ID: 1097232825

View in Genome Browser
Species Human (GRCh38)
Location 12:57522735-57522757
Sequence GCTGCCGCAGCCGCCGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1282
Summary {0: 1, 1: 5, 2: 118, 3: 302, 4: 856}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097232825_1097232830 -3 Left 1097232825 12:57522735-57522757 CCTGCGGCGGCGGCTGCGGCAGC 0: 1
1: 5
2: 118
3: 302
4: 856
Right 1097232830 12:57522755-57522777 AGCGACGGCGGCGGCGGCAGCGG 0: 3
1: 13
2: 287
3: 1763
4: 2767
1097232825_1097232834 28 Left 1097232825 12:57522735-57522757 CCTGCGGCGGCGGCTGCGGCAGC 0: 1
1: 5
2: 118
3: 302
4: 856
Right 1097232834 12:57522786-57522808 TGCGCAGTGCCTTCTGGGAACGG 0: 1
1: 0
2: 1
3: 21
4: 193
1097232825_1097232832 23 Left 1097232825 12:57522735-57522757 CCTGCGGCGGCGGCTGCGGCAGC 0: 1
1: 5
2: 118
3: 302
4: 856
Right 1097232832 12:57522781-57522803 CAGCCTGCGCAGTGCCTTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 235
1097232825_1097232829 -9 Left 1097232825 12:57522735-57522757 CCTGCGGCGGCGGCTGCGGCAGC 0: 1
1: 5
2: 118
3: 302
4: 856
Right 1097232829 12:57522749-57522771 TGCGGCAGCGACGGCGGCGGCGG 0: 1
1: 6
2: 112
3: 1601
4: 2533
1097232825_1097232831 22 Left 1097232825 12:57522735-57522757 CCTGCGGCGGCGGCTGCGGCAGC 0: 1
1: 5
2: 118
3: 302
4: 856
Right 1097232831 12:57522780-57522802 GCAGCCTGCGCAGTGCCTTCTGG 0: 1
1: 0
2: 0
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097232825 Original CRISPR GCTGCCGCAGCCGCCGCCGC AGG (reversed) Exonic
900087325 1:904738-904760 GCTTCCGCAGCGCCCGGCGCAGG + Intergenic
900113779 1:1020196-1020218 GCGGCAGCAGCGGCCGCAGCGGG - Exonic
900154191 1:1197558-1197580 GCTCGTGCAGCCTCCGCCGCTGG + Exonic
900214062 1:1471853-1471875 GCCGCCGCCGCTACCGCCGCCGG - Exonic
900221611 1:1512237-1512259 GCCGCCGCCGCTACCGCCGCCGG - Exonic
900249299 1:1658929-1658951 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
900578036 1:3393998-3394020 CCTGGAGCCGCCGCCGCCGCGGG - Intronic
900637348 1:3672460-3672482 GGGGCCGCAGCCGCCTTCGCTGG - Intronic
900779957 1:4611658-4611680 GCTGCCTCAGCCCCGGCAGCTGG - Intergenic
901628975 1:10639030-10639052 GCCGCCTCCGCCGCCGCCTCGGG + Exonic
901629012 1:10639210-10639232 GCCGCCGCCGCCGCCGCAGCTGG - Exonic
901811307 1:11768138-11768160 AGTGCCACTGCCGCCGCCGCTGG - Exonic
901813053 1:11778675-11778697 GCTGCAGCATCCGCTGCTGCAGG - Exonic
902923133 1:19679152-19679174 GCTGCCGCTGCCCCTGCCGCCGG + Exonic
903055492 1:20633498-20633520 GCCGCCGCTGCCGCCACCACCGG - Exonic
903115521 1:21176259-21176281 GCCGCCGCTGCTGCCGCCGCCGG + Exonic
903115634 1:21176590-21176612 GCCTCCGCCGCCGCCGCCGCCGG + Intronic
903263363 1:22142944-22142966 GCGGCCGCAGCCGCTGCCCCGGG - Exonic
903324741 1:22563450-22563472 GCCGCCGCCGCCGCCGCCCCGGG - Intergenic
903652324 1:24929785-24929807 CTTGCCGCCGCCGCCGCCGCAGG + Exonic
903907486 1:26696765-26696787 GCTGCCGCCACCGCCGCCGCCGG - Exonic
903907688 1:26697433-26697455 GCTGCGGCGGCGGCCGCCTCGGG + Exonic
904039292 1:27575173-27575195 CCCGCCGCCGCCGCCGCCTCTGG + Intronic
904500199 1:30908782-30908804 TGCGCCGCCGCCGCCGCCGCCGG + Intergenic
904642016 1:31938144-31938166 CGCGCCGCCGCCGCCGCCGCCGG - Exonic
904701724 1:32361994-32362016 GCTGCCGGAGCCCTGGCCGCGGG + Exonic
904837745 1:33349915-33349937 GCTCCCGCGGCCGCCTCCGCCGG + Intronic
905067066 1:35192737-35192759 GCAGCCGCCGCCACCGCCGCAGG - Exonic
905137071 1:35808166-35808188 GCCGCCGCCGCCGCCGCCAACGG - Exonic
905422732 1:37859542-37859564 GCTGCTGCTGCCGCCGTTGCCGG - Exonic
906027003 1:42682520-42682542 GGAGCCGCAGCTGCCGCAGCCGG + Exonic
906069684 1:43007705-43007727 GCTGCCGCAGCCCCAGGCCCGGG - Intergenic
906204394 1:43979334-43979356 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
906262530 1:44405410-44405432 GCCGCCGCCGCTGCCTCCGCCGG + Exonic
906376950 1:45303771-45303793 GCTTCCGGGGCCGCCGCCTCTGG + Intronic
906480950 1:46198470-46198492 GCCGCCGCCGCCGCTGCCGCGGG + Intronic
906637014 1:47416489-47416511 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
906960919 1:50419098-50419120 GCCGCCGCCGCCGCCGCCGGGGG - Exonic
906960923 1:50419101-50419123 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
907010628 1:50959889-50959911 GCCACCGCCGCCGCCGCCGCCGG + Exonic
907038334 1:51236348-51236370 GCTGCTGCCCCCGCCGACGCCGG - Exonic
907136228 1:52142062-52142084 GCTCCTGCCGCCGGCGCCGCTGG - Intergenic
907178887 1:52553014-52553036 GCCGTCGCCGCTGCCGCCGCTGG + Intronic
907430053 1:54406369-54406391 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
908355782 1:63323842-63323864 GCGGCGGCGGCCGGCGCCGCGGG + Exonic
908355808 1:63323923-63323945 GCCGCGGCCGCCGCCGCTGCCGG - Exonic
908401131 1:63774054-63774076 GCCGCCACCGCCGCCGCCGAGGG + Exonic
908527586 1:65002690-65002712 GCCCCCGCCTCCGCCGCCGCCGG - Intergenic
910549738 1:88462724-88462746 GCTGCCGCTGGGGCTGCCGCGGG + Intergenic
910676414 1:89821084-89821106 GCTGCCGCTGCCGCCGCCCGTGG + Exonic
910759000 1:90717596-90717618 GCCGCCGCCGCCGCCGCTGCCGG + Intergenic
911114988 1:94237549-94237571 GCAGCCGCAGCCACAGCCACAGG + Exonic
912174723 1:107141355-107141377 GCTGCTGCGGCCGCCGCCCGAGG + Intronic
912363478 1:109113884-109113906 GCCATGGCAGCCGCCGCCGCTGG - Intronic
912777490 1:112514931-112514953 GCTGGCACAGCTGCCGCTGCCGG - Exonic
913615719 1:120558170-120558192 GCCGCCGCCGCCGCCGCCTCGGG - Intergenic
913632521 1:120723955-120723977 GCCGCCGCCTCAGCCGCCGCCGG - Intergenic
913658391 1:120983392-120983414 GCGGTCGCGGCCCCCGCCGCAGG + Intergenic
914009759 1:143766501-143766523 GCGGTCGCGGCCCCCGCCGCAGG + Intergenic
914293634 1:146298121-146298143 GCTGCTCCGGCCGCCGCCGTGGG - Intergenic
914428599 1:147600194-147600216 GCCGCCGCCGCTGCCGCCGCCGG + Intronic
914428603 1:147600197-147600219 GCCGCCGCTGCCGCCGCCGGGGG + Intronic
914554678 1:148748904-148748926 GCTGCTCCGGCCGCCGCCGTGGG - Intergenic
914574557 1:148952732-148952754 GCCGCCGCCGCCGCCGCCTCGGG + Intronic
914648377 1:149675162-149675184 GCGGTCGCGGCCCCCGCCGCAGG + Intergenic
914730392 1:150364664-150364686 GCCGCCGCCGCCGCCGCCAGAGG + Intronic
914730409 1:150364722-150364744 ACTGCTGCCTCCGCCGCCGCCGG - Exonic
914919538 1:151838216-151838238 GCAGCCGCCGCCGCCGCTCCCGG + Exonic
915070348 1:153261155-153261177 GCCGCCCCCGCCCCCGCCGCCGG - Exonic
915070394 1:153261311-153261333 GCAGCCGGAGCCGCCCCCGGAGG - Exonic
915070410 1:153261356-153261378 GCAGCCGGAGCCGCCCCCGGAGG - Exonic
915070436 1:153261455-153261477 GCAGCCGGAGCCGCCCCCGGAGG - Exonic
915070480 1:153261638-153261660 TCCGCCGCTGCCGCCGCCGCCGG - Exonic
915070490 1:153261674-153261696 GCTCCCGCCGCCCCCGCCGCTGG - Exonic
915083167 1:153365933-153365955 GCTGCCCCTGCCGCCCCTGCTGG - Intergenic
915246320 1:154558532-154558554 GATGCAGCAGCCGCAGCCGCAGG - Exonic
915326077 1:155081934-155081956 GCCGCCGCCGCCGCTGTCGCAGG + Intronic
915440454 1:155942399-155942421 GCCGCCGTTGCCGCCGCTGCAGG - Exonic
915495964 1:156282762-156282784 GCCGCAGCCGCCGCCGCCACCGG + Exonic
916065509 1:161132648-161132670 GCCGCCGCCGCCGCGGCCGTGGG + Exonic
916890217 1:169106453-169106475 GCTGCCGCTCCCGCTGCCACTGG - Exonic
917944434 1:179954767-179954789 GCCGCCACAGCCGCTGCCGCTGG + Exonic
918066486 1:181105276-181105298 GCAGCCGCGGGCGCCGGCGCAGG - Intergenic
918497594 1:185157288-185157310 GTTGCCACTGCCGCCGGCGCTGG + Exonic
919101786 1:193105264-193105286 GCTGCGGCAGCTGCGGCCTCTGG - Intronic
919101979 1:193106515-193106537 GCTGCGGCAGCTGCGGCCTCTGG - Intergenic
919712284 1:200739615-200739637 GCCGCCGCCGCCGCCGCTCCCGG - Exonic
919748612 1:201023441-201023463 GCAGCCGCAGCCGCTGCCTCGGG - Exonic
