ID: 1097227047

View in Genome Browser
Species Human (GRCh38)
Location 12:57483655-57483677
Sequence GTGGAGAAGGGACGTGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097227047 Original CRISPR GTGGAGAAGGGACGTGTTTC AGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900720337 1:4171951-4171973 GGGGCGAAGGGACTTGCTTCAGG + Intergenic
901977573 1:13007354-13007376 GGAGAGAAGGGAGGTGTTACAGG - Intronic
902004512 1:13221581-13221603 GGAGAGAAGGGAGGTGTTACAGG + Intergenic
902023729 1:13367313-13367335 GGAGAGAAGGGAGGTGTTACAGG + Intergenic
902206798 1:14874306-14874328 GTAGAGAAGTGACATGTGTCCGG + Intronic
903576294 1:24341644-24341666 GTGGAGAGGGGCTGTGTCTCTGG + Intronic
905369798 1:37476878-37476900 GTTGAGAAGGGATGATTTTCTGG + Intronic
907890120 1:58628992-58629014 GTGGAGAAGGAACTTATTTAGGG + Intergenic
910782223 1:90951618-90951640 GTGGAGAAGGTAAGGGTTTTGGG - Intronic
917076183 1:171207467-171207489 CTGGAAAAGGGAAGTGTGTCTGG - Intronic
921333738 1:214065684-214065706 GTGGAGAAGGGGGGTGTGTAGGG - Intergenic
924510728 1:244727395-244727417 GTGGCCAAGAGACATGTTTCTGG + Intergenic
1065563756 10:26988957-26988979 GTGGGGAAGGGGAGTGTTGCAGG + Intergenic
1069359559 10:67625991-67626013 GTAGAGAAGGGATCTGTTTCAGG - Intronic
1071494353 10:86157578-86157600 CTGGAGGAGAGACGTGTTTAGGG - Intronic
1071678619 10:87682046-87682068 TTGAAGAAGGGACATGATTCTGG + Intronic
1073473799 10:103739950-103739972 GTGGAGAAGGGACCTGTTTCAGG - Intronic
1073480673 10:103784357-103784379 GTGGAGAAGGGCTGGGGTTCAGG - Intronic
1075157534 10:119990281-119990303 GTGGGGGAGGGACGTGGATCAGG + Intergenic
1076995604 11:296173-296195 GTGGAGAGGGGCCGTGGGTCAGG + Intergenic
1078006848 11:7538571-7538593 GTGGAGCAGGGACATGTGACAGG + Intronic
1078777988 11:14411222-14411244 CTCCAGAAGGGATGTGTTTCCGG + Intergenic
1082757914 11:57096398-57096420 GTGGAGGAGAGATGGGTTTCTGG + Intergenic
1083202205 11:61127370-61127392 GTGGAGAAAGGACCTGTCTTAGG - Exonic
1083855251 11:65390040-65390062 GAGGAGAAGGGACATGGCTCAGG + Intronic
1084026116 11:66450860-66450882 GAAGACAAGGGACTTGTTTCGGG + Intronic
1089491113 11:118884933-118884955 CTGGAGAGAGGACTTGTTTCGGG + Intronic
1091058184 11:132438511-132438533 GTGGAGCAGGAACGTGTCTGTGG + Intronic
1091916225 12:4273153-4273175 GGGCAGAAGGGACGTTGTTCTGG + Intergenic
1091932930 12:4411554-4411576 GAGAAGAAGAGACTTGTTTCCGG + Intergenic
1093056217 12:14558397-14558419 GTGGAGAAGGGAAGTTTCTGTGG - Intronic
1094474078 12:30827904-30827926 GTGGAGAAAGGAGGTGTGCCTGG - Intergenic
1096813611 12:54187438-54187460 GTGGAGAACGCCAGTGTTTCAGG + Intronic
1097227047 12:57483655-57483677 GTGGAGAAGGGACGTGTTTCAGG - Intronic
1099574645 12:84363323-84363345 GTGAGCAAGGGACATGTTTCAGG - Intergenic
