ID: 1097223394

View in Genome Browser
Species Human (GRCh38)
Location 12:57463068-57463090
Sequence CTGTGTGGTCTGTGTGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097223394_1097223397 -5 Left 1097223394 12:57463068-57463090 CCTTCTACACACAGACCACACAG 0: 1
1: 0
2: 3
3: 54
4: 365
Right 1097223397 12:57463086-57463108 CACAGGCAAAGCTCCCACCCAGG 0: 1
1: 0
2: 1
3: 24
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097223394 Original CRISPR CTGTGTGGTCTGTGTGTAGA AGG (reversed) Intronic
900546664 1:3233240-3233262 CTGTGTCGTCGGTGTGGAGGAGG + Intronic
900881813 1:5387110-5387132 GTGTGTGGTGTGTGTGTATGTGG + Intergenic
900942417 1:5808787-5808809 GTGAGTGGTGTGTGTGTTGATGG - Intergenic
901156990 1:7146809-7146831 GTGTGTGGTGTGTGTGCACATGG - Intronic
901157074 1:7148318-7148340 GTGTGTGGTGTGTGTGTGGGGGG - Intronic
901799278 1:11698061-11698083 CTGTGTGGTTTGTGTGTGGGTGG - Intronic
902769538 1:18637680-18637702 CTGTGGGGGCTGGGCGTAGATGG - Intronic
903231601 1:21925713-21925735 CTGGGAGGGCTGTGTGGAGAAGG - Intronic
903344735 1:22677049-22677071 CTTTGTGGTCTGTGCGTTGGCGG + Intergenic
903771823 1:25769101-25769123 GTGTGTGGTGTGTGTGTGGGAGG - Intronic
904497270 1:30893969-30893991 GTGTGTGGTGTGTGTGTGGAGGG - Intronic
904700493 1:32355076-32355098 CTGTGTGGTCTGTTCCTATAGGG + Intronic
905944261 1:41888711-41888733 GTGTGTGGTATGTGTGTGGGGGG - Intronic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
907894136 1:58668248-58668270 TTGTGATGTCTTTGTGTAGAAGG - Intronic
912330619 1:108817266-108817288 CTGTGTGGTTTGGGTGTGGGTGG + Intronic
912518073 1:110228279-110228301 CTGTGGGGTCTTTGTCTAGCTGG + Intronic
912700291 1:111873223-111873245 CTGTGTGCATTGTGTGTGGAGGG + Intronic
913129939 1:115830019-115830041 GTGTGGGGTCTATGTGTGGAAGG + Intergenic
913370096 1:118089145-118089167 CTGTGTGTTGTGTGGGGAGAGGG + Intronic
914338490 1:146738558-146738580 GTGTGGGGTGTGTGTGCAGAAGG + Intergenic
916171765 1:162006540-162006562 CTGTGTGCTCTGAGCGAAGATGG - Intronic
916674850 1:167056580-167056602 ATGTGTGGTATGTGTGTATGTGG + Intronic
917923260 1:179768298-179768320 CTGTGTGGTCTTTGTTTATGTGG - Intronic
918295131 1:183149473-183149495 CTGTGTGGTGTGTGAGGAGAGGG - Intergenic
918295150 1:183149565-183149587 CTGTGTGGTGTGTGAGGAGAGGG - Intergenic
918295155 1:183149595-183149617 CTGTGTGGTGTGTGAGGAGAGGG - Intergenic
918295159 1:183149625-183149647 CTGTGTGGTGTGTGAGGAGAGGG - Intergenic
918295192 1:183149782-183149804 CTGTGTGGTGTGTGAGGAGAGGG - Intergenic
918295199 1:183149812-183149834 CTGTCTGGTGTGTGAGGAGAGGG - Intergenic
918295229 1:183149979-183150001 CTGTGTGGTGTGTGAGGAGAGGG - Intergenic
918295236 1:183150009-183150031 CTGTCTGGTGTGTGAGGAGAGGG - Intergenic
918295242 1:183150040-183150062 CTGTGTGGTGTGTGAGGAGGAGG - Intergenic
918295261 1:183150136-183150158 CTGTGTGGTGTGTGAGGAGAGGG - Intergenic
918295266 1:183150166-183150188 CTGTGTGGTGTGTGAGGAGAGGG - Intergenic
918295271 1:183150196-183150218 CTGTGTGGTGTGTGAGGAGAGGG - Intergenic
918566733 1:185942971-185942993 TTGAGTGGTATGTGAGTAGAGGG - Intronic
918825650 1:189320421-189320443 CTGTGTGGTGTGTGTGTAGGGGG - Intergenic
919547257 1:198939365-198939387 TTGTGGGGTTTGTTTGTAGATGG + Intergenic
920089070 1:203439631-203439653 CTGTGTGATCTCTGTTTTGACGG + Intergenic
920232700 1:204481101-204481123 GTGTGTGGTGTGTATGTAGCGGG - Intronic
920440026 1:205974325-205974347 GTGTGTGGTGTGTGTGTGGAGGG - Intergenic
920571527 1:207021727-207021749 GTGTTTGGTGTGTGTGTGGAGGG - Exonic
920597602 1:207288385-207288407 AAGTGTGGTCTATGTGTAAATGG + Intergenic
922230871 1:223684516-223684538 CTGTGTGGACTGTAAGTAGTTGG + Intergenic
922618755 1:226978220-226978242 GTGTGTGGTGGGTGTGTAGAGGG - Intronic
922618911 1:226978919-226978941 GTGTGTGGTGGGTGTGTGGAGGG - Intronic