920003341 1:202814189-202814211 CCTGCCTCAGCCTCCGCAGCAGG - Intergenic
920260521 1:204685198-204685220 GCGGCCGGAGCAGCCGCCTCAGG - Intronic
920367478 1:205455705-205455727 GCTGCGTCAGCCGCCGCCCTAGG - Intronic
920705008 1:208244297-208244319 GCCGCCGCCGCCGCCACCGCGGG - Exonic
921189848 1:212699672-212699694 GCAGCCGCAGCCGCAGCAGCAGG - Exonic
922200239 1:223394597-223394619 GCTCCCGCAGGCGCCGCACCTGG - Exonic
922586312 1:226737216-226737238 GCTGGCGGAGCGGCCGGCGCAGG - Exonic
922661224 1:227432058-227432080 GCTGCCACGGCCACCGCTGCAGG - Intergenic
922696813 1:227735061-227735083 GCTGGGGCAGCCGGCGGCGCTGG - Exonic
922753738 1:228082873-228082895 CCTGTCGCCGCCGCCGCCGCGGG - Intronic
923056193 1:230426793-230426815 TCGGCAGCAGCCGCCGCCGCGGG - Intergenic
923191770 1:231626889-231626911 GGCGCCCCAGCCGCCGCCGGCGG + Exonic
923191777 1:231626902-231626924 GCTCACGCCGCCGCCGCCGGCGG - Exonic
923506403 1:234609608-234609630 GCGGCCGCCGCCGCCGCTGGTGG - Intergenic
923506404 1:234609611-234609633 TTTGCGGCCGCCGCCGCCGCTGG - Intergenic
923674042 1:236065013-236065035 GCTGCTGCTGCCGCTGCTGCTGG - Exonic
923684194 1:236142592-236142614 ACGGCCGCCGCCGCCCCCGCGGG - Exonic
924289722 1:242524714-242524736 CCCGCCGCCGCCGCCGCCCCGGG - Intergenic
924436681 1:244048904-244048926 CCGGCCGCCGCCGCCGCCGCCGG - Intergenic
924624500 1:245687836-245687858 GCTGCTGGTGCCGCTGCCGCTGG - Exonic
924754787 1:246931493-246931515 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
924853998 1:247857676-247857698 GCGCCCGCAGCCCCCGCCGGGGG - Intronic
1063367295 10:5499090-5499112 GCTGGGGCAGCCGCTGCCGCAGG - Exonic
1063418241 10:5890306-5890328 GACCCCGCTGCCGCCGCCGCCGG - Intronic
1063664100 10:8051507-8051529 GATGCCGCCGCCGCCGCCGCAGG - Intergenic
1064209078 10:13348112-13348134 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1064230945 10:13528946-13528968 GCCGCCGCCGCCGCGACCGCAGG - Intronic
1064244344 10:13657227-13657249 GCTGCCGCTGCCTCTGCCTCTGG + Exonic
1064274199 10:13891772-13891794 CCCGCCGCCGCCCCCGCCGCGGG + Intronic
1064553116 10:16521722-16521744 GTGCCCGCCGCCGCCGCCGCTGG - Exonic
1064645442 10:17454593-17454615 GCTGCCGCCGCCGCCGCGCGGGG + Intergenic
1064662062 10:17616933-17616955 GCTGTCGCCGCGGCCACCGCCGG - Intronic
1064981872 10:21173845-21173867 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1065023084 10:21516867-21516889 GCGGCGGCGGCGGCCGCCGCGGG - Exonic
1065117779 10:22498924-22498946 GCTGCCCCAGCCACAGCTGCAGG - Intergenic
1065188799 10:23192734-23192756 GCTGCTGCAGCCCGCGCCCCCGG + Exonic
1065214940 10:23439716-23439738 GCGCCCGCCTCCGCCGCCGCCGG + Exonic
1065712734 10:28533158-28533180 CCCGCCGCCGCCGCCGCCGCTGG - Intronic
1065925999 10:30434243-30434265 GCTTCTGCCGCTGCCGCCGCCGG + Exonic
1066429268 10:35336652-35336674 GCCGCCGTCGCCGCAGCCGCCGG + Intronic
1066429329 10:35336849-35336871 GCCGCCGCCGCCGCCGCCCATGG + Intronic
1066464802 10:35641985-35642007 CAAGCCGCCGCCGCCGCCGCCGG + Exonic
1067226902 10:44382538-44382560 AGTGCTGCAGCCGCCCCCGCTGG + Intronic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1068538612 10:58267839-58267861 GCCGCCGCAGCCGCCGGCCCCGG + Exonic
1068910524 10:62374420-62374442 GCTGCTGCAGCCGCCGCCTCCGG - Exonic
1069019174 10:63466097-63466119 GTGGCCGCTGCCGCCTCCGCAGG - Intergenic
1069019186 10:63466135-63466157 GCCGCCGCCGCCGCCGCCTCTGG - Intergenic
1069386076 10:67884630-67884652 TCTCCCGCAGCCGGAGCCGCGGG + Intergenic
1070809857 10:79292234-79292256 GCTGCTGCAGCGGCTGCCGCGGG - Exonic
1071086644 10:81874603-81874625 CGCGCCGCTGCCGCCGCCGCCGG - Intergenic
1071563474 10:86659937-86659959 GCAGCCGCTGCCGCTGCCACAGG - Exonic
1071611721 10:87038198-87038220 GCTGCTGCTGCCACTGCCGCTGG - Intergenic
1071695356 10:87863795-87863817 GCCGCCGCTGCCGCCGCCGCAGG - Exonic
1071997520 10:91162878-91162900 AGCGCCGCCGCCGCCGCCGCGGG + Intergenic
1072409071 10:95183876-95183898 CCTGCCGCCGCCGCCGCCCCGGG + Intergenic
1072555983 10:96513895-96513917 GCCGCCGCAGCCTCGGCCGCCGG - Exonic
1073059355 10:100724280-100724302 GATGCCGCGGCCGCCGCGCCCGG + Intergenic
1073101828 10:101010531-101010553 GCAGCCGCAGCCGCAGCAGCCGG - Intronic
1073137375 10:101227438-101227460 GCCGCAGCCGCCGCCACCGCCGG + Exonic
1073196437 10:101695146-101695168 GCCGCCACCGCCGCCGCCCCGGG + Exonic
1073268276 10:102241358-102241380 GCCGCCGCAGCCGCCGCTACTGG - Exonic
1073325978 10:102644170-102644192 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1073432171 10:103493928-103493950 GCCGCCGCGGCCGTCTCCGCGGG + Intergenic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1074503105 10:114043913-114043935 GCCGCCGCCGCCGCTGCTGCTGG - Intergenic
1074722120 10:116272606-116272628 GCTGCCGCCGCCGCCACCGAGGG - Intronic
1074814503 10:117134309-117134331 GCAGCCGCCGCCGCCGCCCCGGG - Exonic
1074865510 10:117542435-117542457 GAAGCCGCAGCGGGCGCCGCAGG + Exonic
1074865721 10:117543424-117543446 TCGGCCGCCGCCGCCGCCGCCGG + Exonic
1074995503 10:118754513-118754535 GGGGCCGCAGCCACCGCCGGAGG - Exonic
1075129492 10:119726067-119726089 GCCGCTGCCGCCGCCGCTGCCGG + Intergenic
1075802168 10:125160404-125160426 GCCGCCACCGCCACCGCCGCCGG - Intronic
1076116944 10:127907387-127907409 GCTGCCTCGGCCGCTGCCGCGGG + Intronic
1076363688 10:129908610-129908632 GTCGGCGCAGCCACCGCCGCTGG + Intronic
1076554208 10:131311518-131311540 GCCGCCGCCGCCGCCGCCCTGGG - Exonic
1076554221 10:131311593-131311615 GCAGCTGCCGCCGCCGCCGCTGG + Exonic
1076638915 10:131901020-131901042 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076722087 10:132397163-132397185 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1076822680 10:132947343-132947365 GCTGCAGCAGCCTCTGCAGCAGG - Intergenic
1077013770 11:391175-391197 GCTGCCCCAGCCACAGGCGCGGG + Intergenic
1077298101 11:1835371-1835393 GCTGCTGCTGCCGCCGCCACAGG + Exonic
1077423762 11:2464975-2464997 GCTGCCCCGGCCGCCCCCGTGGG + Intronic
1077637747 11:3855324-3855346 GCTGCTGTCGCCGCCGCCGCAGG + Intronic
1078316073 11:10294157-10294179 GCTGCCGCTACTGCCGCTGCAGG - Exonic
1078527230 11:12110462-12110484 GCTGTCACCGCCGCTGCCGCCGG - Intronic
1079180426 11:18188956-18188978 GATGCCCCAGCCGGCACCGCGGG - Exonic
1079450781 11:20598298-20598320 GCCGCGGCGGCCGCGGCCGCAGG - Intergenic
1079689406 11:23403535-23403557 CGCGCCGCCGCCGCCGCCGCGGG + Intergenic
1081528564 11:43943033-43943055 ACTGGCGCGGCCGCCGCAGCCGG - Exonic
1081700078 11:45147105-45147127 GCTGCCGCCGCCGCGGGAGCCGG + Intronic
1081773923 11:45665259-45665281 GCTGCCGCCGCCGCCACCCGCGG - Exonic
1082787517 11:57324917-57324939 GCCGCCGCCGCCGTCACCGCGGG + Intronic
1083039127 11:59669081-59669103 CCCTGCGCAGCCGCCGCCGCCGG - Intergenic
1083207495 11:61161402-61161424 GCCGTCGCCGCCGCCACCGCGGG + Exonic
1083571467 11:63764085-63764107 ACTGCCGCAGCCTCCGACGAGGG - Exonic
1083595549 11:63916967-63916989 GTCGCCGCCGCCGCCGCCGCCGG - Intergenic
1083618446 11:64037326-64037348 GCTGCCTCCCCCGCGGCCGCCGG - Intronic
1083710165 11:64543020-64543042 GCGGCCGCTGCCGCCTCCCCGGG - Intergenic
1083807497 11:65083836-65083858 CCTCCCGCTGCCGCCGCCGGAGG - Intronic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1083970350 11:66070518-66070540 GCTGCCGCCCCCGGCGCCTCCGG - Exonic
1084021325 11:66420007-66420029 GCAGCCGCGGCAGCCGCCGGAGG + Intergenic
1084085207 11:66851884-66851906 GCTCCTGCAGCCGCCGCCAGGGG + Exonic
1084129037 11:67119341-67119363 GCCGCCGCCGCCGCCGCTGCCGG - Intronic
1084172411 11:67406862-67406884 GCGGAAGCAGCCGCCGCAGCAGG - Exonic
1084193280 11:67508597-67508619 GCTGCCGTCGCCGCTGCCACCGG + Exonic
1084328185 11:68413947-68413969 GCAGCCGCAGCGGTGGCCGCCGG - Exonic