1100796260 12:98185044-98185066 GTGGAGAGGGGAGGTTATTCAGG - Intergenic
1101774266 12:107779395-107779417 TTGGAGAAGGTACGTGGTTAAGG + Intergenic
1103139831 12:118538863-118538885 GAGGTGAAGGCACTTGTTTCAGG - Intergenic
1103441603 12:120967007-120967029 GTGGAGATGGGACTTGTTCAAGG + Intergenic
1104377916 12:128281390-128281412 GTGGAGCAGGGATTTGATTCAGG - Intronic
1108535695 13:51374725-51374747 GTGGAGAAGGTACTTGCTTGAGG + Exonic
1110645423 13:77877741-77877763 CTGGACAAGGGACGTGGTTGGGG + Intergenic
1112482716 13:99791983-99792005 GTGGAAAAGTGGCGTTTTTCTGG - Intronic
1113780963 13:112977115-112977137 GTGGAGTAGGGAGTTGTTTAGGG - Intronic
1114551230 14:23533991-23534013 GTGGAGCAGGGACATGTGGCTGG + Exonic
1115087777 14:29538287-29538309 GTAGAGAGGAGAGGTGTTTCAGG - Intergenic
1115907648 14:38218443-38218465 GTGGAGAATTGAGGTGATTCAGG + Intergenic
1116298243 14:43140728-43140750 GTGGATAAGAGTCATGTTTCAGG + Intergenic
1118611295 14:67542308-67542330 GTGGGGAAGGACGGTGTTTCGGG + Intronic
1118981927 14:70724189-70724211 CTGGAGAAGGGAAGTGATTATGG - Intronic
1118991808 14:70803519-70803541 GTGGAGAACGGAGGCGTTACAGG - Intronic
1123582283 15:21726402-21726424 AAGGAGATGGGAGGTGTTTCTGG - Intergenic
1123618933 15:22168998-22169020 AAGGAGATGGGAGGTGTTTCTGG - Intergenic
1124368908 15:29092210-29092232 GGGGAGATGGTACGTGTTTTAGG - Intronic
1126609287 15:50512395-50512417 GGGGAGAAGGAACGGGTTACAGG + Exonic
1128988293 15:72237145-72237167 GTGGAGAGTGGAAGTGTGTCAGG - Intergenic
1129178298 15:73855694-73855716 ATGGGGAAGGGAAGTGTTTTGGG + Intergenic
1129754106 15:78085582-78085604 CTGGAGAAGGGACGAGATTTTGG - Intronic
1130937732 15:88484642-88484664 GTGGAGATGGGGAGTGTTACAGG - Intergenic
1132397363 15:101483739-101483761 GGGGAGAAGGGAAGGGTTCCTGG + Intronic
1138403558 16:56769169-56769191 GTGAAGGAGGGAAGTTTTTCAGG + Intronic
1138752360 16:59439188-59439210 GGGGTGGAGGGAAGTGTTTCAGG - Intergenic
1140406246 16:74713500-74713522 GGGGAGAAGGGCTGTGATTCTGG + Exonic
1140466849 16:75189645-75189667 GTGGACAAGGGACTTGTTGGAGG - Intergenic
1140950071 16:79808532-79808554 GTGGAGAGGGGACATGTTGGTGG - Intergenic
1141008561 16:80375952-80375974 GTGGGGAAGGGAATTGTCTCCGG - Intergenic
1141576926 16:84970050-84970072 GTGCAGAAGGGACATGTTGAGGG + Intergenic
1143770038 17:9162709-9162731 GTGGAGAAGGGAGGAGTTGAGGG + Intronic
1145019294 17:19417041-19417063 GGGGAGAAAGGATGTGTTTAAGG - Exonic
1146722381 17:35132452-35132474 GTGGAGAAGGGAAGGGTGTCAGG + Intronic
1147389200 17:40099123-40099145 GTGGAGCAGGGACGTGAGGCCGG - Intronic
1148865811 17:50628005-50628027 GGGGAGGGGGGAAGTGTTTCTGG + Intergenic
1150097378 17:62389275-62389297 GTGGAGAAGGCAGGTGGTTGAGG + Intronic