922722048 1:227904260-227904282 CTTTGTGCTCTGGGTGCAGACGG + Intergenic
922856796 1:228782238-228782260 GTGTGTAGTCTGTGTGTATGTGG + Intergenic
922856801 1:228782316-228782338 GTGTGTAGTCTGTGTGTATGTGG + Intergenic
922857541 1:228787988-228788010 CTGAGTGCACTGTGGGTAGATGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923377615 1:233380115-233380137 CTGTTGGGACTGTGTGTAGCAGG + Intronic
924895379 1:248332935-248332957 TTGTGTGGTTTTTGTTTAGAGGG - Intergenic
1064148317 10:12842528-12842550 ATCTGTGGTCTGTGTGTGCATGG + Intergenic
1064567190 10:16653386-16653408 CTCTGTTGTGTGTGTGCAGAGGG + Intronic
1065794834 10:29296657-29296679 TTGTGGGGTCTGAGTGGAGATGG - Intronic
1065981210 10:30899656-30899678 CTGTGTGCCCTGTGTGTGGGGGG - Intronic
1066129633 10:32380088-32380110 GTGTGTGGTGTGTGTGGGGAGGG - Intergenic
1066315748 10:34244926-34244948 CTGTGGGGTCACTGTGTACAAGG - Intronic
1066488532 10:35872277-35872299 CTCTGTGGTCAGTTTGTAGTAGG + Intergenic
1068404457 10:56571420-56571442 CTCTGTGGGCTCTGTGTACAAGG + Intergenic
1069468777 10:68667176-68667198 CTGTGAGCTCTGTGTATAGCCGG - Exonic
1069871329 10:71534985-71535007 CTGTGTGGGCTGTCAGGAGAGGG + Intronic
1070765457 10:79053695-79053717 GTGTGTGGTATGTGTGTTGGGGG + Intergenic
1071149440 10:82617148-82617170 CTGTGTGGTGTGTGTGTGAGTGG - Intronic
1071724375 10:88181848-88181870 CTTTGTGTTTTCTGTGTAGATGG + Intergenic
1073926632 10:108523711-108523733 CTTTGTTGTTTTTGTGTAGAGGG - Intergenic
1074132119 10:110588879-110588901 CTGTTGTGTGTGTGTGTAGAGGG + Intronic
1074909287 10:117892912-117892934 CTGTGTGGTTCCTGTGGAGAAGG - Intergenic
1075997730 10:126892230-126892252 GTGTGTGGTGTGTGTATATATGG - Intergenic
1077632955 11:3823588-3823610 GTGTTTGGTCAATGTGTAGATGG - Intronic
1081641306 11:44756248-44756270 GTGTGTTGTGTGTGTGTGGAGGG + Intronic
1084259241 11:67963964-67963986 CTGAGTGGTCTGTTTGGACAGGG - Intergenic
1084641929 11:70431372-70431394 CAGTGTGGCGTGGGTGTAGAGGG + Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1084876577 11:72137903-72137925 GTGGGTGGGCTGTGTGTAGAAGG - Intronic
1087486247 11:98762868-98762890 CTGAGTGGTCTGTTTTGAGAGGG + Intergenic
1087958438 11:104318951-104318973 ATGTGGGGTCAGAGTGTAGAGGG - Intergenic
1088333064 11:108673216-108673238 ATGTGTGGTGTGTGTGTATTGGG + Intronic
1088391993 11:109324601-109324623 CAGTGTGGTCTCAGTCTAGAGGG - Intergenic
1089069686 11:115689791-115689813 CTTTGTGTTCTGACTGTAGAGGG + Intergenic
1091023974 11:132125825-132125847 GTGTGTGGTGTGTGTGTGGCTGG + Intronic
1092515240 12:9204630-9204652 TTGTGTAGTGTGTGTGTAGCAGG - Intronic
1093556726 12:20484889-20484911 TGGTGTGGTTTGTGTGTTGATGG + Intronic
1094123858 12:27002024-27002046 TTGTGGGGTATGTGTGTAGGGGG - Intronic
1097223394 12:57463068-57463090 CTGTGTGGTCTGTGTGTAGAAGG - Intronic
1101875649 12:108595388-108595410 GTGTGTGGTATGTGTGTGCATGG - Intronic
1102549682 12:113682709-113682731 CAGTGGGGTCTGTTTGGAGATGG - Intergenic
1103054909 12:117811201-117811223 CTGTGTTGTGTGGGTGTAGAGGG - Intronic
1103606924 12:122093733-122093755 CTGTGTGGTGTGTGTGGTGTGGG + Intronic
1104459400 12:128942652-128942674 CTGTGTGGTCTGGGAGAAGTGGG - Intronic
1104907989 12:132225429-132225451 TTGTGTGGTGTGTGTGTGGGGGG - Intronic
1104910968 12:132240878-132240900 GTGTGTGGTGTGTGTGTAATGGG - Intronic
1104911783 12:132243306-132243328 GTGTGTGGTGTGTGTGTAATGGG - Intronic
1104972170 12:132536069-132536091 TAGTGTGTTCTGTGTGTACATGG + Intronic
1106404920 13:29465095-29465117 CTGTGTCCTCTGTGTAGAGAGGG - Intronic
1106408106 13:29491352-29491374 GTGTGTGGTAGGTGTGTATATGG + Intronic
1106408116 13:29491426-29491448 GTGTGTGGTGTGTGTGTAGTGGG + Intronic
1106520898 13:30496874-30496896 GTGTGTGGTGTGTGTGTTGCAGG - Intronic
1106560698 13:30843627-30843649 GTGTGTGGTGTGTGTGTATGTGG + Intergenic
