ID: 1097227156

View in Genome Browser
Species Human (GRCh38)
Location 12:57484378-57484400
Sequence CCTAGTTAGGGCCCCTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 41}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097227156_1097227162 -8 Left 1097227156 12:57484378-57484400 CCATTAGAGGGGCCCTAACTAGG 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097227156 Original CRISPR CCTAGTTAGGGCCCCTCTAA TGG (reversed) Intronic
900235976 1:1590884-1590906 CCTAATTAGGGCCCCCCACACGG - Intergenic
917223227 1:172754118-172754140 AGTAGTTGGGGCCCCTCTGATGG - Intergenic
919713168 1:200748459-200748481 TCTAGTTAGGATCCATCTAAAGG + Intronic
919838249 1:201591416-201591438 CCGAGTCAGGGCCCCTCCCAGGG + Intergenic
921079490 1:211727227-211727249 CCTTTTTGGGGCCCCTCTCAAGG + Intergenic
1072535872 10:96362314-96362336 CCCAGTGAGGGTCCCTCCAATGG + Intergenic
1074101119 10:110355620-110355642 CCAAGTTAGGTCCCCTCAGAGGG - Intergenic
1074181576 10:111069538-111069560 CCTATTTGGGGCCACTCTAGTGG + Intergenic
1080401911 11:31944017-31944039 CCAAGTTATGGCCCTTCTGAAGG + Intronic
1087964441 11:104395020-104395042 CCTAGTTGATGCCCCTTTAATGG - Intergenic
1096477835 12:51919228-51919250 CCTGGTTAGGGCACCTCTCTAGG + Intronic
1097227156 12:57484378-57484400 CCTAGTTAGGGCCCCTCTAATGG - Intronic
1101428874 12:104610208-104610230 CCTAGTTAGGTACTCTGTAATGG + Intronic
1105069763 12:133227398-133227420 CCTAGCAAGGGCCCCACTCAGGG - Intronic
1113231494 13:108217898-108217920 CCTCGTTAGGGCCCCTCTCAAGG - Intronic
1116332732 14:43615716-43615738 CCTAGTTGGGGGCACTTTAAAGG + Intergenic
1120595102 14:86423628-86423650 AGTAGTCATGGCCCCTCTAATGG - Intergenic
1153584678 18:6608924-6608946 AGTAGTTAGGGCCCCACTGAAGG - Intergenic
1165405097 19:35625366-35625388 CCTAGTTAAGTCCCCTGAAAAGG + Intergenic
937368568 2:121282712-121282734 CCTAGTCAGGGACCCACGAAGGG - Intronic
938884336 2:135628151-135628173 CATATGTAGGGCCCCTATAAAGG + Intronic
943098972 2:183464150-183464172 CCTTGTTAATGACCCTCTAATGG - Intergenic
946305026 2:218851566-218851588 CCCAGTAAGGGACACTCTAATGG + Intergenic
1182370054 22:29804456-29804478 CCCAGCTTGGGACCCTCTAAAGG + Intronic
1184176634 22:42792815-42792837 TCTAGGTCAGGCCCCTCTAAGGG + Intergenic
951114075 3:18839282-18839304 CCTAGTTAGGACCTTTATAATGG - Intergenic
952553354 3:34503930-34503952 CCTAGTGAGGGCACCATTAAAGG - Intergenic
961126156 3:124419953-124419975 CCTAGTTAAAGCCCATCAAATGG - Intronic
970644307 4:18102567-18102589 CCTTGCTAGGGCCCCTCTCAGGG + Intergenic
981856053 4:149294166-149294188 TCCAGTTAGGGCCAATCTAAAGG - Intergenic
988834164 5:35015155-35015177 CTTAGTTAGGCTCCCTCTCAAGG + Intronic
989678654 5:44004342-44004364 CCAACTGAGGGCTCCTCTAATGG - Intergenic
991277025 5:64861013-64861035 CTTAGTTGGGGCTCCTCAAATGG + Intronic
1010194215 6:73223877-73223899 CCTACTAAGGGCCCCAGTAATGG - Intronic
1015866678 6:137734079-137734101 CCAACCTAGGGCCCCTCAAATGG + Intergenic
1017284615 6:152659691-152659713 CTTAGTTAGGGCACCTATATTGG + Intergenic
1033768489 7:144522062-144522084 CCCAGTTTGGCACCCTCTAATGG - Intronic
1036732982 8:11282572-11282594 CCTAGTTAAGGGCACTTTAAAGG - Intergenic
1039107978 8:34009928-34009950 CATTGTTAGGCCCCCTCTCAGGG - Intergenic
1045729349 8:105217176-105217198 CCTCTTTAGGCCCCCTCCAAGGG + Intronic
1048066645 8:130976240-130976262 ACTTGCTAGGGCCCCTCTGAAGG + Intronic
1052488414 9:29131806-29131828 CCTAGTTAAGGGCACTTTAAAGG + Intergenic
1192503726 X:71668726-71668748 CCGGGGTAGGGGCCCTCTAACGG - Intergenic
1192522488 X:71814778-71814800 CCGGGGTAGGGGCCCTCTAATGG - Intergenic