1151988539 17:77559214-77559236 GCGGAGAATGGGAGTGTTTCAGG + Intergenic
1157709857 18:49842846-49842868 GTGGAGAGGGCCCATGTTTCAGG + Intronic
1158422325 18:57306206-57306228 GTGAAGAAGGAGCCTGTTTCTGG + Intergenic
1162518585 19:11165538-11165560 GTGGGGAAGGGAGGGGTTTCTGG + Intronic
1162823695 19:13238083-13238105 GTGGAGACGGGAAGGGTTTGGGG + Intronic
1163149729 19:15403897-15403919 GTGGGGAGGGGGCATGTTTCTGG - Intronic
1165496068 19:36152427-36152449 GCGGAGAAGGGAGGTGACTCCGG - Exonic
1167391855 19:49200503-49200525 GTGGAGAAGGGGCGTGACTTTGG + Intronic
1167419674 19:49395523-49395545 CTGGAGAAGGGAGGAGTTTGGGG + Intronic
1168115421 19:54219550-54219572 GGGGAGCAGGGCCGTGGTTCAGG - Intronic
1168141511 19:54391069-54391091 GAGGAGAAAGGACGTGGTTCAGG + Intergenic
1168156922 19:54478957-54478979 GAGGAGAAAGGACGTGGTCCAGG - Intergenic
1168157244 19:54481582-54481604 GAGGAGAAAGGACGTGGTCCCGG - Intergenic
1168429876 19:56270089-56270111 GTGGAGCAGGGAAGTGGTGCTGG - Intronic
925056964 2:863699-863721 GTGGAGAAGAGAGGTGGATCAGG + Intergenic
925123680 2:1438587-1438609 GTGGAGGAGGGACGTGGGGCAGG - Intronic
925800180 2:7591429-7591451 GTGGAGAACTGAAGTGATTCAGG - Intergenic
926780922 2:16471143-16471165 TTGTAGAAGGGAGGTGTTTGGGG + Intergenic
927712847 2:25336393-25336415 GTGGAGAAGGGTCCCTTTTCTGG - Intronic
928125466 2:28612443-28612465 GTGAGGAAGGGACGGGTTCCAGG - Intronic
928324075 2:30306176-30306198 GAGGGGAAGGGACATGTCTCAGG - Intronic
928332674 2:30369720-30369742 TTGGAAAAGGGACGTGTTTAAGG - Intergenic
928888168 2:36173962-36173984 GAGGAGTATGGACGTGTTCCGGG - Intergenic
929478149 2:42274528-42274550 GTGGAGAAGGGAGATGGCTCTGG - Intronic
929664608 2:43823855-43823877 CTGGAGAAGGGAGGTATTTAGGG + Intronic
934561458 2:95315634-95315656 GTGGAGAAGGGACATCTTCCTGG - Intronic
935285805 2:101562746-101562768 GTGGAGAGGGTACGTTTTGCAGG - Intergenic
936224932 2:110640321-110640343 GTGGGGAGGGGTCTTGTTTCTGG - Intronic
937024058 2:118682794-118682816 GTGGAGAATGGACAGATTTCAGG - Intergenic
946310902 2:218882123-218882145 GTGGAGTGGGTACGTGTTTTGGG - Intronic
948705647 2:239790601-239790623 GGGGAGAAGGGCAGCGTTTCAGG + Intronic
1168980446 20:1999008-1999030 GTGCAGAAGAGACCTGTTTTAGG - Intergenic
1172281304 20:33710148-33710170 GTGGGGAAAGGGCGTGGTTCTGG - Intronic
1175625670 20:60486638-60486660 CTGGGGAAGGGAAGTGTTTAGGG + Intergenic
1175967251 20:62665825-62665847 GTGGAGAGGGGACAGGTTTGGGG - Intronic
1179524662 21:41967834-41967856 GTGGAGACGGGGTGTCTTTCTGG + Intergenic
1180260252 21:46663485-46663507 GTGGAGAAGGCACATGTCTGTGG + Exonic
1181527792 22:23500105-23500127 GTGGAGAAGTGAAGTGACTCGGG - Intergenic
1181569965 22:23763213-23763235 GTGGAGCAGAGACCTGCTTCAGG - Exonic