1106560710 13:30843767-30843789 CTCTGTGGTGTGTGTGCATATGG + Intergenic
1107183149 13:37485508-37485530 TTGTGTGTTCTGTGTGTGCAAGG + Intergenic
1107631156 13:42344034-42344056 CTGTGTTGTGTGTGTGTTTAGGG - Intergenic
1107662529 13:42653809-42653831 CTGGGTGCTCTGTATGTTGAAGG - Intergenic
1109144414 13:58759904-58759926 CTAGGTGGTCAGTGTGGAGAAGG - Intergenic
1110453230 13:75660719-75660741 CTGTGCTGTCTATGAGTAGAAGG + Intronic
1110957420 13:81572616-81572638 CTGTGTGGTCTGACTGAAGCAGG + Intergenic
1112684481 13:101808082-101808104 CTCTGTGGTTTGTGTCTAGGAGG + Intronic
1112808060 13:103184534-103184556 CTGTGTGTTTTGTGTTTACAAGG + Intergenic
1113263540 13:108592408-108592430 GTGTGTGGTGTGTGTGTGGAGGG + Intergenic
1113533154 13:111044107-111044129 GTGTGTGGTGTGTGTGTGCATGG - Intergenic
1113607565 13:111621398-111621420 CTGTGTGGTGTGTGTCTGTATGG + Intronic
1113900705 13:113795417-113795439 GTGTGTAGTCTGTGTGGAGAGGG - Intronic
1114515926 14:23300562-23300584 CTTTGTGGACTGTTTGTCGAGGG - Intronic
1114615800 14:24067742-24067764 CTGTGAGGTGTGTGTGCAGTGGG - Intronic
1114832455 14:26161698-26161720 CAGTCTATTCTGTGTGTAGAAGG + Intergenic
1117239038 14:53809725-53809747 CTCTGTGGGTTCTGTGTAGAGGG - Intergenic
1117981740 14:61348492-61348514 CTGTTTAGACTGTGTTTAGATGG + Intronic
1118328932 14:64801070-64801092 CTGCCTGGTCTGTTTGGAGATGG - Intronic
1118438415 14:65791679-65791701 GTGTGTGGTCTGTGTGTGCATGG + Intergenic
1121608413 14:95258482-95258504 ATCTGTGGTGTGTGTGTTGAGGG + Intronic
1121608429 14:95258631-95258653 GTGTGTGGTGTGTGTGTGGAGGG + Intronic
1121608442 14:95258764-95258786 ATCTGTGGTGTGTGTGTGGAGGG + Intronic
1121608453 14:95258875-95258897 ATCTGTGGTGTGTGTGTGGAGGG + Intronic
1122076775 14:99240552-99240574 CTGAGTTTTCTGTATGTAGATGG + Intronic
1123195506 14:106612006-106612028 CTGGGTTGTCTGTCTGAAGAAGG + Intergenic
1123202997 14:106684607-106684629 CTGGATGGTCTGTCTGGAGAAGG + Intergenic
1124168531 15:27351427-27351449 GTGTATGGTGTGTGTGTATATGG + Intronic
1125083998 15:35708674-35708696 CTCTGTCTTCTGTGTGGAGATGG + Intergenic
1125727038 15:41873445-41873467 CAGTGTGGTCTGGGTGATGATGG - Intronic
1128007869 15:64262153-64262175 ATGTCTGGTATCTGTGTAGATGG - Intronic
1130045916 15:80444334-80444356 GTGTGTGGTTTGTGTGTACGTGG + Intronic
1130045949 15:80444816-80444838 ATGTGTGGTGTGTGTGTGAATGG + Intronic
1130624883 15:85503960-85503982 CTTTGTGTGCTGTGTGTTGAAGG + Intronic
1131403639 15:92145966-92145988 CTCTGTGTTCTGTGGGGAGAGGG + Intronic
1135720212 16:24810979-24811001 CTGAGGGGTCTGTCTGGAGAGGG - Intronic
1136344630 16:29666767-29666789 CTGTGGGGCCTGGGTGGAGAGGG + Exonic
1136405673 16:30045270-30045292 GTGTGTGGTGTGTGTGTGGTGGG + Intronic
1136653506 16:31693953-31693975 ATGTGTGGTGTGTGTGTATGTGG - Intergenic
1136653562 16:31694395-31694417 GTGTGTGGTGTGTGTGTATGTGG - Intergenic
1137273019 16:46915280-46915302 CTCTGTGGTGTGTGTGTATGTGG - Intronic
1138593846 16:58018799-58018821 CTGTTTTGTCTGTCTGTGGAGGG + Intronic
1139736596 16:68995168-68995190 TTGTGTGGTCTGTGTGTGACTGG + Intronic
1139995788 16:70978796-70978818 GTGTGGGGTGTGTGTGCAGAAGG - Intronic
1140219879 16:73036088-73036110 CTGTGTGGTATGTGTGTATGGGG - Intronic
1141097515 16:81173165-81173187 CTGTGTGGTCTGTGTGCTTGGGG + Intergenic
1141318053 16:82980153-82980175 CAGTGAGGTGTGTGTGCAGAAGG + Intronic
1141506615 16:84482351-84482373 CTCAGTGGTTTGTGTGCAGATGG - Intronic
1142011077 16:87714446-87714468 CTGGCTGGTCTGTGTGTGGCGGG - Intronic
1144476277 17:15591806-15591828 GTGTGTGGTGTCTGTGTGGAGGG - Intronic
1144734757 17:17548877-17548899 CTGTCTGGGCAGTGTGTGGAGGG + Intronic
1147117414 17:38311729-38311751 CTGTGTCGTCAGTGGGTGGAAGG - Intronic
1147365088 17:39953828-39953850 CTGGGTGCTCTGTGTGGTGAGGG + Intergenic