1084546849 11:69818951-69818973 CCTGCAGCCGCCGCCGCCGCGGG - Exonic
1085043981 11:73343010-73343032 ACTGCGGCTGCCGCCGCGGCCGG + Intronic
1085208066 11:74749048-74749070 GCCGCCGCTGCCGCCGCGGCCGG + Exonic
1085284629 11:75351733-75351755 GCCGCCGCCGCCCCCGCCCCCGG + Intergenic
1085353391 11:75815231-75815253 GCTGCCGCCGTTGCCGCCGCTGG - Exonic
1085423206 11:76381063-76381085 TTTACCGCCGCCGCCGCCGCTGG + Intergenic
1085530365 11:77189038-77189060 GCAGCCGCAGCCACAGCCACAGG - Intronic
1085561271 11:77474210-77474232 GCAGCCGCCGCCGCCGCGCCGGG - Intronic
1085597140 11:77820546-77820568 GGTGCTGCAGGCGCCGCCGCCGG - Exonic
1086887837 11:92224977-92224999 GCCGCCGCCGCCGCCGCCGGGGG - Intergenic
1086887840 11:92224980-92225002 GACGCCGCCGCCGCCGCCGCCGG - Intergenic
1087672757 11:101127554-101127576 TCCGCCTCTGCCGCCGCCGCCGG - Exonic
1088522173 11:110712072-110712094 GCCGCCGCAGCCCCCACTGCCGG - Intronic
1088677252 11:112206301-112206323 GCTGCCGCCCCTGCCGCCCCAGG - Intronic
1088868982 11:113875531-113875553 TCTCCCGCCGCAGCCGCCGCCGG + Exonic
1088893162 11:114060034-114060056 GCTGCAGCCGTCGCCGCCACCGG + Intronic
1089432710 11:118436684-118436706 GCCGCCGCGGCCGCCACAGCCGG - Exonic
1089494867 11:118902806-118902828 ACTGCCGCCGCCGCCACCCCCGG - Exonic
1089543668 11:119206289-119206311 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090780385 11:130002208-130002230 GCCCGCGCAACCGCCGCCGCCGG + Intronic
1090832337 11:130428217-130428239 GCTGCTGCTGCTGCTGCCGCTGG - Exonic
1091558583 12:1594166-1594188 GCCGCCGCCGCCGCCGCCTCGGG + Intronic
1091759458 12:3077383-3077405 GCCGCCGCCGCCGCCGCCAGCGG - Exonic
1093435340 12:19129743-19129765 GCTGCCGCCGCGGCTGCCGAGGG - Intronic
1094041122 12:26122642-26122664 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
1094653433 12:32399394-32399416 GCCGCCGCCGCCGCCTCCTCCGG - Intergenic
1095752803 12:45729688-45729710 GCCGCCGCCGCCGCCACCGCCGG + Exonic
1095953925 12:47795983-47796005 TCTCCTGCAGCCGCAGCCGCTGG + Exonic
1096077639 12:48815138-48815160 GGGGTCGCAGCCGCCGCCGGAGG + Intronic
1096466186 12:51848683-51848705 GCGGCTGCTGCGGCCGCCGCGGG + Intergenic
1096466187 12:51848686-51848708 GCTGCTGCGGCCGCCGCGGGCGG + Intergenic
1096489774 12:52007143-52007165 CCTGCCGCAGCCGCCACCCCTGG + Exonic
1096491363 12:52014902-52014924 GCTGCCGCCCCCGCCGCCCCCGG + Exonic
1096495421 12:52037063-52037085 GCTGCGTCGGCCGCCGCCGCCGG + Intronic
1096983739 12:55743398-55743420 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1097057428 12:56258302-56258324 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1097107674 12:56634961-56634983 GCCGCCGCCGCCGCCGCCTGCGG - Intronic
1097232825 12:57522735-57522757 GCTGCCGCAGCCGCCGCCGCAGG - Exonic
1097264419 12:57737513-57737535 GCCACCGCCGCCGCCGCCGGGGG - Exonic
1097264423 12:57737516-57737538 GCCGCCACCGCCGCCGCCGCCGG - Exonic
1097264608 12:57738119-57738141 GCGGCCGCGGCCGGCGCCGCCGG - Exonic
1097267153 12:57752584-57752606 GCTGCCACAACCCCCGCTGCAGG + Intronic
1097267565 12:57755076-57755098 GTCTCCGCCGCCGCCGCCGCCGG + Exonic
1097648138 12:62260606-62260628 GCTGCCCCGGCGGCCGCCGCCGG - Intronic
1097929629 12:65169837-65169859 CCCGCGGCCGCCGCCGCCGCTGG - Exonic
1098123824 12:67269639-67269661 GCCGCCGCCGCCGCCGCCACTGG - Exonic
1098161040 12:67648649-67648671 GCCGCCGCAGGCCCCGCCCCCGG - Intronic
1098255489 12:68611257-68611279 GGAGCAGCCGCCGCCGCCGCGGG + Intronic
1098426059 12:70366535-70366557 GGCGCTGCCGCCGCCGCCGCCGG + Exonic
1098426062 12:70366538-70366560 GCTGCCGCCGCCGCCGCCGGGGG + Exonic
1099133521 12:78864792-78864814 GCTGCCGCTGCCGCTGCTGCAGG - Exonic
1099202160 12:79690200-79690222 GCTGCCGCCGAGGCCGCTGCTGG + Exonic
1100309183 12:93378274-93378296 GCTGCTCCGGCCGCCGCCGTGGG - Exonic
1100391309 12:94148357-94148379 GCGGCCGCGGCGGCCGCGGCGGG + Intergenic
1100540035 12:95548842-95548864 GCTGTCGTAGCCGCCGCACCGGG - Intronic
1100632292 12:96400594-96400616 GCCCCCGCCTCCGCCGCCGCCGG - Intergenic
1100823891 12:98457028-98457050 GCTGCTGCTGCCGCTGCTGCTGG - Intergenic
1101935359 12:109052621-109052643 GCTACCGCCGCCGCCGCCGCCGG - Exonic
1102053612 12:109880396-109880418 GATGCCCCAGCCGGCGCCGCGGG + Exonic
1102136861 12:110582933-110582955 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1102136863 12:110582939-110582961 GCCGCCGCCGCCGCCGGCCCTGG + Exonic
1102197154 12:111033966-111033988 GCCGCCGCCGCCGCCGCCAACGG - Intergenic
1102197415 12:111034873-111034895 GCCGCCAGAGCCGCCGCCGCCGG + Intronic
1102248343 12:111368991-111369013 GCCGCCGCCGTCGCCGCCACCGG - Exonic
1102254047 12:111405993-111406015 GCGGCCGCCGTCGCCACCGCGGG - Exonic
1102278228 12:111598938-111598960 GCAGCAGCAGCCGCCGCCCGCGG - Exonic
1102346375 12:112163682-112163704 GCTCCCGCAGCCGCAGGCTCCGG + Exonic
1103074155 12:117968901-117968923 GCTGCTGCTGCTGCCGCCGCCGG + Intronic
1103308823 12:119988987-119989009 GATGCGCCAGCCGCCTCCGCAGG + Intergenic
1103308947 12:119989454-119989476 GCTGCTGCTGCTGCCGCCGCCGG - Intergenic
1103359913 12:120347469-120347491 GCCGCCGCTGCCGCCGCCATTGG + Exonic
1103407701 12:120687347-120687369 GCTGCTGCTGCTGCTGCCGCCGG + Exonic
1103433025 12:120904103-120904125 GGAGCCGCCGCCGCCGCCGCGGG - Exonic
1103521248 12:121537911-121537933 GCCGCCGCCGCCGCCGCCGAGGG - Intronic
1103563347 12:121803884-121803906 GGCGGCGCAGCTGCCGCCGCCGG + Intergenic
1103954253 12:124567590-124567612 GCCACCGCCGCCGCGGCCGCCGG - Intergenic
1104602655 12:130163502-130163524 GTTGTCGCAGCCGCCGCGCCCGG - Exonic
1104828838 12:131734097-131734119 GCTTCCCCAGCCTCCGCTGCAGG - Intronic
1104841620 12:131828560-131828582 GCTGCCGCTGCTGCTGCTGCTGG + Exonic
1105011855 12:132761617-132761639 GCGGCCGCCGCCCCCGCCTCAGG - Exonic
1105578839 13:21675327-21675349 CCTGCCGCAGCGGCAGCAGCGGG - Intronic
1106246388 13:27953896-27953918 GCAGCCGGAGCCGCCGCAGGAGG - Intergenic
1106322965 13:28659274-28659296 GCTGCCGCCGCCGCCGCCACCGG - Intronic
1106517089 13:30465194-30465216 GCCGCCGCCGCCGCCGCGACCGG + Intronic
1106720149 13:32427989-32428011 GCCGCCCCGGCCGCCCCCGCGGG - Exonic
1106720153 13:32428013-32428035 GCTGCCGCTGCTGCTGCTGCTGG + Exonic
1106735833 13:32586910-32586932 GCCGCCGCCGCCGCCCCGGCCGG - Intronic
1106776848 13:33016965-33016987 GCTCCCGCAGCCGCTCCAGCAGG - Exonic
1107467832 13:40665899-40665921 GCCGCCGCGGCCGCCACCGGGGG - Exonic
1107467835 13:40665902-40665924 GCGGCCGCCGCGGCCGCCACCGG - Exonic
1107513475 13:41107489-41107511 GCTGCAGCACCCGCAGCTGCAGG + Intergenic
1107534076 13:41311277-41311299 GGAACCGCCGCCGCCGCCGCTGG + Exonic
1107851784 13:44577900-44577922 GCGGCAGCAGCCGCGGCGGCGGG - Intergenic
1108373416 13:49792536-49792558 GCCGCCGCCGCCGCAGCCGCAGG - Exonic
1108541494 13:51451731-51451753 GCCGCCGCCGCCGCCGCTGCCGG + Intronic
1110119758 13:71866530-71866552 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1111396083 13:87671885-87671907 GCTGCAGCCGCCGCCTTCGCTGG + Intergenic
1111951275 13:94711388-94711410 GCGGCGGCCGCCGCCGCCGGGGG - Exonic
1111951278 13:94711391-94711413 GCAGCGGCGGCCGCCGCCGCCGG - Exonic
1111951317 13:94711550-94711572 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1112050621 13:95641776-95641798 GCTGTGGCCGCCGCCGCCGCGGG - Exonic
1112271902 13:97976480-97976502 CCCGCCGCGGCCGCCGGCGCCGG - Intronic
1112505033 13:99970403-99970425 GCCGCCGCCGCCACCGCCCCCGG - Exonic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1112505231 13:99971112-99971134 GCTGCCGCCGCCGCCACTGTTGG + Exonic
1112507813 13:99985446-99985468 GCCGCCGCTGCCGCCGCCGCTGG - Exonic
1113200987 13:107867317-107867339 GCCGCCGCCGCCGCTGCCGCAGG + Intergenic
1113378132 13:109782945-109782967 GCAGCCGCCGCCACCGCCGCCGG - Exonic
