322368-136322390 CAGCAGCCTCAGTGGGAGTGGGG + Intergenic
1062446717 9:136598322-136598344 CAGGAGCACCTGGGGCAGTGTGG + Intergenic
1062446731 9:136598371-136598393 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446759 9:136598469-136598491 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446773 9:136598518-136598540 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446806 9:136598641-136598663 CAGGAGCACCTGGGGGAGTGTGG + Intergenic
1062446834 9:136598739-136598761 CAGGAGCACCTGGGGCAGTGTGG + Intergenic
1062542108 9:137046062-137046084 CGGGAGCAGCGGAGGCAGCGGGG + Exonic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1062621792 9:137426113-137426135 CAGGAGCAGGAGGGGCTGTGGGG + Intronic
1202794143 9_KI270719v1_random:105376-105398 CAGGAGCTGCAAAAGGAGAGAGG - Intergenic
1185711481 X:2307307-2307329 CAAGAGCAGGGGAGGGAGAGGGG + Intronic
1186069960 X:5808802-5808824 AAGCAGCAGGAGAGGGAGGGAGG - Intergenic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1186685645 X:11922298-11922320 CAGGAGCAAGAGAGCGGGTGTGG + Intergenic
1186830997 X:13390116-13390138 CAGGAGCAAGAGAGTGAGGGAGG - Intergenic
1187013386 X:15302565-15302587 CAGGAGGAGGAGAGGCAGTGAGG + Intronic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1188339117 X:28977373-28977395 CAGGAGCAAGAGAGAGAGTGGGG + Intronic
1189060824 X:37751901-37751923 CAGGAGCAAAAGAGGGACGGGGG + Intronic
1189431235 X:40949601-40949623 CAGGAGGAAGAGAGAGAGTGAGG + Intergenic
1189431549 X:40951637-40951659 CAGGAGGAAGAGAGAGAGTGAGG + Intergenic
1189729880 X:44008573-44008595 AAGGAGGAGAAGAGGGAGGGAGG + Intergenic
1189989824 X:46583882-46583904 CAGAAGCTGCAAAGGGTGTGGGG - Intronic
1190471251 X:50781762-50781784 CAGGATGAGGTGAGGGAGTGAGG - Intronic
1191695552 X:63986079-63986101 TAGCAGCAGCAGTGGCAGTGTGG - Intergenic
1192134015 X:68580252-68580274 GAGGAACAGCAGAGGGGATGAGG - Intergenic
1193026414 X:76850460-76850482 CAGGAGGAACAGAGAGAGGGGGG + Intergenic
1193467985 X:81869694-81869716 CAAAAGCAGCAGTGGCAGTGAGG - Intergenic
1193509762 X:82384461-82384483 CAGGATCTGCTGAGGGAGGGAGG + Intergenic
1193894684 X:87098673-87098695 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1193980949 X:88181093-88181115 CTGGAGCAGCTAAAGGAGTGTGG - Intergenic
1194192316 X:90852840-90852862 CAGGAGCAAGAGAGGAAGAGTGG - Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194394749 X:93368655-93368677 CAAGAGCAGGAGAGAGAGTGAGG + Intergenic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1195127413 X:101822275-101822297 CAGGAGCAGCAAAGCGGCTGTGG - Intergenic
1195544491 X:106100104-106100126 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1195648356 X:107258482-107258504 CAGGAGCAAGAGAGCCAGTGGGG + Intergenic
1195853704 X:109308907-109308929 CAGGGGCAGTAGTGGGACTGGGG + Intergenic
1196918131 X:120560593-120560615 CAGCAGCAGCTGAGGGACTGGGG + Exonic
1196970075 X:121099110-121099132 CAGGAGCAAGAGAGAGAGTGGGG + Intergenic
1197397541 X:125945523-125945545 CAGGAGCAAGAGGGAGAGTGGGG + Intergenic
1197558725 X:127991470-127991492 CAGGAGCAAGAGAGAGAGGGAGG + Intergenic
1197813812 X:130476205-130476227 CGGGAGCAAAAGAGGGAGTGGGG + Intergenic
1198261003 X:134964871-134964893 CAGGAGCAAGAGAGAGAGCGGGG + Intergenic
1198375045 X:136030526-136030548 CAGGAAGAGCAGCTGGAGTGGGG - Intronic
1198421190 X:136471963-136471985 GAGGAGCAACAGAGAGAGTGGGG - Intergenic
1198479360 X:137026968-137026990 CAGCAGAGGGAGAGGGAGTGAGG + Intergenic
1198600014 X:138272349-138272371 CAGGAGCAAAAGAGAGGGTGTGG + Intergenic
1198630942 X:138637910-138637932 CAGGAAAAGTAGAGGAAGTGTGG - Intronic
1198717455 X:139573507-139573529 CAGGAGCAGGAGAGTGATGGGGG - Intergenic
1198979106 X:142374572-142374594 CAGGAGCAAGAGAGGGAGCGGGG - Intergenic
1199261305 X:145778734-145778756 CAGAAGCAAGAGAGCGAGTGGGG - Intergenic
1199442151 X:147880342-147880364 CAGGAGCAAGAGAGAGAGTGGGG - Intergenic
1199683022 X:150240462-150240484 CAGCAGCAGCACTGAGAGTGAGG + Intergenic
1199720562 X:150540282-150540304 CAGGAGCAACAGAGAGAGCAGGG - Intergenic
1200538951 Y:4435290-4435312 CAGGAGCAAGAGAGGAAGAGTGG - Intergenic
1200933999 Y:8722410-8722432 CAGGAGGAAGAGAGGCAGTGAGG - Intergenic
1201229125 Y:11845973-11845995 CAGAAGCAGCAGTGGCAGTATGG - Intergenic