1147613410 17:41814126-41814148 CTGTGGGGTCTGTGTGTAACTGG - Intronic
1147651629 17:42065624-42065646 GTGTGGGGACTGTGTGTGGATGG + Intergenic
1149458629 17:56809763-56809785 GTATGAGGTGTGTGTGTAGAGGG - Intronic
1150411138 17:64941326-64941348 ATGGGTGGGCAGTGTGTAGATGG + Intergenic
1151374781 17:73679974-73679996 CTGTGTGGCATGTGTGTATATGG + Intergenic
1151518675 17:74613530-74613552 CTGTGGGGTCTGTGGGGAGATGG - Intronic
1151635398 17:75344218-75344240 CTGTGTGGACTGTGAGTAGAAGG + Intronic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1152394572 17:80024317-80024339 GTGTGTGGTATGTGTGTCTATGG - Intronic
1152394579 17:80024389-80024411 GTGTGTGGTATGTGTGTCTATGG - Intronic
1152394583 17:80024459-80024481 GTGTGTGGTGTGTGTGTCTATGG - Intronic
1152394591 17:80024541-80024563 GTGTGTGGTGTGTGTGTATATGG - Intronic
1152394597 17:80024599-80024621 GTGTGTGGTGTGTGTGTCTATGG - Intronic
1152394621 17:80024922-80024944 GTGTGTGGTGTGTGTGTCTATGG - Intronic
1152394636 17:80025098-80025120 CTGTGGTGTTTGTGTGTATATGG - Intronic
1152854358 17:82655761-82655783 GGGTGTGGTCTGTGGGCAGAAGG - Exonic
1152858940 17:82684347-82684369 CGGTGTGGTCAGTGTGGAAAAGG + Intronic
1153741499 18:8134240-8134262 ATGAGTGGTCTGTGTATAGATGG - Intronic
1156406885 18:36791315-36791337 CTGTGTCTTCAGTGTGGAGATGG - Intronic
1156835009 18:41542217-41542239 CTGTCAAGACTGTGTGTAGATGG - Intergenic
1157288213 18:46391981-46392003 ATGTGTGGTATGTGTGTACGTGG - Intronic
1157296481 18:46448456-46448478 GGGTGTGGTCTGTGGGTAAAGGG + Intronic
1159983291 18:74812389-74812411 CTGTTTTCTCTGGGTGTAGAGGG - Intronic
1160049126 18:75415320-75415342 CTGTGTTCTCTGTATGGAGATGG + Intronic
1160325030 18:77938275-77938297 CTGTGTGGTGTATTTGTATAAGG + Intergenic
1160523495 18:79522254-79522276 GTGTGTGTTTTGTGTGTAGAGGG + Intronic
1161884162 19:6980692-6980714 CTGTGTGGTCAGTGTGGAAAAGG + Intergenic
1164314236 19:24072627-24072649 CTGTGTGGTCATGGTGCAGATGG - Intronic
1164717575 19:30404799-30404821 CTGTGGGATCTCTGGGTAGATGG - Intronic
1164828900 19:31305188-31305210 ATTTGTGGTGTGTGTGTGGAGGG - Intronic
1165314680 19:35047354-35047376 CCTTGTGGTCTGTGTGTGGCTGG + Intronic
1166304588 19:41930410-41930432 GTGTGTGCTGCGTGTGTAGATGG + Intergenic
1166344146 19:42154994-42155016 GTGTGTGGACTGTGTGTGGAGGG - Intronic
1168241573 19:55091620-55091642 CTGTGGGGGCTGTGGGCAGAGGG - Intronic
925156820 2:1655014-1655036 GTGTGTGGTGTGTGTGAGGAGGG - Intronic
925160430 2:1680130-1680152 GTGGATGGTGTGTGTGTAGATGG + Intronic
925914759 2:8596772-8596794 TTGTGTGGTGTGTGTGTGGCAGG + Intergenic
925944002 2:8844010-8844032 CTATGTGGTTTTTATGTAGAGGG + Intergenic
925976273 2:9144236-9144258 GTGTGTGGTGTGTGTGTGGGGGG - Intergenic
926369094 2:12162516-12162538 GTGTGGTGTGTGTGTGTAGAAGG - Intergenic
926806496 2:16716493-16716515 GTGTGGGGGCTGTGTGTGGAGGG + Intergenic
926946001 2:18188201-18188223 CTGTGTGCTCTAGGTGCAGAGGG + Intronic
927668516 2:25049332-25049354 CTGTCTGCTCTGTGTTTGGAAGG + Intronic
927888308 2:26731873-26731895 CTGTGCAGTCTGTGTGAGGATGG - Exonic
928638592 2:33274444-33274466 CTGTTTGGTGTGTGTGTATGGGG + Intronic
929966610 2:46542001-46542023 CTGGCTGGTGTGTGTGTGGAGGG + Intronic
930535780 2:52644458-52644480 CTGTGTGCTGTGTCTGTTGAGGG - Intergenic
931257686 2:60587721-60587743 CTCTGTGGGTTGTGGGTAGATGG + Intergenic
931626777 2:64263225-64263247 CTGAGTTGTCTCTGGGTAGAGGG - Intergenic
932300691 2:70665005-70665027 CTGTGTGGTGTGTGTGTGATGGG + Intronic
932705821 2:74024356-74024378 CTGTGCCCTCTGTGTGTGGAGGG + Intronic
934149258 2:89129663-89129685 ATGTGTCCTCTGTGTTTAGAGGG + Intergenic
936079434 2:109422408-109422430 CTGTACGGTCAGTGTGTCGATGG + Intronic
936103934 2:109608394-109608416 CTGTGTGGTCTGTATTTATGGGG - Intronic
937009936 2:118553402-118553424 CTGAATGTTCTGTGTGTACATGG - Intergenic