1113378633 13:109784821-109784843 GCCGCCGCAGCCGCCGCTCAGGG + Exonic
1113397567 13:109962802-109962824 GCTGCTGCTGCCACAGCCGCCGG + Intergenic
1113656100 13:112068502-112068524 GCCGCCGCCGCCGCCGCTGCGGG + Exonic
1113656163 13:112068724-112068746 GCGGCCGCTGCTGCCGCCGCCGG - Exonic
1113769109 13:112897360-112897382 GCTGCCCCAGCCGGCTCTGCGGG + Intronic
1113976962 13:114234970-114234992 GCAGCCGCCGCCGCCGCCCCAGG - Exonic
1114037928 14:18646560-18646582 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1114120693 14:19668471-19668493 ACCGCTGCGGCCGCCGCCGCTGG - Intergenic
1114616524 14:24071560-24071582 GCTGCTCCAGCCGCTGGCGCCGG - Exonic
1114866200 14:26598002-26598024 GCTGCCGCCGCCGCCGCTGCCGG + Intergenic
1115028399 14:28767498-28767520 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1115119938 14:29927448-29927470 GCGGCAGCTGCCGCCGCCACGGG + Exonic
1115203022 14:30874274-30874296 GCTGCCGCCGTCGGGGCCGCCGG + Intergenic
1115257612 14:31420024-31420046 ACTGGCGCAGCGGACGCCGCAGG + Intronic
1115399318 14:32939416-32939438 GCCGCCGCCTCCGCCGCCGAGGG + Intronic
1115490030 14:33950355-33950377 CCTGCCGCAGCTGCTCCCGCGGG - Intronic
1115576205 14:34714545-34714567 GCCGCCGCAGCCACAGCCGAGGG - Exonic
1116973880 14:51095030-51095052 ACCACCACAGCCGCCGCCGCTGG - Exonic
1117072553 14:52069441-52069463 GCAGCCGCACTCGCCGCTGCGGG - Intergenic
1117176625 14:53152723-53152745 CCCGCCGCAGCAGCCTCCGCTGG - Exonic
1117675604 14:58152140-58152162 GCCGCCGCAGGGCCCGCCGCTGG - Exonic
1117675609 14:58152152-58152174 GCTACCGCCGCCGCCGCCGCAGG - Exonic
1118321081 14:64753742-64753764 CCTGCAGCAGCCACCACCGCCGG - Exonic
1118339099 14:64879826-64879848 GCCGCCGCCGCCGCCACCCCCGG - Exonic
1118463920 14:66013813-66013835 GGAGCCGCAGCTGCCGCAGCCGG - Intergenic
1118607699 14:67515404-67515426 GCCGCCGCCGCCGCCGCCGGGGG - Intronic
1118607703 14:67515407-67515429 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1118748349 14:68789897-68789919 GCTGCCACCGCCGCTGCCACCGG - Exonic
1118843211 14:69527888-69527910 GCTGCCGCTTCCACCGACGCCGG + Exonic
1119223961 14:72929838-72929860 CCAGGCACAGCCGCCGCCGCGGG - Intronic
1119377545 14:74206795-74206817 GCTCCCGCAGCAGCCTCCTCTGG + Intergenic
1119623626 14:76151967-76151989 GCTGCCGCAGCCACCTCCAACGG - Exonic
1119821038 14:77616452-77616474 GCCGCAGCCGCAGCCGCCGCCGG - Exonic
1120914782 14:89701623-89701645 GCGGCCGCGCCCGACGCCGCCGG - Intergenic
1121075001 14:91060506-91060528 GCAGCCGCTGCCGCGGCCCCAGG + Exonic
1121250714 14:92497575-92497597 GCAGCCTCAGCCGCTGGCGCTGG - Exonic
1121312296 14:92941714-92941736 GCTGCCGCAGCAGCCGGGGCTGG + Exonic
1121711048 14:96039448-96039470 GCTGCTGCCGCTGCCGCTGCGGG - Exonic
1121828892 14:97033272-97033294 GCTGCGGGATCCGCCGCCCCGGG + Intergenic
1122130691 14:99603312-99603334 GCTGCCGCCGCTGCCCGCGCTGG + Exonic
1122130813 14:99603928-99603950 GCCGCCGCCGCCGTCGCCGCGGG + Exonic
1122162308 14:99793348-99793370 GCAGCAGCAGCCGCCACAGCAGG + Exonic
1122183498 14:99971991-99972013 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1122418454 14:101561234-101561256 ACTCCGGCAGCCGCTGCCGCTGG - Intergenic
1122445013 14:101761777-101761799 GCCGCCGCCGCCGCCGCCCGGGG - Exonic
1122582116 14:102777541-102777563 GCGGCCGCCGCGGCTGCCGCCGG - Exonic
1122707152 14:103628788-103628810 CCGGCCGCAGCCGCCACCACTGG - Intronic
1122779919 14:104139191-104139213 GCGGCACCAGCCGCCTCCGCCGG - Exonic
1122975374 14:105168678-105168700 ACCGCCGCCGCCGTCGCCGCCGG - Exonic
1123702851 15:22928528-22928550 GCTGCCACAGCCACCGCCTGGGG + Intronic
1124497185 15:30193630-30193652 GCTGCAGCAGCCGCGGCTCCTGG + Intergenic
1124500728 15:30225039-30225061 CCCGCCGCCGCCGCCGCCGCAGG + Intergenic
1124584468 15:30991954-30991976 GCTGCCGCCGTGGCCCCCGCAGG - Intergenic
1124742841 15:32313628-32313650 CCCGCCGCCGCCGCCGCCGCAGG - Intergenic
1124746389 15:32345017-32345039 GCTGCAGCAGCCGCGGCTCCTGG - Intergenic
1124922315 15:34038918-34038940 GCCGCCTCCGCCGCCGCCTCTGG + Exonic
1124929145 15:34101890-34101912 CCGGCCGCCACCGCCGCCGCTGG + Exonic
1125200738 15:37099013-37099035 GCCGCCGCCGGGGCCGCCGCTGG - Intronic
1125516460 15:40323833-40323855 GCCAGCGCCGCCGCCGCCGCCGG - Intergenic
1125674247 15:41494060-41494082 GTCGCTGCGGCCGCCGCCGCGGG + Exonic
1125916577 15:43493124-43493146 GCTGTCGCCACCGCCGCCACCGG + Exonic
1126150858 15:45522674-45522696 GCTGCTCCACCCGCGGCCGCAGG + Exonic
1126436851 15:48645597-48645619 GCAGCCGCCGCCGCCTCCTCGGG - Exonic
1126767006 15:52019444-52019466 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
1126963948 15:54030066-54030088 GCTGCTGCAGCAGCGGCAGCAGG + Intronic
1127789916 15:62390559-62390581 GCTGCCGCCGCCGCTGGCTCCGG - Intronic
1127789918 15:62390565-62390587 TCAGCCGCTGCCGCCGCCGCTGG - Intronic
1128119093 15:65133034-65133056 GAAGCCGCAGCCGGCGGCGCCGG + Exonic
1128582753 15:68820492-68820514 GCTGCCGCCGCCGCTGCCCTTGG - Intronic
1128736657 15:70057487-70057509 GCTGCTGCAGCCGCTGCCTATGG - Exonic
1129016720 15:72474866-72474888 GCCGCCGCCGCCGCCACCGCCGG - Exonic
1129082450 15:73052551-73052573 GCTGGAGCAGCGGCGGCCGCGGG + Exonic
1129260767 15:74365984-74366006 GGGGCCGCCGCCGCCTCCGCGGG + Intronic
1129387019 15:75201891-75201913 GCTGCCGTTCGCGCCGCCGCTGG - Intronic
1129414670 15:75368567-75368589 GCCGGCGCAGCCGCCATCGCCGG + Exonic
1129644692 15:77419720-77419742 GCTCCCGGGGCCGCCGCCGAGGG + Intronic
1129675977 15:77632639-77632661 GCCGCCGCCGCCTCTGCCGCTGG + Intronic
1130261135 15:82355266-82355288 GCAGCCGCTGCTGCCGCCGCCGG + Intergenic
1130261138 15:82355269-82355291 GCCGCTGCTGCCGCCGCCGGGGG + Intergenic
1130280097 15:82513749-82513771 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130280100 15:82513752-82513774 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130411699 15:83653723-83653745 GACGCCGCCACCGCCGCCGCCGG - Intergenic
1130471472 15:84229935-84229957 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130471475 15:84229938-84229960 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130478966 15:84344506-84344528 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130478969 15:84344509-84344531 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130492801 15:84443622-84443644 GCAGCCGCTGCTGCCGCCGCCGG + Intergenic
1130492804 15:84443625-84443647 GCCGCTGCTGCCGCCGCCGGGGG + Intergenic
1130593766 15:85234562-85234584 GCCGCTGCTGCCGCCGCCGGGGG - Intergenic
1130593769 15:85234565-85234587 GCAGCCGCTGCTGCCGCCGCCGG - Intergenic
1130908599 15:88256345-88256367 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1130908663 15:88256685-88256707 GCTGCAGCAGCCGCCGCGAATGG + Exonic
1131006450 15:88982564-88982586 GCAGCCGCAGCCCCAGCCCCAGG + Intergenic
1131182389 15:90249574-90249596 GCAGCCGCAGCCACGGCCACCGG + Exonic
1131431747 15:92393908-92393930 GCCGCTGCCGCTGCCGCCGCCGG + Exonic
1131827148 15:96331074-96331096 GCTGCCGCTGCTGCCGCCGCCGG - Exonic
1132335918 15:101048694-101048716 GGTGCCACAGCAGCCACCGCGGG + Intronic
1132683531 16:1153245-1153267 GCCGCCGCCGTCGCCTCCGCCGG + Exonic
1132713734 16:1280341-1280363 GCTCCCACAGCCGACGCCGAGGG + Intergenic
1132858679 16:2058954-2058976 GCCACCGCAGCCCCCGCAGCAGG - Intronic
1132872666 16:2122706-2122728 TCTGCTGCCGCCGCAGCCGCTGG - Intronic
1132877960 16:2148665-2148687 GCCGCCGCCGCCGCCGCCAGGGG + Exonic
1133156453 16:3880137-3880159 CCGGCCGCCGCCGCCGCCGCCGG + Exonic
1133156581 16:3880501-3880523 GCTGCCGCCGCCGCCGCCGCCGG + Exonic
1133227835 16:4351050-4351072 GCCGCCGGTGCCGCCGCTGCCGG + Intronic