1183722760 22:39572019-39572041 CTGGAGAAGGGAGGAGTTGCAGG + Intronic
1185263304 22:49883394-49883416 GTGCAGCAGAGACGTGCTTCTGG - Exonic
950670128 3:14521006-14521028 GGGGAGAAGGCACGGGATTCAGG - Intronic
951363447 3:21751434-21751456 GTGCAGGAGGGACGTGGTTAAGG + Exonic
954382878 3:50228923-50228945 GGGGAGGAGGGACCTGTTGCGGG - Intronic
954662691 3:52234542-52234564 GGGGAGAAGGGATGAGTGTCTGG - Intronic
955084840 3:55692654-55692676 GGGGAGAAGGGACATATTTAGGG + Intronic
961141781 3:124562276-124562298 GTGGGGATGGGAGGTGTTGCAGG + Intronic
962424780 3:135260165-135260187 AAGGAGAAGGAAAGTGTTTCTGG + Exonic
962603779 3:137014866-137014888 GTGGAGGAGGTACATGTTCCTGG + Intergenic
963489189 3:145977786-145977808 GTGGAGATCAGACGTGTTTGGGG - Intergenic
965095302 3:164217747-164217769 GTGTAGCAGGTACGTGTTGCAGG + Intergenic
965747777 3:171943513-171943535 TTTGAGAAGGGAGGTGTTTTAGG + Intergenic
966266711 3:178054842-178054864 GGGGAGAAGGGAAGTGATTAGGG - Intergenic
969549137 4:7852732-7852754 GTGGAGACGGAACCTGTTACAGG + Intronic
970733310 4:19134936-19134958 TTGGGGAAGAGATGTGTTTCAGG + Intergenic
970981021 4:22097253-22097275 GTGGAGAAGTGACTTATTTAAGG + Intergenic
976944236 4:90744832-90744854 ATGGATAGGGGACTTGTTTCAGG - Intronic
978343607 4:107742492-107742514 GTGGAGCAGGAAAGTGTTACAGG + Intergenic
979708718 4:123751517-123751539 GAGGAGATGGGACCTGGTTCTGG + Intergenic
980453738 4:133011741-133011763 GTAAAGAAGGGACTTGTTTGTGG - Intergenic
980665956 4:135935899-135935921 GAGGAGAAGGGCGGGGTTTCTGG - Intergenic
982961953 4:161850545-161850567 GTGGAGAAGAATCATGTTTCTGG + Intronic
984438022 4:179728332-179728354 GAGGAGAGGGGACTCGTTTCTGG + Intergenic
986089383 5:4488958-4488980 GTGGAGCAGGGACCTGTTTTAGG - Intergenic
987080053 5:14418219-14418241 GAGGAGGAGGGAGGTGCTTCTGG + Intronic
993922896 5:93829210-93829232 GGGGAAAAGGGATGTGTTTGGGG - Intronic
998411718 5:141916238-141916260 GTGGTGAAGGGAGGTGTAGCAGG - Intergenic
998512210 5:142722977-142722999 GTGGATCTGGGAAGTGTTTCAGG + Intergenic
1001889104 5:175324334-175324356 GTGCAGAAGGGATATGTTTGGGG - Intergenic
1002951279 6:1814248-1814270 GTGGAGAAGGTGCCTGTCTCTGG - Intronic
1004203618 6:13572442-13572464 TGGGAGAAGGGACGAGTTCCAGG + Intergenic
1007737737 6:43992241-43992263 GTGGAGATGGGATGTGTGGCAGG + Intergenic
1008766543 6:54923929-54923951 GTGGAGAAGGGGAGAATTTCTGG - Intronic
1009348228 6:62644099-62644121 GTGGAGAAGGGACCTGGTAGAGG + Intergenic
1013378934 6:109546915-109546937 GTAGGGAAGGGAAATGTTTCTGG + Intronic
1015303960 6:131685174-131685196 GTGGAGAAGGGTCATGTTTGAGG - Intronic
1017661430 6:156677923-156677945 GTGGGGAAGGTACGTGTGTATGG + Intergenic
1017664792 6:156709198-156709220 GTGGAGATGGGAAGTGTATTAGG + Intergenic