937010357 2:118557334-118557356 CTGAATGTTCTGTGTGTACATGG - Intergenic
937390154 2:121478935-121478957 GTGTGTGGTGTGTGTGTGGGGGG - Intronic
938215079 2:129504493-129504515 CTCTTTGGTCTGTGTGTTTATGG + Intergenic
941311916 2:163943807-163943829 GTGTGGGGAATGTGTGTAGAAGG + Intergenic
941855104 2:170222959-170222981 GTGTGTGGTGTGTGTGGAGTAGG - Intronic
946187678 2:217990380-217990402 GTGTGTGGCCTATGTGTGGATGG - Intronic
947318394 2:228889932-228889954 CTGTGTGGGCTGTGTCTGGAGGG - Intronic
947769030 2:232656175-232656197 GTGTGAGGTCTGTGTGGAGTGGG + Intronic
947994418 2:234515260-234515282 GTGTGTGGTCCGTGTGTAAAGGG + Intergenic
948192616 2:236071542-236071564 ATGTGTGCTGTGTGTGCAGAGGG + Intronic
948544084 2:238713758-238713780 GTGTGTGGTGTGTGTGTATGTGG - Intergenic
948569385 2:238907864-238907886 TTGTGTGGTGTGTGTGTATGTGG - Intronic
948716380 2:239866487-239866509 CTATGTGGTGTGTGTGTATGTGG - Intergenic
948753865 2:240147826-240147848 GTGTGTGGTGTGTGTGTATGTGG + Intergenic
948784783 2:240346716-240346738 GTGTGGGGTCTGTGTGTGCAGGG - Intergenic
948784802 2:240346827-240346849 GTGTGGGGTCTGTGTGTGCAGGG - Intergenic
948784809 2:240346868-240346890 GTGTGGGGTCTGTGTGTGCAGGG - Intergenic
949064535 2:241981750-241981772 CTGTGTAGTCTGTGTGGTGCAGG + Intergenic
1170247690 20:14241326-14241348 TTATGTGGTTTATGTGTAGAAGG + Intronic
1171429012 20:25067722-25067744 GTGTGTGGTTTGTGTGCATATGG - Intergenic
1172904131 20:38356273-38356295 GTGTGTGGTGTGTGTGTAGGGGG - Intronic
1173322549 20:42001373-42001395 CTGTGTGCTCTGTGTCGAGAGGG + Intergenic
1173653710 20:44684439-44684461 TTGGATGGTCTGTGTGTGGAGGG - Intergenic
1174896934 20:54459552-54459574 CAGTGTGGTCTGTGTCTTCATGG + Intergenic
1174986469 20:55459693-55459715 CTTAGTGGTTTGAGTGTAGAAGG + Intergenic
1176884438 21:14237532-14237554 CTGGATGTTCTGTGGGTAGAAGG - Intergenic
1178363720 21:31970971-31970993 CAGTGTCTTCTGTGTGTATAAGG + Intronic
1178511943 21:33212726-33212748 CAATGAGGTATGTGTGTAGAGGG + Intergenic
1178599770 21:33985590-33985612 GTGTGTGGTGTGTGTGTACATGG - Intergenic
1179153713 21:38831515-38831537 CTGTGTGTTCTTTGGGTAGGAGG - Intergenic
1179279228 21:39920039-39920061 ATGTGTGGTGTGTGTGTGTAGGG + Intronic
1179461126 21:41536086-41536108 CTGGGTTGTCTGGGTGCAGATGG - Intergenic
1179532065 21:42026434-42026456 GTGTGGGGTGTGTGTGTGGAGGG + Intergenic
1179620932 21:42615429-42615451 GTGTGTGGTGTGTGTGTATGTGG - Intergenic
1179620954 21:42615696-42615718 GTGTGTGGTGTGTGTGTATGTGG - Intergenic
1179769576 21:43604480-43604502 GTGTGTGGTGTGTGTGTGTATGG - Intronic
1179769664 21:43605369-43605391 GTGTGTGGTGTGTGTGTCGGGGG - Intronic
1180141936 21:45898287-45898309 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141940 21:45898313-45898335 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141950 21:45898365-45898387 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141955 21:45898391-45898413 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141960 21:45898417-45898439 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180141988 21:45898531-45898553 CTGGGAGGACAGTGTGTAGAGGG - Intronic
1180142007 21:45898601-45898623 CCGTGAGGACGGTGTGTAGAGGG - Intronic
1180142021 21:45898645-45898667 CTGTGAGGACGGTGTGCAGAGGG - Intronic
1180986833 22:19909844-19909866 GTGTGTGGTGTGTGTGTGAAGGG - Intronic
1181794902 22:25300359-25300381 ATGTGTGGTGTGTGTGTGTAGGG + Intergenic
1181967432 22:26666867-26666889 CTGTGGGGTCTGTGTGGGGAAGG + Intergenic
1182022572 22:27093680-27093702 ATGTGTGGTGTGTGTGTATTGGG - Intergenic
1182832191 22:33313267-33313289 CTGAGTGGACTGAGAGTAGAAGG - Intronic
1183265911 22:36825146-36825168 CTGTGTGGTGTGTGTGTGTAAGG + Intergenic
1183686517 22:39364081-39364103 CTGGGTGGTCTGTCTGCAGAGGG + Intronic