1133784411 16:8963567-8963589 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1135296536 16:21283932-21283954 GCCGCCGCCTCCGCCGCTGCGGG - Intronic
1135303039 16:21347195-21347217 GCAGCCACAGCCGCAGCCGCAGG + Intergenic
1135597458 16:23755126-23755148 CCCTCCGCAGCCGCCGACGCGGG - Intronic
1135607342 16:23836061-23836083 GCTGCTGCACCCGGGGCCGCGGG - Exonic
1135712492 16:24729666-24729688 GCCGACACCGCCGCCGCCGCAGG - Intergenic
1135712551 16:24729911-24729933 GCCTCTGCTGCCGCCGCCGCGGG - Intronic
1135821972 16:25692705-25692727 GCCGCCCGCGCCGCCGCCGCTGG + Exonic
1135970338 16:27067472-27067494 GCTGCTGCCGCTGCCGCTGCCGG - Intergenic
1136003542 16:27313781-27313803 GCTGTCCCCGCCGCCGCCGCCGG - Intronic
1136110887 16:28063192-28063214 GCCGCCGCCGCCACCGCCTCGGG - Exonic
1136226502 16:28863897-28863919 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1136299781 16:29326387-29326409 GCAGCCACAGCTGCAGCCGCAGG + Intergenic
1136365560 16:29807554-29807576 GCTGCCGCAGTGGCCGCCGGTGG + Exonic
1136366143 16:29810094-29810116 GCTGCCGCTGCCGCCGCCATTGG - Exonic
1136414741 16:30096224-30096246 GCTGCTGCCGCCGCTGCGGCGGG + Intronic
1136546530 16:30958014-30958036 GCCGCCGCCGCCACCGCTGCGGG + Intronic
1136641549 16:31569424-31569446 GCCGCGGCGGCCGCCACCGCAGG + Intergenic
1137655258 16:50153553-50153575 GCCGCCGCCGCCGCCGCCTCAGG - Intronic
1137668620 16:50266497-50266519 GCCGCCGCTGCTGCCGCTGCCGG + Exonic
1137708027 16:50548667-50548689 GCGGCGGCAGCCGCGGCGGCGGG - Intronic
1137748525 16:50841364-50841386 GGTGCCGCAGTCGCAGCCGTGGG + Intergenic
1138105595 16:54285836-54285858 GCTGCGGCCGCCGCCGCCCAAGG - Exonic
1138105630 16:54285964-54285986 GCTGCCGCCGCTGCCGCCAGCGG + Exonic
1138178733 16:54928870-54928892 CCCGCCGCAGCCGCAGCCCCTGG - Intergenic
1138185838 16:54976996-54977018 GCCGCCGCCGCCGCCGCCACTGG + Intergenic
1138247622 16:55479275-55479297 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
1138360747 16:56425437-56425459 GCCGCCGCCGCCGCCGCGCCGGG + Exonic
1138596711 16:58033014-58033036 TCTGCTGCAGCCGCCCCAGCCGG - Intronic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1139459411 16:67109968-67109990 CCTGCAGCAGCCGCGGCAGCGGG - Exonic
1139459423 16:67110025-67110047 GGTGCTGCTGCCGCTGCCGCCGG + Exonic
1139528108 16:67528815-67528837 GCTGTCGCCGCCGCAGGCGCCGG - Intronic
1139528110 16:67528821-67528843 GCTGCCGCTGTCGCCGCCGCAGG - Intronic
1139615364 16:68085386-68085408 GTCGCCGCCACCGCCGCCGCGGG - Intronic
1139615419 16:68085631-68085653 GCTGCCGCCGCCGCCGCCTGAGG + Intronic
1140187424 16:72787737-72787759 ACTGCCACCGCCGCCGCCGCCGG + Exonic
1140187425 16:72787740-72787762 GCCACCGCCGCCGCCGCCGGTGG + Exonic
1140222987 16:73057859-73057881 GCTGCCGCGGCCGCCACCGCTGG - Intronic
1140223212 16:73058542-73058564 GCCGCTGCAGCCGCCGCCGCCGG - Intronic
1141054613 16:80804012-80804034 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1141054706 16:80804385-80804407 GCCGCCGCCGCCGCTGCTGCCGG - Intergenic
1141054737 16:80804504-80804526 CCGGCTGCAGCCACCGCCGCCGG - Intergenic
1141079202 16:81035952-81035974 GGAGCCGCCGCCGCCGCCTCGGG + Exonic
1141128310 16:81416949-81416971 GCTGCTGCTGCTGCTGCCGCCGG - Intergenic
1141430587 16:83968696-83968718 GCTCCGGGAGCCGCCGCAGCAGG + Exonic
1141582727 16:85011329-85011351 GTCGCCGCCGCCGCCGCCGCAGG - Exonic
1141682597 16:85553294-85553316 GCCGCCGCCGCCGCCGCTGCCGG + Intergenic
1141682599 16:85553297-85553319 GCCGCCGCCGCCGCTGCCGGCGG + Intergenic
1141840107 16:86568526-86568548 GCAGGCGCCGCCGCCCCCGCCGG + Exonic
1141959020 16:87392351-87392373 GCCGCAGCAGCCGCCGCCCCCGG + Exonic
1142061511 16:88033149-88033171 GCAGCCACAGCCGCAGCCGCAGG + Exonic
1142336163 16:89490573-89490595 GCTCCCGCCGCAGCCGCCGCTGG - Intergenic
1142623660 17:1179728-1179750 TCTGACCGAGCCGCCGCCGCGGG - Exonic
1143202676 17:5123123-5123145 GCGGCGGCAGCGGCCGGCGCTGG + Intronic
1143548499 17:7614555-7614577 GCTGCTGCAGCCGCCGCCGGGGG - Exonic
1143548502 17:7614558-7614580 ACTGCTGCTGCAGCCGCCGCCGG - Exonic
1143885819 17:10064107-10064129 GCTGCAGCAGCCGCCGCTGCTGG - Intronic
1144021349 17:11241651-11241673 GCCGCCGCCACAGCCGCCGCGGG - Exonic
1144107285 17:11997436-11997458 GCGCCCGGAGCCGGCGCCGCGGG - Intronic
1144207478 17:12989249-12989271 GCTGCTGCAGCCGCCGCCCTGGG - Intronic
1144339674 17:14301369-14301391 GCAGCAGCAGCGGCGGCCGCGGG + Exonic
1144339725 17:14301581-14301603 GCCGCCGCCGCCCCCGCCGCCGG + Exonic
1144724541 17:17495260-17495282 GCCGCCGCCGCCGCCGCTGCCGG + Exonic
1144846978 17:18225337-18225359 GCTTCCCCAGCCGCCCGCGCTGG + Intergenic
1144909910 17:18672509-18672531 GCTGCCACCGCCGCAGCCGGGGG - Intronic
1144910059 17:18673039-18673061 GCCGCCGCCGCCGCCGCCTGGGG + Exonic
1145002035 17:19312399-19312421 GCTGCCGTAGCCACAGCGGCAGG - Intronic
1145306841 17:21680112-21680134 CCTGCTGCAGCCGCGGCGGCGGG + Intergenic
1145307522 17:21683604-21683626 GCCGCCGCCGCCGCTGCAGCAGG - Intergenic
1145307753 17:21684769-21684791 GCCGCCGCCGCCGCTGCAGCAGG - Intergenic
1145380444 17:22383969-22383991 GCTGCAGCCGCGGCTGCCGCTGG - Intergenic
1145912879 17:28552586-28552608 GCTGCCGCCGCTGCCTGCGCCGG + Exonic
1145925652 17:28644947-28644969 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1145925657 17:28644956-28644978 GCCGCCGCCGCCGGCGCGGCCGG + Intronic
1146187277 17:30731995-30732017 GCCTCCACAGCCCCCGCCGCCGG - Intergenic
1146259922 17:31414614-31414636 GCTGTCCCAGCCGCCACAGCTGG - Intronic
1146393606 17:32444480-32444502 CCGGCCGCGGCCGCCGACGCCGG - Exonic
1146492388 17:33292282-33292304 GCCGCCGCTGCCGCCTCCGCGGG + Exonic
1146762440 17:35490168-35490190 GCTGCTGCAGCCACCAGCGCTGG + Intronic
1146794285 17:35770224-35770246 GGTCCCTGAGCCGCCGCCGCGGG - Exonic
1147144577 17:38477672-38477694 GCCGCAGCCCCCGCCGCCGCCGG - Exonic
1147161773 17:38572780-38572802 GCAGCCGCGGCCGCCGCCGCCGG + Intronic
1147183653 17:38702367-38702389 GGGGCCGCCGCGGCCGCCGCCGG - Intergenic
1147200646 17:38799426-38799448 GCCGCCGCCGCCGCCGCCCCGGG - Exonic
1147285739 17:39401575-39401597 GTTGCGGCCGCCGGCGCCGCGGG - Exonic
1147307401 17:39573630-39573652 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1147486367 17:40818909-40818931 GTAGCCGCCGCCGCCGCCGCCGG + Exonic
1147486381 17:40818960-40818982 ACTGCCGCCGTGGCCGCCGCTGG + Exonic
1147486393 17:40819002-40819024 GCCGCCGGAGCTTCCGCCGCCGG + Exonic
1147486410 17:40819065-40819087 GCCGCCGCCGTGGCCGCCGCCGG + Exonic
1147486415 17:40819080-40819102 GCCGCCGGAGCTTCCGCCGCCGG + Exonic
1147486428 17:40819137-40819159 GCCGCCGCGTCCGCCGCCTCCGG + Exonic
1147564491 17:41528047-41528069 GCCGCCGTAGCCGCCGCCGTAGG + Exonic
1147582920 17:41636999-41637021 GCTGCCGCTGCCGGGGCTGCAGG - Intergenic
1147651182 17:42062837-42062859 GCTGCCGAAGCCGCCTCTGGTGG + Exonic
1147943504 17:44066607-44066629 GCTGCTGCCGCCGCCGCCGCCGG - Exonic
1147967141 17:44199544-44199566 GCCGCCGTCGCCGCCGCCGGAGG - Intronic
1147967143 17:44199547-44199569 GCCGCCGCCGTCGCCGCCGCCGG - Intronic
1147971178 17:44219749-44219771 GCCGCCGCAGCCTCAGCCGCCGG + Intronic
1147971182 17:44219755-44219777 GCAGCCTCAGCCGCCGGAGCGGG + Intronic
1147971289 17:44220059-44220081 GCTGCTGCTGCTGCCGCCGCCGG + Intronic
1147994790 17:44354674-44354696 GCTGGCGCGGCCGCCGTCGCTGG - Exonic
1148105953 17:45118968-45118990 GCCGCTTCAGCAGCCGCCGCAGG + Exonic
1148262220 17:46193489-46193511 GCCGCCGCAGCCGCAGCCGGCGG - Intronic
1148440411 17:47709014-47709036 GCCACCGCCGCCGCCCCCGCCGG + Exonic
1148698624 17:49575651-49575673 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1148698626 17:49575654-49575676 GCCGCCGCCGCCGCCGCCGGTGG + Intergenic
1148768844 17:50055729-50055751 GCAGCAGCAGCAGCAGCCGCAGG + Intergenic