1017991134 6:159490795-159490817 GTGGGGAAGGGACGTGGAACTGG + Intergenic
1019295557 7:272216-272238 GTGGACTTGGGAAGTGTTTCTGG - Intergenic
1021819503 7:24482120-24482142 GAAGAGAAGGGACTTTTTTCAGG - Intergenic
1022030856 7:26490889-26490911 GTGGAGAAGGGAGGAGCCTCAGG - Intergenic
1022623569 7:32010716-32010738 GTGAAGGAAGGACGTGTTCCAGG + Intronic
1023235762 7:38084573-38084595 GTGGAGAAAGAAATTGTTTCTGG - Intergenic
1031421807 7:121562048-121562070 GTGGAGAAGGGAAGTGGGACAGG - Intergenic
1033269211 7:139915599-139915621 GTGGAGAAGGGCCCTGATTTGGG + Intronic
1034244536 7:149634633-149634655 GTGGAGAAGGCACGTGTGGAAGG + Intergenic
1036239357 8:7069208-7069230 GTGGTGGAGAGACGTGTTTTTGG + Intergenic
1037501857 8:19494285-19494307 GTGGAGGAGGGGAGTGTTTTGGG - Intronic
1038866315 8:31442134-31442156 GTGTAGAAGGGTCCTGTTTATGG - Intergenic
1039399474 8:37257021-37257043 ATGGAGAAAGGAGGTGTGTCAGG + Intergenic
1039620760 8:38995605-38995627 TTGGAGAAGGGAGGTGTTTCTGG + Intronic
1040055082 8:43050784-43050806 GTTGAGAAGGGACATGTGTAAGG - Intronic
1040912843 8:52538766-52538788 GTGGAGAAAGCACGTGCTTTGGG - Intronic
1041345193 8:56889915-56889937 TTGGAGAAGAGACGTATTTCTGG + Intergenic
1044817619 8:96129398-96129420 GTGAAGAAGGGAGGTATTTGAGG - Intergenic
1046245684 8:111558530-111558552 GTGGAGAAGTGACATCTTTCAGG - Intergenic
1048095951 8:131294409-131294431 GTGGAGGAGGGAGGTGTTGGAGG - Intergenic
1048452811 8:134548957-134548979 GTGGAGTAGTGACGTGAGTCGGG - Intronic
1048982474 8:139710230-139710252 GTGGAGATGGGCAGTGGTTCAGG - Intergenic
1049055829 8:140236787-140236809 GGGGAGAAGTGACGTGTTTATGG - Intronic
1056505565 9:87255060-87255082 ATGGTGAAGGGAAGTGTCTCCGG - Intergenic
1057352894 9:94315506-94315528 GTGGTGAAGGGAGTGGTTTCTGG + Intergenic
1057654853 9:96942085-96942107 GTGGTGAAGGGAGTGGTTTCTGG - Intronic
1058167628 9:101637860-101637882 GTGAAGAAGGGACTTGCTCCAGG + Intronic
1059775001 9:117465548-117465570 GGGGAGAAGGGACAGGTTGCTGG + Intergenic
1060368368 9:123043614-123043636 GAGGGGAAGGGAAGTGTTTGGGG + Intronic
1060517290 9:124273920-124273942 GTGGGGAAGGAAAGTGTTGCTGG - Intronic
1060625148 9:125105494-125105516 GTGGAGAAGGGACATGAGACAGG - Intronic
1062128913 9:134882195-134882217 GGGGTTAAGGGACTTGTTTCAGG + Intronic
1185701465 X:2234008-2234030 GAGGAGAAGGGAGCTGTTGCAGG + Intronic
1187486349 X:19707799-19707821 GTGGAGAAAGAACGTGTATGGGG + Intronic
1189767445 X:44386128-44386150 GTGGAGCAGGGACTTGGGTCAGG - Intergenic
1189845585 X:45133459-45133481 GTGGAGAAGGGTAGTGGTTTGGG - Intergenic
1192249753 X:69402030-69402052 GTGGAATTGGGAGGTGTTTCTGG - Intergenic
1199965868 X:152820357-152820379 GTGAAGAAAGGATGTGTTCCAGG + Intergenic