1184880962 22:47303935-47303957 GTGTGTGGTGTGTGTGTGGGGGG + Intergenic
1184880969 22:47303978-47304000 GTGTGTGGTATGTGTGTATGGGG + Intergenic
1184880974 22:47304054-47304076 GTGTGTGGTGTGTGTGTGTACGG + Intergenic
1184945747 22:47802602-47802624 CTGGGGGGTCTTTGTGGAGACGG + Intergenic
1185056826 22:48584743-48584765 GTGTGTTGTGTGTGTGTGGAGGG - Intronic
1185119370 22:48956865-48956887 GTGTGTGGTGTGTGTGTGGGGGG - Intergenic
1185351005 22:50338401-50338423 GTGTGTGGTATGTGTGTGTAGGG + Intergenic
950620453 3:14201378-14201400 CTGTATGGTCTAAGTGCAGAAGG + Intergenic
950822417 3:15775318-15775340 TTGAGTGGTGTGTGAGTAGAAGG - Intronic
950880171 3:16316967-16316989 CTGTGTGGGGTGGGTGTGGAGGG - Exonic
951708193 3:25565127-25565149 CGCTGTGGACTGTGTGTACATGG + Intronic
952791291 3:37202669-37202691 CTGTGTGTTTTGTGTGTGGGTGG - Intergenic
954144108 3:48625861-48625883 CTGAGTTGTGTGTGTGTACATGG + Exonic
955333250 3:58064849-58064871 CTGTGTGGTGTGTGTGTGGCGGG - Intronic
955862265 3:63344233-63344255 CTGTGTATTCTGTTTGTAAAGGG - Intronic
955950180 3:64235920-64235942 CTGCGTTGTGTGTGTGTAGTTGG + Intronic
956749992 3:72337683-72337705 TTGTGTGGTGTGTGTGTGGGGGG + Intergenic
957352348 3:79041765-79041787 CTCTGTGGTCTCTGAGCAGATGG + Intronic
960062188 3:113334707-113334729 CTGTTTCGTATGTGTGTAGGTGG - Intronic
960991087 3:123311804-123311826 TTGTGTGGCCTGGGGGTAGAGGG + Intronic
961122528 3:124385014-124385036 CTCTTTGGTGTGTGTGTGGAAGG - Exonic
961445956 3:126981924-126981946 CTGTCTGCTCTGTGTGGTGAGGG - Intergenic
962304739 3:134275771-134275793 CAGTGTGGTCTGCATGTAGGAGG + Intergenic
962850953 3:139307982-139308004 CTGGGTGGTGTGCATGTAGATGG + Intronic
963591594 3:147267492-147267514 CTGTGAGTTCTGCATGTAGACGG - Intergenic
964398318 3:156272070-156272092 CTGTGTGAGCTGTGTGGAGCTGG + Intronic
967782790 3:193457975-193457997 CTGTGTTGTCTTTGGGTAAAAGG - Intronic
967884620 3:194324599-194324621 GTGTGTGGTGTGTGTGTATGTGG - Intergenic
968631195 4:1652936-1652958 CTGTGTGGTATGTGTGTGGTGGG - Intronic
969687936 4:8686887-8686909 GTGTGTGGTGTGTGTGTGGAGGG + Intergenic
970362888 4:15327678-15327700 CTCTGTGGTCTGTCTGTTAAAGG + Intergenic
974871043 4:67642504-67642526 TTGTGTGGGCAGTGTGTAAAGGG - Intronic
975336608 4:73184053-73184075 CTTTGTGTTTTGAGTGTAGAAGG - Intronic
976779347 4:88740981-88741003 CTCTGTGGTAGGTGTGTAGCGGG - Intronic
979317926 4:119288399-119288421 CTGTATTATCTGTGTGTAAATGG - Intronic
980411857 4:132430042-132430064 CTGTGGGGTATGTCTGTAGGTGG + Intergenic
982664364 4:158243518-158243540 AGGTGTGGTCTTTGTGGAGAAGG - Intronic
983882186 4:172945673-172945695 CTGTGTGAGCTGTTTGTAGGTGG - Intronic
985707469 5:1409846-1409868 CCCTGTGCTCTGTGTGCAGATGG - Exonic
985936552 5:3101952-3101974 CTGTGTGTTCTCTGTGAAGATGG - Intergenic
986483039 5:8208514-8208536 GTGTGTGGTATGTGTGTACGTGG + Intergenic
986549195 5:8934194-8934216 CAGTGTGGTGTGTGTGGAGACGG - Intergenic
986793042 5:11181927-11181949 GTGTGTGGTGTGTGTGTGGGGGG + Intronic
986793065 5:11182082-11182104 ATGTGTGGGGTGTGTGTGGATGG + Intronic
986793068 5:11182110-11182132 GTGTGTGGTGTGTGTGTGGATGG + Intronic
986818843 5:11443387-11443409 GTGTGTGGTGTGTGTGTGGGGGG + Intronic
987536563 5:19196937-19196959 CTGTGTGTTCCATGAGTAGAGGG + Intergenic
988527969 5:32002904-32002926 GTGTGTGGTGTGTGTGTGGTGGG - Intronic
988527998 5:32003152-32003174 GTGTGTGGTGTGTGTGTTGGTGG - Intronic
988637032 5:32995774-32995796 CTGCATGGTCTGCGTGTTGAGGG + Intergenic
991254098 5:64595711-64595733 CTGAGTGTTCTGTGTGTATGAGG + Intronic
991585150 5:68194515-68194537 GTGTGTGGTGTGAGTGTAGGGGG + Intronic
991690611 5:69221573-69221595 ACGTGAGGTCTGTGTCTAGATGG - Intronic
992550079 5:77851588-77851610 CTGTGTGGTGGGTGTGTAAGAGG + Intronic
993672505 5:90778214-90778236 GTGTGTGGTGTGTGTGTGTACGG + Intronic