1149430614 17:56593723-56593745 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1149430843 17:56594544-56594566 GCTGCGGCAGCGGCCGTCGGGGG + Exonic
1149461541 17:56833696-56833718 GATGCCGGCGCCGCCGCCGCCGG - Exonic
1149477868 17:56978201-56978223 GCTGCTGCTGCCGCTGCTGCTGG + Exonic
1149626524 17:58083949-58083971 GCTGCCGCTGCCCCCGCCCCCGG + Intronic
1149996376 17:61408156-61408178 GCTGCCGCCGCCGCAGCCGCCGG + Exonic
1150373509 17:64661885-64661907 GCCCCCGCCGCCCCCGCCGCCGG - Exonic
1150423170 17:65056600-65056622 GCCGCCGCCGCCGCCTCGGCGGG + Exonic
1150747296 17:67825949-67825971 GAAGCCGCCGCCGCCGCCGCCGG + Exonic
1151854338 17:76710633-76710655 GCCTCCGCTGGCGCCGCCGCGGG + Exonic
1152049084 17:77958760-77958782 GGAGCCGTAGCCGCCGCCGCCGG + Intergenic
1152049187 17:77959097-77959119 GCCGCCGCCGCCGCCCGCGCCGG + Intergenic
1152357291 17:79813381-79813403 GCTGCGGCGCCCGCCCCCGCCGG + Intergenic
1152503490 17:80729858-80729880 GCTGCCTCAGTTCCCGCCGCGGG - Intronic
1152561331 17:81080228-81080250 GGTGCCGCAGGCGCCCCAGCCGG - Intronic
1152697411 17:81804057-81804079 GCTGCCGCTCCCACCCCCGCGGG + Intergenic
1152755956 17:82087149-82087171 GCTGCTCCTGCTGCCGCCGCGGG + Exonic
1152775854 17:82201578-82201600 GCTGCAGCAGCAGCAGCAGCTGG - Exonic
1152824847 17:82458438-82458460 TTGGCCGCCGCCGCCGCCGCAGG + Intronic
1152834380 17:82519886-82519908 GCCGCCGCGGCCGCCGCCATGGG - Exonic
1153794399 18:8609486-8609508 GCCGCTGCCGCCGCCGCCGCCGG - Exonic
1154241566 18:12657982-12658004 GCGGCCGCGCGCGCCGCCGCCGG + Exonic
1154501445 18:14999735-14999757 CCTGCCGGAGCCACCGCCCCTGG - Intergenic
1155007506 18:21741524-21741546 GCCGCCGCCGCTGCCGCCGGGGG - Exonic
1155007510 18:21741527-21741549 GCCGCCGCCGCCGCTGCCGCCGG - Exonic
1155191936 18:23437919-23437941 GCTGCCGCTGCTGCTGCTGCGGG - Intronic
1155507648 18:26548480-26548502 GCTGGCGCTGCCGCCCGCGCTGG + Intronic
1155654334 18:28177050-28177072 GCCGCCGCCGCCGCCTCCTCCGG - Exonic
1156036155 18:32770288-32770310 GCAGCAGCAGCCGCCGCCGCAGG - Exonic
1156099623 18:33578356-33578378 GCTGCCGCCGCCCCCGCCCCCGG + Intergenic
1156149423 18:34224514-34224536 GCGGCCGCAGCCGCCGCGCGAGG - Intronic
1156213838 18:34976942-34976964 GCCGCCGCCGCCGCCGCTCCGGG - Intronic
1157279093 18:46334164-46334186 GCTGCGGGAGCCGCCGGGGCGGG - Intronic
1157609639 18:48948652-48948674 GCGGCCGCAGCCGCCGCGCTCGG + Intronic
1157849133 18:51030705-51030727 GCCGCCGCCGCCGCCGTCGTCGG - Intronic
1158570929 18:58596482-58596504 GCTGCTGCAGCAGCCGCCGCAGG + Intronic
1158601971 18:58863644-58863666 GCAGCCACAGCAGCAGCCGCCGG + Intronic
1158931037 18:62325282-62325304 GCCGCGGCAGCCGCGCCCGCTGG + Intronic
1158954142 18:62523556-62523578 GCCGCCGCCGCCGCCGCCCGCGG + Exonic
1158954159 18:62523598-62523620 GCCGCCGCCGCCGCCGCCCCGGG + Exonic
1158976505 18:62715753-62715775 GCTGCCGCAGCGGCGGCCGCCGG - Exonic
1159040288 18:63318419-63318441 GCTGCCCCCGGCGCCGCCGCGGG - Exonic
1160242394 18:77132899-77132921 GCGGCCGCCGGCGCCGCCCCGGG + Intronic
1160453343 18:78979745-78979767 GCCCCCCCCGCCGCCGCCGCCGG - Intergenic
1160521008 18:79507928-79507950 GCAGCCGCAGTCGCCGCGTCAGG + Intronic
1160535269 18:79588342-79588364 GCTGCCGCGGGTGCTGCCGCCGG - Intergenic
1160719131 19:589895-589917 GGAGCCGCCGCCGCCGCCGCCGG - Exonic
1160725378 19:615949-615971 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
1160727672 19:624757-624779 CCCGCCGCAGCTGCCGCCCCCGG - Exonic
1160765671 19:806455-806477 GCAGCTGCCGCCGCCGCCGAGGG - Exonic
1160790457 19:920579-920601 GCCGCCCCCGCCGCCCCCGCCGG + Exonic
1160810442 19:1010802-1010824 GCTGCTTCAGGCGCCGCCACTGG - Exonic
1160873105 19:1285890-1285912 GCCGCCGCCGCCGCACCCGCCGG - Intergenic
1160894289 19:1395487-1395509 AGCGCCGCCGCCGCCGCCGCCGG + Exonic
1160923891 19:1533827-1533849 CCTCCCGCAGCCGCCGCCGCAGG - Intronic
1161022140 19:2015537-2015559 GCCGCCGCCGCCGCCGCCCCTGG - Exonic
1161069655 19:2253722-2253744 GCAGCCGCCGCCGCCGCCCCCGG - Exonic
1161162912 19:2770566-2770588 GCCGCCCCCGCCCCCGCCGCTGG + Intronic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161264823 19:3359423-3359445 GCAGCCGGAGCCGCCGCAGCCGG + Intergenic
1161297732 19:3528081-3528103 GCTGCCGCAGATGCCACTGCTGG - Intronic
1161317366 19:3623891-3623913 GCAGCCGCAGCCGCTCCTGCAGG + Exonic
1161400708 19:4065464-4065486 GCCGCCGCCACCGCCGCCGCCGG - Intronic
1161628761 19:5340878-5340900 AGCGCCGCCGCCGCCGCCGCCGG + Intergenic
1161700025 19:5789446-5789468 GCTTCCGCAGCTGCTGCTGCAGG + Exonic
1161707266 19:5828026-5828048 CCCGCCGCAGGCGCCGCCGCTGG - Exonic
1161718574 19:5891216-5891238 GCTGACCCAGGCCCCGCCGCCGG - Intronic
1161752901 19:6110426-6110448 GCAGCCGCTGCCGCCGCCGCGGG - Exonic
1161911551 19:7198183-7198205 GCCGCCGCAACCGCCGGGGCCGG - Intronic
1161911554 19:7198189-7198211 GCTGCGGCCGCCGCAACCGCCGG - Intronic
1161960491 19:7520470-7520492 GCAGCTGCAGCAGCGGCCGCCGG + Exonic
1162030917 19:7916921-7916943 GCCGCCGCCGCCGCCATCGCGGG + Exonic
1162033205 19:7926051-7926073 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
1162130123 19:8521342-8521364 ACTGCTGCAGCCCCCGCCCCTGG - Exonic
1162311989 19:9913403-9913425 GCTGCCGCCGCCGCAGCCCCCGG - Intronic
1162752674 19:12838463-12838485 GAGGCTGCAGCCGCCGCAGCGGG - Intronic
1162792547 19:13070498-13070520 GCTGCAGCTGCCCCGGCCGCAGG + Intronic
1162954322 19:14090030-14090052 GCAGCCACAGCCGCCGCCGGAGG - Exonic
1163006137 19:14397733-14397755 GCTGCCGCTGCCGCCCAGGCTGG + Exonic
1163061608 19:14765707-14765729 GCTGCCGCTGCCGCCCAGGCTGG - Exonic
1163154473 19:15432491-15432513 GCCACCGCCACCGCCGCCGCGGG - Intronic
1163262174 19:16197977-16197999 GCTGCCGCCGCCACCGCCCTCGG + Exonic
1163436853 19:17301197-17301219 GCTGCCGCTGCCTGCGCTGCCGG + Exonic
1163451414 19:17379465-17379487 GCAGCCGCCGACGACGCCGCTGG - Intergenic
1163557627 19:18001545-18001567 GCAGCAGCTGCCGACGCCGCAGG - Intronic
1163586950 19:18169342-18169364 GCTCCCGCCGCCGCAGCCTCCGG - Exonic
1163606978 19:18280982-18281004 GCCGCCGCCGCCGCCGCCGGGGG - Exonic
1163606982 19:18280985-18281007 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1163804151 19:19386014-19386036 GCCGCCACAGCGGCCGCCGCGGG + Exonic
1163807251 19:19406449-19406471 GCCGCCGCCGCCGCCGCCGCGGG - Intronic
1164594850 19:29526118-29526140 GCTCCCGCAGCCGCCCCCGCCGG - Intergenic
1164834534 19:31349244-31349266 GCCGCCGCCGCCGCCGCTGCCGG + Exonic
1165080113 19:33302103-33302125 GCCGCCGCCGCCGCCGCCCGTGG + Exonic
1165243054 19:34482261-34482283 GCCGCCACCGCCGCCGCCGTCGG - Exonic
1165309472 19:35021764-35021786 GGGGCCGCTTCCGCCGCCGCAGG - Exonic
1165328285 19:35126617-35126639 TGGGCCGCAGCAGCCGCCGCGGG + Exonic
1165351691 19:35279273-35279295 GCAGCCGCCGCCGCCCACGCCGG + Exonic
1165429943 19:35766862-35766884 GCTTCCGCCGCTGCCGCCACTGG - Exonic
1165493945 19:36141118-36141140 GCCGCCGCCGCCGCCGCCCCCGG - Exonic
1165803157 19:38565270-38565292 GCCGCCGCACGCGCCGCCGCAGG - Exonic
1166055423 19:40285285-40285307 GCCGCCGCCGCTGCCGCTGCCGG - Exonic
1166333007 19:42089528-42089550 CCTGCCCCAGCCGCCCCCTCCGG + Intronic
1166361250 19:42253866-42253888 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1166361254 19:42253869-42253891 GCCGCCGCCGCCGCCGCCGGGGG + Intronic
1166389558 19:42401576-42401598 GCTGCTGCGGCGACCGCCGCAGG - Exonic
1166732577 19:45067399-45067421 GTAGCCGCAGCCGCAGCAGCTGG + Exonic
1166748340 19:45152510-45152532 GCTGCAGCAGCAGCAGCAGCAGG - Exonic
1166851817 19:45764985-45765007 GCTGCCCCACCCCCCGCCCCTGG + Exonic
1166888030 19:45973360-45973382 GCAGCAGCAGCCGCCGCCCCAGG - Exonic
1166902663 19:46077670-46077692 GCTCCCGCAGGCGCTCCCGCGGG - Intergenic
