ID: 1097227162

View in Genome Browser
Species Human (GRCh38)
Location 12:57484393-57484415
Sequence TAACTAGGAGGTACGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097227155_1097227162 -7 Left 1097227155 12:57484377-57484399 CCCATTAGAGGGGCCCTAACTAG 0: 1
1: 0
2: 1
3: 2
4: 23
Right 1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48
1097227156_1097227162 -8 Left 1097227156 12:57484378-57484400 CCATTAGAGGGGCCCTAACTAGG 0: 1
1: 0
2: 1
3: 1
4: 41
Right 1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097227162 Original CRISPR TAACTAGGAGGTACGATGGC AGG Intronic
907858625 1:58328247-58328269 AAAATAGGAGCTGCGATGGCAGG - Intronic
920522208 1:206635877-206635899 TCAGTAGGAGGGACGAGGGCAGG + Intronic
1064923950 10:20549823-20549845 TATCATGGAGGTACCATGGCAGG + Intergenic
1067271482 10:44795392-44795414 GAACTAGGAGGTCACATGGCAGG + Intergenic
1079525742 11:21385530-21385552 ATACTAGGAGGTAGGATGGAGGG - Intronic
1082263874 11:50098827-50098849 TAAGTAGGAGCTACCATGCCTGG - Intergenic
1082832618 11:57630245-57630267 TTACTAGGAGGTAGGATCACTGG - Intergenic
1083190990 11:61052438-61052460 TACTTAGCAGGTACGAGGGCAGG + Intergenic
1093687107 12:22069705-22069727 TAACTTGTAGGAACGACGGCTGG - Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1106870498 13:34013731-34013753 TATTTAGGAGGTACGATGCCAGG + Intergenic
1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG + Intergenic
1131025325 15:89136656-89136678 CAACTAGGAGCTGCGCTGGCTGG - Intronic
1151260618 17:72913141-72913163 TAGATAGGAGGTAAGAGGGCAGG + Intronic
1158258831 18:55586555-55586577 TAACTAGGAGGTAAGATGTAAGG + Intronic
1161325372 19:3661141-3661163 GCACTAGGAGGGACCATGGCGGG - Intronic
1162386301 19:10362251-10362273 CAACCAGGAGGTACGATGATAGG - Exonic
1164533232 19:29063664-29063686 TAAACATGAGGTACAATGGCTGG + Intergenic
1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG + Intergenic
1167607699 19:50490261-50490283 AAATTAGCAGGCACGATGGCGGG - Exonic
927627604 2:24738951-24738973 TCACTTGGAGGTACTATGTCTGG - Intronic
928846456 2:35679329-35679351 TAACTAGGAGATAGGATGTGAGG + Intergenic
937178105 2:119962735-119962757 TAACCAAGAGGTAAGAAGGCAGG + Exonic
937881919 2:126874629-126874651 TAAATAGGAGGTTCGAGAGCAGG + Intergenic
948668449 2:239551215-239551237 TAACTAGAAGGAATGGTGGCAGG - Intergenic
1172826391 20:37790735-37790757 TAGCTATGAGGTCTGATGGCAGG - Intronic
1177820619 21:26027394-26027416 AAACTGGAAGGTACAATGGCTGG + Intronic
1179187838 21:39098240-39098262 TAATTAGGAGGAAAGATTGCTGG - Intergenic
958680528 3:97325029-97325051 TACTTTGGAGGTACGCTGGCTGG + Intronic
965287791 3:166840583-166840605 GAACAAGGAGATACGATTGCTGG - Intergenic
968747654 4:2369160-2369182 TCACCAGGAGGAAGGATGGCAGG - Intronic
985530028 5:428751-428773 TAACTAGGCGGCCCCATGGCGGG + Intronic
1002424940 5:179169444-179169466 GAACTAGGAGGCACTAAGGCTGG - Intronic
1004432987 6:15563141-15563163 TGAGTAGGAGGTAAGATGGGAGG - Intronic
1006033532 6:31195016-31195038 TCACTAGGAGTGACAATGGCTGG + Intergenic
1014190601 6:118491996-118492018 TAACTAGGAAGCAAGATAGCTGG - Intronic
1020664858 7:11027312-11027334 TAACTAGGCAGTAGGATGTCAGG + Intronic
1022741407 7:33125145-33125167 TAAATAGTAGATACGATGTCTGG + Intergenic
1032141416 7:129334414-129334436 TAACTAGGAGTTAGGAAGGCTGG - Intronic
1037432397 8:18827516-18827538 TAACTAGGTGGTATTATGGAAGG + Intronic
1041582233 8:59474350-59474372 TAATTAGGAAATACAATGGCCGG - Intergenic
1047925992 8:129683125-129683147 TAATTAGTAGGTAAAATGGCAGG + Intergenic
1048593839 8:135845893-135845915 TAATTAAGTGGTAGGATGGCTGG + Intergenic
1049998036 9:1049830-1049852 TAACTAGGAGTTTCGGTGCCAGG + Intergenic
1053371776 9:37567670-37567692 GAACTAGGAGGCACCATGCCTGG + Intronic
1056307429 9:85303756-85303778 TCACTAGGAGTTAGGAGGGCCGG + Intergenic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1187461990 X:19495443-19495465 TAACTAGGAGGAAGGAGGGGAGG + Intronic
1193408236 X:81130661-81130683 TCAGTTGGAGGCACGATGGCAGG - Intronic
1194270701 X:91811084-91811106 TAGATAGGAGGTTCCATGGCAGG - Intronic
1195483854 X:105379816-105379838 TAGCTAGGAGGTAGTATGTCAGG + Intronic
1200587933 Y:5032517-5032539 TAGATAGGAGGTTCCATGGCAGG - Intronic