996816932 5:127584544-127584566 CTGTGAGGTCTCTGAGTATATGG - Intergenic
997139636 5:131364876-131364898 CAGTGTGCTCAGTGTTTAGATGG + Intronic
997428920 5:133824027-133824049 CTGGGTGGTGTGGGGGTAGAGGG - Intergenic
998103186 5:139451172-139451194 ATGTGTGGTGTGTGTGTATGTGG + Intronic
998187509 5:139993107-139993129 GTGTGTGGTGTGTGTGTGGTGGG + Intronic
999178973 5:149655394-149655416 GTGTGTGGTGTGTGTGTGGGGGG - Intergenic
1000332094 5:160213746-160213768 CTGTGTTGTCTGCGTGCACATGG + Exonic
1001410052 5:171505101-171505123 TTGTGTGGTGTGTGTGTTGGGGG + Intergenic
1001427403 5:171632332-171632354 GTGTGTGGCATGTGTGTAGGAGG + Intergenic
1001550205 5:172597303-172597325 GTGTGTGGTGTGTGTGTATGTGG - Intergenic
1001550210 5:172597393-172597415 GTGTGTGGTGTGTGTGTATGTGG - Intergenic
1002058872 5:176614452-176614474 GTGTGTGCTCTGTGTGTGGGGGG + Intergenic
1002394910 5:178945131-178945153 GTGTGTCGTGTGTGTGTTGAGGG + Intronic
1003534348 6:6963170-6963192 TTGTGTGGTGTGTGTGTAAAAGG - Intergenic
1003541973 6:7025988-7026010 CTGGCTGGTCTGTGGGCAGATGG - Intergenic
1005250418 6:23939734-23939756 CAGTGTGGTCTGAGTGTGGTTGG - Intergenic
1005348247 6:24910743-24910765 CGGTGAGGTCTGTGTGGGGAGGG - Intronic
1006907918 6:37545510-37545532 CTGTGTTTTCTGCGTGGAGATGG + Intergenic
1007159021 6:39774063-39774085 GTCTGTCATCTGTGTGTAGAGGG - Intergenic
1007168417 6:39845127-39845149 GTGTGTAATGTGTGTGTAGATGG - Intronic
1007168426 6:39845282-39845304 CTGTGTGATGTGTGTATAGATGG - Intronic
1008574595 6:52848111-52848133 TTGCTTGGTCTTTGTGTAGAAGG - Intronic
1008666857 6:53725193-53725215 CTGTGTGGTCCACGTGTAGTTGG + Intergenic
1010235509 6:73572032-73572054 CTGAGTGGTCTGTTTTTACAGGG + Intergenic
1013309250 6:108878456-108878478 CTGTGTGGTGTGTGTTTATCTGG + Intronic
1013599202 6:111688506-111688528 CTATGTGCTCTGTGTCTACAAGG + Intronic
1015110961 6:129590805-129590827 GTGTGTGGTTTGTGTGTCTATGG + Intronic
1016197014 6:141356595-141356617 CTGTGGGGTGTGTGTGTATATGG - Intergenic
1018988949 6:168658944-168658966 GTGTGTGGTGTGTGTGTATATGG + Intronic
1019074044 6:169372706-169372728 GTGTGTGGTGTGTGTGTTGTGGG - Intergenic
1019188281 6:170234065-170234087 CTGTGTGTTCTGTGTGGGGAGGG - Intergenic
1019456446 7:1130238-1130260 CTTTGTGGACTGTGTGATGAGGG + Intronic
1019521094 7:1460816-1460838 CAGTGAGGCCTGTGTGTAGGTGG + Intergenic
1019639315 7:2094785-2094807 GTGTTTGGTCTCTATGTAGATGG - Intronic
1020825798 7:13026328-13026350 CTGTGTGATTTCTGTGTAAATGG + Intergenic
1021284087 7:18757731-18757753 GTGTGTGCTCTGTGTGTGGGTGG + Intronic
1021927486 7:25547382-25547404 CTGTTTGCTCTTTGTGAAGATGG + Intergenic
1027975095 7:85143602-85143624 ATGTGTAGTCTGTGAGTTGATGG + Intronic
1028453119 7:91007963-91007985 CTTTGTGGTCAGTGTGTGTATGG + Intronic
1030020076 7:105265092-105265114 GTGTGTGTGTTGTGTGTAGAAGG - Intronic
1034262211 7:149764275-149764297 GGGGGTGGTCTGTGTGTGGATGG + Intronic
1034341492 7:150359521-150359543 GTGTGTGGTGTGTGTGTGGTGGG - Intergenic
1034432096 7:151046159-151046181 CTGGGTGTTCTTGGTGTAGATGG - Intronic
1035083595 7:156237371-156237393 CTGTGTGGTGTGTGTGTGTGTGG + Intergenic
1035283151 7:157789762-157789784 ATGTGTGGTGTGTGTGTATATGG + Intronic
1035283189 7:157790118-157790140 GTGTGTGGTGTGTGTGTGGTGGG + Intronic
1035478951 7:159166171-159166193 ATGTGTGGTGTGTGTGTATATGG + Intergenic
1035555509 8:564518-564540 GTGTGTGGCATGTGTGTATACGG - Intergenic
1036476056 8:9094538-9094560 CTCTGTGTCCTGTGTGTTGATGG + Intronic
1036627609 8:10484419-10484441 CTGTGGGGACTGAGTATAGAAGG + Intergenic
1037334393 8:17778207-17778229 CTGTGTGGTTTGTGTATCAATGG - Intronic
1038066857 8:23972429-23972451 CTTTGTGGTCTGGGGGCAGAGGG - Intergenic
1038749595 8:30283191-30283213 CTTTGGTGTTTGTGTGTAGAGGG - Intergenic