1166975122 19:46601370-46601392 GCTGCAGCTGCTGCCGCCGCCGG + Exonic
1166975123 19:46601373-46601395 GCAGCTGCTGCCGCCGCCGGAGG + Exonic
1167019097 19:46861100-46861122 GCCGCCGCCTCAGCCGCCGCTGG + Intergenic
1167040464 19:47020348-47020370 GCCGCCGCAGCCTCTGCCCCAGG - Intronic
1167146006 19:47681096-47681118 GCAGGCGCAGCAGCCCCCGCAGG + Exonic
1167258109 19:48443029-48443051 GCCGCCGCGGCCACCGCCGTCGG + Exonic
1167268957 19:48497682-48497704 GCTTCCGGGGCCGCCGCCGGGGG + Exonic
1167578937 19:50330896-50330918 GCAGCCCCAGCCGCAGCCGCTGG - Intronic
1167613316 19:50517658-50517680 GCCCCCGCAGCCCCCGCCGCTGG + Exonic
1167699119 19:51031984-51032006 GCAGGCGCAGCCGCAGCAGCCGG + Exonic
1168064058 19:53909425-53909447 CCGGCCGCCGCCGCCGCCACCGG - Exonic
1168076325 19:53982545-53982567 GGCGCCGCCGCCGCCGCCGCCGG - Exonic
1168076348 19:53982599-53982621 GCCGCCTCCGCCGCCGCCCCCGG - Exonic
1168092712 19:54096127-54096149 GCTGCCGCGGCCGTCGCTGGTGG - Exonic
1168095833 19:54114501-54114523 GCTGGCGCCGCCGCCGACCCCGG + Exonic
1168239442 19:55081867-55081889 GCGGCCGCAGGAGCCGGCGCCGG + Exonic
1168247005 19:55117491-55117513 GCAGCCGCCGCCGCCGCCCCCGG + Exonic
1168721770 19:58558394-58558416 GCCGCCGCTGCCGCCGCCGCGGG + Exonic
925013427 2:503468-503490 GCTGGCGCCGCCTCCCCCGCTGG - Intergenic
925609911 2:5693752-5693774 GCTGCTGCTGCCGCTGCTGCTGG - Exonic
925912704 2:8583766-8583788 CCTGCTGCAGGCGCCGGCGCGGG - Intergenic
925977466 2:9151089-9151111 GCAGCCACAGCGGCCGCCGCAGG - Intergenic
926044996 2:9703771-9703793 GCTGCCCCAGCCTCCACTGCTGG - Intergenic
926217103 2:10912359-10912381 GCCGCCGCCGCCGCTGCCGCTGG - Exonic
926305411 2:11634363-11634385 GCTGCCGCCGCCTCTGCCCCAGG - Intronic
927714044 2:25341429-25341451 GCTGCCGCAGGGGCCCCGGCCGG - Intronic
927751381 2:25673466-25673488 GCTGCCGCTGCCTCAGCCGAGGG - Exonic
927760028 2:25744277-25744299 GCTGCTGCAGCCGCCTCAGTTGG - Exonic
928322395 2:30294339-30294361 GCTGCCGCTGCTGCTGCTGCTGG - Intronic
928606357 2:32947621-32947643 ACCGCCGCCGCCGCCGCCGCCGG + Exonic
928983218 2:37156918-37156940 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
929188786 2:39120983-39121005 GCCGCCGCCACCGCCGCCGCCGG + Exonic
929242419 2:39666157-39666179 GCTGTCGCACCTGCCGCTGCGGG + Exonic
930011479 2:46941209-46941231 GCTGCCACAGCCTCCGCCCCGGG - Exonic
930358223 2:50346884-50346906 GCCGCCGCCGCCGCCGCCCCCGG + Intronic
930762377 2:55050324-55050346 GCAGCTGCTGCCGCCGCCGCCGG + Exonic
930847764 2:55923796-55923818 CCTGCCGCCGCGGCCGCTGCCGG - Exonic
931253507 2:60552418-60552440 GCCGCCGCCGCCGCCGCCGAAGG - Intronic
931254109 2:60555284-60555306 GCAGCCGCCGCCGCCGCCGCCGG + Intergenic
931356031 2:61538220-61538242 GCGGCTGCAGCGGCCGCGGCAGG - Exonic
931429213 2:62196086-62196108 CCAGGCGCAGCAGCCGCCGCGGG - Intergenic
931489092 2:62725284-62725306 ACTGCCACAGCCGCTGCTGCTGG - Intronic
931881393 2:66574867-66574889 GCAGCCGCAGCAGCAGCAGCAGG + Intergenic
932567230 2:72917703-72917725 GCCGCAGCAGCCGCCGCGCCTGG + Exonic
932607674 2:73175833-73175855 GCGCCCGCCCCCGCCGCCGCGGG - Intergenic
932621865 2:73269443-73269465 GCCGCCGCCGCCGCTGCCTCGGG - Exonic
932699848 2:73985057-73985079 GCCGCCGCCGCCGCCGCCTGGGG - Intergenic
932773959 2:74516060-74516082 GCTGCGGCCGCCGCTGCCCCCGG + Exonic
933666861 2:84971284-84971306 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
934079113 2:88452453-88452475 GCCGCCACCGCCGCCGCCCCGGG - Exonic
934736303 2:96691533-96691555 GCCGCCGCTGCTGGCGCCGCAGG + Intergenic
934776385 2:96940290-96940312 GCTGCTGCTGCCACCGCCACAGG + Intronic
934966854 2:98731106-98731128 GCCGCTGCCGCCGCCGCTGCGGG + Intronic
935196642 2:100820238-100820260 GCCGCCGCCGCCGCGGCTGCGGG - Exonic
935592438 2:104855285-104855307 GCCGCCGCCGCCGCGGCCCCCGG - Intergenic
935592639 2:104855924-104855946 GCCGCCGCCGCCACCGCCGCAGG + Exonic
935592736 2:104856229-104856251 CGCGCCGCCGCCGCCGCCGCCGG - Exonic
935634881 2:105242593-105242615 GCTGCCGCTGCAGGCGCCGCAGG - Exonic
935692616 2:105744882-105744904 GCCGCCGCCGCCGCTGCCGCGGG + Exonic
936122699 2:109760437-109760459 GCCGCCGCCGCCGCCGCCCCCGG - Intergenic
936221994 2:110611036-110611058 GCCGCCGCCGCCACCGCCCCCGG + Intergenic
936279152 2:111122661-111122683 GCTGCCCCGGCCGCAGCCGCCGG - Intronic
937044990 2:118846554-118846576 GCCGCCGCCGCCGCCGCAGCCGG + Exonic
937326091 2:120990195-120990217 GCCTCCCCAGCCGCCTCCGCAGG + Exonic
938273022 2:129992528-129992550 GCTGCCGCCGCCGCCGGCGCTGG - Intergenic
938443202 2:131353578-131353600 GCTGCCGCCGCCGCCGGCGCTGG + Intronic
938500623 2:131829917-131829939 CCTGCCGGAGCCACCGCCCCCGG - Intergenic
938583744 2:132670000-132670022 GCAGCCACAGCCGCTGCAGCCGG - Exonic
938727296 2:134120154-134120176 GCGCCCGGGGCCGCCGCCGCGGG - Intronic
938796105 2:134719136-134719158 GCGGCCCCAGCCTCCGCCACCGG - Intergenic
938876020 2:135531870-135531892 GCAGCCGGAGCCGCAGCCGCGGG - Intronic
939432658 2:142130785-142130807 CCTGCCGCCGCCGCCGCCGCCGG - Exonic
939900614 2:147845242-147845264 GCAGCGGCCGCCGCGGCCGCAGG - Intronic
939900615 2:147845245-147845267 GCGGCCGCGGCGGCCGCTGCTGG + Intronic
941029314 2:160493444-160493466 GCCGCCGCTGCCGCCGCCGCCGG - Exonic
941104846 2:161341013-161341035 GCCTCCGCTGGCGCCGCCGCGGG + Intronic
941119112 2:161507856-161507878 CCCGCCGCCGCCGCCGCCGCGGG + Intronic
941930085 2:170929839-170929861 GCCGCCGCAGGCCCCGCCTCCGG - Intronic
941951382 2:171160459-171160481 GTTGCCGCCGCTGCCGTCGCAGG - Exonic
941951523 2:171160961-171160983 GCCGCCGCCGCCGCCGCTACCGG - Intronic
941951529 2:171160982-171161004 GCGGCGGCAGCGGCGGCCGCGGG + Intronic
942241114 2:173964681-173964703 GCCGCCGCCGCCGCCGCCGGGGG - Intronic
942241118 2:173964684-173964706 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
942241410 2:173965828-173965850 GCGGCCGCAGCAGCAGCCCCGGG - Intergenic
942277972 2:174336425-174336447 GCTGCCGCGGCGGCAGCGGCCGG + Exonic
942278090 2:174336938-174336960 GGCGCCGCGGCTGCCGCCGCCGG + Exonic
942278093 2:174336941-174336963 GCCGCGGCTGCCGCCGCCGGGGG + Exonic
943060532 2:183038106-183038128 GCTGGTGCCGCCGCCGCCGCCGG + Exonic
943209014 2:184938733-184938755 GCAGCTGCAGCCGCAGCTGCAGG + Exonic
943571507 2:189580772-189580794 GCCGCCGCCGCCGCCGCCGTGGG + Exonic
944273087 2:197804958-197804980 GCCGCCGCCACTGCCGCCGCTGG + Exonic
944412443 2:199457722-199457744 GCCGCCGCCGCCGCCGCCTCCGG - Exonic
944412848 2:199459316-199459338 ACTCCCGCGGCCGCGGCCGCCGG + Intronic
944547570 2:200812464-200812486 GTTGCGGCGGCCGCCACCGCAGG + Exonic
944743729 2:202635607-202635629 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
944831218 2:203535341-203535363 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
945033471 2:205685457-205685479 CCTGGTTCAGCCGCCGCCGCCGG + Intronic
945225826 2:207530329-207530351 GCTGCCGCCCCGGCCGCCGCTGG - Intronic
945478383 2:210314993-210315015 GCAGCCGCAGCCGCAGCCACAGG + Exonic
945988174 2:216371470-216371492 GCCGCCGCAGCAGCAGCTGCGGG - Exonic
946248567 2:218400232-218400254 GGAGCCGCCGCCGCCGCCCCGGG + Intronic
946329582 2:219001841-219001863 GCGGCCGCGGCGGCCACCGCAGG + Intergenic
946431021 2:219627527-219627549 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
947119293 2:226799382-226799404 GCTGCTGCTGCCGCCGCCCGCGG + Exonic
947315480 2:228853429-228853451 GCTGCCGCTGCTGCTCCCGCAGG + Intronic
947815672 2:233034703-233034725 GCTGGTGGAGCCGCCGCCCCAGG + Exonic
947992510 2:234497769-234497791 CCTGCCCCAACCGCCGCCACCGG - Intergenic
948415331 2:237798819-237798841 GCCGCCGCTGCCGCCTCCACGGG - Exonic
948470188 2:238172562-238172584 TCTCCAGCAGCCGCCGCCTCTGG - Intronic
