ID: 1097227155

View in Genome Browser
Species Human (GRCh38)
Location 12:57484377-57484399
Sequence CTAGTTAGGGCCCCTCTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 23}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097227155_1097227162 -7 Left 1097227155 12:57484377-57484399 CCCATTAGAGGGGCCCTAACTAG 0: 1
1: 0
2: 1
3: 2
4: 23
Right 1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097227155 Original CRISPR CTAGTTAGGGCCCCTCTAAT GGG (reversed) Intronic
901748298 1:11389233-11389255 TTCCTTAGGGCCCCTCTGATGGG + Intergenic
1085636282 11:78161802-78161824 CTAGTGAGGGCCTCTCTCCTCGG + Intergenic
1091758380 12:3071247-3071269 CAAGGTAGGGCCCCTCTAATTGG + Intergenic
1093607236 12:21107421-21107443 CTTGCTAGGTCCCATCTAATAGG - Intronic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1099973419 12:89523909-89523931 CTGGTTAGGGCCCGTCTGATTGG - Exonic
1102287828 12:111673641-111673663 ATAGTTAGATCCCATCTAATGGG + Intronic
1107124215 13:36828287-36828309 GTAGTTGGGGCACCTATAATTGG + Exonic
1118529988 14:66693613-66693635 CTATTTCGGTCCCCTCTAATTGG + Intronic
928249375 2:29661314-29661336 CTAGTTAGGGGCTTTCTAACAGG + Intronic
933749725 2:85595588-85595610 CTAATTCGGCCCCCTCTCATTGG - Intergenic
942323995 2:174760078-174760100 TTAGTTATGGCCACTCTAGTGGG - Intronic
946305028 2:218851567-218851589 CCAGTAAGGGACACTCTAATGGG + Intergenic
1172509364 20:35489635-35489657 CTAGTTCAGGACCCTCTATTAGG - Intronic
1184965505 22:47969237-47969259 CTAGTTCTGGCACCTCTCATGGG + Intergenic
964502010 3:157358312-157358334 CTAGTAAGTGCCCTTCTAACAGG + Intronic
966398036 3:179521716-179521738 CTACTTAGGCACTCTCTAATTGG + Intergenic
1010194214 6:73223876-73223898 CTACTAAGGGCCCCAGTAATGGG - Intronic
1028692361 7:93667829-93667851 CTGGTGAGGGCCCCTCTCTTGGG + Intronic
1032258285 7:130314293-130314315 TTAGTTATGGGCCCTTTAATGGG + Intronic
1047742485 8:127818011-127818033 CTAGTTACTGCCCCTCTCCTGGG - Intergenic
1056321679 9:85441130-85441152 CTAGCTAGGGCTCCAATAATTGG - Intergenic
1059518331 9:114916343-114916365 CTAGTTAGAGCCCCTATGCTTGG + Intronic
1186154020 X:6707183-6707205 CTAGTGAAGGACCCTCTAGTAGG - Intergenic
1188585216 X:31766203-31766225 CTAGTTAGGGCTCCTTTATATGG - Intronic
1198493447 X:137166756-137166778 CCAGTTAGGCCCCCTCTCACTGG - Intergenic
1198966424 X:142232259-142232281 CTCCTTAGGGACTCTCTAATTGG + Intergenic