1039040477 8:33403300-33403322 GTGTGTGGACTGTGTGTGTATGG + Intronic
1039610878 8:38918296-38918318 GTGTGTGGTGTGTGTGTATAAGG - Intronic
1039717819 8:40129690-40129712 CTGTATGCTGTATGTGTAGAGGG + Intergenic
1040887051 8:52276273-52276295 TTGTGTGGTATGTGTGTATGTGG - Intronic
1043345135 8:79289187-79289209 GTGTGTGGTGTGTGTGTCGTGGG + Intergenic
1045573493 8:103394028-103394050 CAGTGTTGTCTGTGGTTAGATGG + Intergenic
1045915453 8:107464837-107464859 CAGTGTGGTAAGTGTGTTGATGG + Intronic
1046103120 8:109637063-109637085 CTTTGTGGTCTGTGTGTATTTGG - Intronic
1046847529 8:118934664-118934686 CTGTGTTTTTTGTGTGTAGGGGG + Intronic
1047523568 8:125614315-125614337 CTGTGTGGTCTGTATGTGTGAGG + Intergenic
1047997098 8:130347542-130347564 CTGTGTGATCTGGGTATAAACGG + Intronic
1048254164 8:132893104-132893126 GTGTGTGGTATATGTGTGGAGGG + Intronic
1048293020 8:133194678-133194700 GTGTGTGGTGTGTGTGTGGAGGG + Intronic
1049429946 8:142557056-142557078 CTCTGTTGTCCGTGTGGAGAAGG + Intergenic
1049504788 8:142990484-142990506 GTGTGTGGTGTGTGTGTGGTAGG + Intergenic
1052438383 9:28460804-28460826 GTGTGTGGTTTGTGTGTGGGGGG + Intronic
1052994182 9:34541278-34541300 CCATGTGGTATGTGTGTAGTTGG - Intergenic
1053011200 9:34634827-34634849 ATGTGTTGTGTGTGTGTAAAAGG + Exonic
1053346713 9:37383533-37383555 CTGTGTGATGTGTGTGTTGTCGG + Intergenic
1053504371 9:38628857-38628879 GTGTGTGGTGTGTGTGTATGGGG - Intergenic
1053714496 9:40873584-40873606 CTTTGTGATGTGTGTGTAGATGG + Intergenic
1054963687 9:70997968-70997990 CTGTGTGGGCTGTGTGCTGTGGG - Intronic
1056222844 9:84467281-84467303 GTGTGTGGTGTGTGTGTGGGGGG + Intergenic
1056558982 9:87713407-87713429 GTGTGTGGTGTGTGTGTGGGGGG + Intergenic
1056577878 9:87869789-87869811 GTGTGTGGTGTGTGTGTGGTGGG - Intergenic
1056708848 9:88973664-88973686 TTGTGTAGTCTGTGTGTGGGGGG - Intergenic
1056708855 9:88973764-88973786 TTGTGTAGTCTGTGTGTGGGGGG - Intergenic
1056714681 9:89019364-89019386 CTGTGTGGCCTGTGGTCAGAAGG + Intronic
1056826857 9:89882131-89882153 ATGTGTGGTGTGTGTGTATGTGG - Intergenic
1056826886 9:89882416-89882438 GTGTGTGGTGTGTGTATATATGG - Intergenic
1056922990 9:90808589-90808611 CTGTGTGGTGTGTGGGTGGCAGG + Intronic
1057022563 9:91711261-91711283 GTGTGTGGTGTATGTGTGGATGG + Intronic
1057394601 9:94668688-94668710 TTGTGTGGTGTGTGTGTCTATGG + Intergenic
1057703546 9:97381438-97381460 TTGAGTGGTGTGTGAGTAGAGGG + Intergenic
1057703858 9:97384249-97384271 TTGAGTGGTGTGTGAGTAGAGGG + Intergenic
1057819313 9:98318930-98318952 GTGTGTGGTGTGTGTGTATTAGG + Intronic
1059275875 9:113096812-113096834 GAGTGTGTTCTGTGAGTAGAAGG - Intergenic
1059561503 9:115339091-115339113 CTGTGTCTTGTGTGTGCAGAGGG - Intronic
1060491138 9:124085199-124085221 CTGTGTGGTCTGTGTCGGGTGGG - Intergenic
1060754822 9:126205236-126205258 CTGTGTGTTGTGTGTGTTTATGG + Intergenic
1061541917 9:131282088-131282110 CTGTGGGGTGTGTGTGCAGTGGG + Intergenic
1061662966 9:132142583-132142605 GTGTGTGGTGTGTGTGTGGGGGG - Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062119480 9:134826603-134826625 GTGGATGGTGTGTGTGTAGATGG + Intronic
1187047282 X:15659754-15659776 CTCTTTGGCCTGTATGTAGATGG - Intronic
1187423110 X:19153710-19153732 GAGTGAGGTCTGTGTGGAGAAGG - Intergenic
1189846414 X:45142740-45142762 CACTGTGGTCTGTGTGTAGAAGG + Intergenic
1190190718 X:48274675-48274697 ATGTGTGGGCTGTGAGCAGATGG + Intronic
1190198099 X:48336819-48336841 ATGTGTGGGCTGTGAGCAGATGG + Intergenic
1194025488 X:88745996-88746018 CTGAGTGGTCTGTTTTGAGAGGG + Intergenic
1196335795 X:114532133-114532155 GTGTGTTGTCTGTGTGTGGGGGG + Intergenic
1198317823 X:135487196-135487218 GTGTGTGGTATGTGTGTACTGGG - Intergenic
1198577490 X:138026057-138026079 TTGTGTGGTATGTCTGTAGGTGG - Intergenic
1200044019 X:153390836-153390858 ATGTGTGGTGTGTGTGTGCATGG - Intergenic