948757433 2:240167649-240167671 GCTGCTGCAGAGGCCGCCCCAGG - Intergenic
948831514 2:240600618-240600640 GCTGCCACAGCCACTGCTGCTGG - Intronic
948933626 2:241148981-241149003 GCGGGCTCAGCCGGCGCCGCGGG - Intronic
1169065564 20:2692799-2692821 GCCGCCGCCGCCGCCGCTCCCGG - Intergenic
1169093165 20:2873619-2873641 GAGGCCGCCGCCGCCGCCGCGGG + Intronic
1169214728 20:3786511-3786533 GGCGCCGCCGCCGCCGCCCCGGG + Exonic
1169557620 20:6767689-6767711 GCCGCCGCCGTCGCCGCCGCCGG + Exonic
1170756916 20:19212877-19212899 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1170756918 20:19212880-19212902 GCCGCCGCCGCCGCCGCCGGAGG + Exonic
1170889971 20:20368423-20368445 GCTGCCGCCGCCGCCGCCCGCGG + Exonic
1171382232 20:24742580-24742602 GCTGCTGCAGCCTCCGAGGCTGG + Intergenic
1171847140 20:30284071-30284093 GCTGCCGCCGCGGCGGCGGCTGG - Intergenic
1172015530 20:31870543-31870565 GCTGCCACCGCCGCCGCCGCAGG + Exonic
1172037310 20:32019123-32019145 GCTGCCGCCGCCGCCTCCCCCGG - Exonic
1172083174 20:32358520-32358542 GCAGCCGCCGCTGCCGCCGTGGG + Exonic
1172118729 20:32585520-32585542 GCAGCCGCGCCCGCAGCCGCCGG + Intronic
1172143965 20:32743453-32743475 GCTGCCGCTGCCACCGCTGCCGG + Exonic
1172284601 20:33731993-33732015 GCCGCCGCCGTCGCCGCCACAGG - Exonic
1172474491 20:35226777-35226799 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1172480425 20:35268099-35268121 GCAGCCTCAGCCACCCCCGCAGG + Intronic
1172529209 20:35618636-35618658 GCTGCTGCAGCTGCTGCCCCTGG - Exonic
1172587051 20:36092479-36092501 GCCGCCGGAGCCGCCGGAGCTGG - Intronic
1172702848 20:36863431-36863453 GCAGCCGCAGCCCCAGCGGCCGG - Exonic
1172853450 20:37983359-37983381 GCTGCCGCTGCCACCGCCTATGG + Exonic
1173243434 20:41317604-41317626 GCCGCCGCCGCCGCCTCTGCGGG - Intronic
1173790119 20:45823037-45823059 GCACTCGCAGCCGCCGCCTCGGG + Intergenic
1173855996 20:46251195-46251217 GCCGCCGCCGCCGACGCTGCTGG - Exonic
1174287770 20:49484197-49484219 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
1174317434 20:49713660-49713682 GCAGCCGCAGCAGCCCCCGGCGG + Exonic
1174357822 20:50010100-50010122 GCCGCCGCCGCCGCCGCTGCCGG - Intergenic
1174386499 20:50190913-50190935 GCTGCTGCTGCCGCCGCTGCCGG - Exonic
1174494667 20:50931112-50931134 GCGGCCGCCGCCGCCCGCGCCGG - Exonic
1174494731 20:50931312-50931334 GTTGCCGCCGCCGCCTCCGCCGG - Intergenic
1174494850 20:50931770-50931792 GCTGCTTCTGCCTCCGCCGCCGG - Intergenic
1174504786 20:51010194-51010216 GCGGCCGCAGCCGCTGCGCCCGG + Exonic
1174607044 20:51768469-51768491 GCTGCCGCCGCCTCCTCCCCCGG - Exonic
1175429538 20:58891709-58891731 GCCGCCGCCGCCGCCGCCATGGG + Intronic
1175847005 20:62064798-62064820 GGCGCCGCAGCCGCCGCGCCGGG + Exonic
1175847235 20:62065365-62065387 GCCGCCGCCGCCGTCGCCGCGGG - Exonic
1175962264 20:62643013-62643035 TCGGCAGCAGCGGCCGCCGCAGG - Exonic
1176071601 20:63229532-63229554 GCAGCGGCAGCCGCTGCCGGGGG - Intergenic
1176207110 20:63895198-63895220 GCCGCCGCCGCCGCCGCCCGGGG + Exonic
1176267782 20:64219792-64219814 GCTGCTGCAGCTGCTGCTGCTGG - Exonic
1176733357 21:10521450-10521472 GCCGCCGCAGACTCCGCCTCCGG - Intergenic
1177011054 21:15730367-15730389 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1178306070 21:31491017-31491039 CCTGCCTCAGCCTCCGCCTCTGG - Intronic
1178334668 21:31732277-31732299 GCGGCCGCCGCCGCCGCCGGCGG - Intergenic
1178334670 21:31732280-31732302 GCCGCGGCCGCCGCCGCCGCCGG - Intergenic
1178334672 21:31732286-31732308 GCGGCGGCGGCCGCGGCCGCGGG + Intergenic
1178453709 21:32727978-32728000 GCAGCCGCCGCCACAGCCGCCGG + Exonic
1178552760 21:33555161-33555183 GCAGCCGCACCCCCAGCCGCCGG + Exonic
1178922525 21:36747928-36747950 GGCGCCGCACCCGCCGCCTCCGG + Exonic
1178961912 21:37073289-37073311 GCCGCCGCCGCCGCCACCTCCGG - Intronic
1179098251 21:38334887-38334909 GCTGCCGCTGCCCCTGCAGCTGG + Intergenic
1179561592 21:42219237-42219259 GCCGCCGCCGCCGCCGCCCCCGG + Exonic
1180064340 21:45405140-45405162 CGCGCTGCAGCCGCCGCCGCTGG - Intronic
1180110263 21:45644030-45644052 GCCGCCGCAGGCGCCGGCGGCGG - Intronic
1180151576 21:45950841-45950863 CCTCCCGCAGCGGCCGCCTCCGG + Intergenic
1180462055 22:15573602-15573624 ACCGCTGCGGCCGCCGCCGCTGG + Intergenic
1180649957 22:17369506-17369528 GCGGCCGCCGCCGCAGCCGCGGG + Exonic
1180950667 22:19719144-19719166 GCTGCCGCCGCCCCCGCGGCTGG + Intronic
1181026854 22:20131826-20131848 GCCGCCGCCGCCGCCGCCGCGGG + Intronic
1181031417 22:20150295-20150317 CCTGCCCCAGCCCCAGCCGCAGG - Intronic
1181085211 22:20436652-20436674 GCAGCCGCAGAGGCGGCCGCCGG - Intronic
1181521163 22:23449442-23449464 GCTCCTGCAGCCGCAGCCGGAGG - Intergenic
1181572029 22:23772939-23772961 GCTCCAGCCGCCGCCGCTGCTGG + Exonic
1181694481 22:24586026-24586048 GCTGGCTCAGCCGCCGGCGCAGG + Exonic
1181725133 22:24806230-24806252 GCTGCTGCTGCAGCCGCGGCGGG - Intronic
1182211316 22:28679702-28679724 GATGGAGCAGTCGCCGCCGCCGG - Exonic
1182236911 22:28883500-28883522 GCCTCCGCAGCCGCCGCCGTGGG - Intergenic
1182257765 22:29050544-29050566 GCTGCCCCCTCCGCCCCCGCGGG - Exonic
1182532303 22:30969627-30969649 GCTGCCGCCGCCGCCTCCCCCGG - Intergenic
1182567684 22:31212309-31212331 GCTCCTGCCGCCGCCGCCTCAGG - Intronic
1182622070 22:31623806-31623828 GCTGCCCCAGCCTCCGCCTCAGG + Exonic
1182664083 22:31944751-31944773 GCTGCTGCAGCGGGCGCGGCTGG + Exonic
1182771862 22:32801978-32802000 GCCGCTGCTGCCGCCGCTGCCGG - Exonic
1182903974 22:33920814-33920836 GCGGCCGCTGCAGCCGCCGCGGG + Intronic
1183574910 22:38681982-38682004 GCTGCCGCCGTCGCTGCTGCCGG + Exonic
1183702290 22:39457416-39457438 CCCGCCGCAGCCGCTGCCGCCGG + Exonic
1183931444 22:41238150-41238172 GCAGCCGCAGCCGGCGCAGCTGG + Exonic
1184489997 22:44803000-44803022 GCTGCTGCTGCCGCCACCACTGG + Intronic
1184759690 22:46537443-46537465 GGAGCCGCCGCCGCCGCCGCAGG - Intergenic
1185037935 22:48489464-48489486 GCCGCCGCCGCCGCCGCGCCCGG - Exonic
1185055264 22:48575864-48575886 GCCGCCACCGCCGCCGCGGCGGG - Intronic
1185173222 22:49305355-49305377 GCTGCTGCCGCCTCTGCCGCCGG + Intergenic
1185191493 22:49439505-49439527 GCTTCCGCAACCACCACCGCTGG + Intronic
1185268769 22:49918814-49918836 GCTGCTGCTGCCGCCCGCGCCGG + Exonic
1185313766 22:50170317-50170339 GATCCCGCCGCCGCCCCCGCCGG + Intergenic
1185418063 22:50720760-50720782 GCGGGCGAAGCTGCCGCCGCCGG - Intergenic
1203238464 22_KI270732v1_random:30911-30933 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
949414383 3:3799850-3799872 GCTGCCGCCGCCGCCGCCGTGGG + Exonic
949865329 3:8542469-8542491 GCTGGCGAAGCCGCTGCCCCAGG + Intronic
949970239 3:9397670-9397692 GCCGCCGCCGCCGCCGCTGCCGG + Intronic
949970243 3:9397673-9397695 GCCGCCGCCGCCGCTGCCGGGGG + Intronic
950084665 3:10248761-10248783 GCTGCCGGATCCGCGGCCCCGGG - Exonic
950153815 3:10707951-10707973 GCTGCCGCCGCCGCTGCCGCTGG + Intronic
951080301 3:18444721-18444743 CCTGCCGCCGCCGCCGCCGCCGG + Intronic
951208321 3:19947260-19947282 GCCGCCGCCGCCGCCGGCGCTGG - Exonic
951208324 3:19947266-19947288 TCCGCCGCCGCCGCCGCCGCCGG - Exonic
951485286 3:23203233-23203255 GCCGCCGCTGCCGCCGCCCCCGG - Intronic
951981969 3:28575977-28575999 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
952867192 3:37862004-37862026 GCTCCCGCCGCCGCCGCCGCTGG - Intronic
953027531 3:39153564-39153586 CCCGCCGCCGCCGCCGCTGCCGG - Exonic
953705207 3:45225816-45225838 GCCGCCGCCGCCGCCTCCTCCGG + Exonic
953880122 3:46687111-46687133 GCTGCCGCAGCGCCTTCCGCTGG + Exonic
953908872 3:46882162-46882184 CCCTCCGCAGCCGCCGACGCGGG - Intronic
953909283 3:46883508-46883530 GCAGCCGCCGCCGCCGGCCCTGG - Exonic
953947771 3:47164007-47164029 GCCGCCGCCGCCGCCGCGGTCGG - Intergenic
954108926 3:48423665-48423687 GATGCCCCAGCAGCCGCCGATGG + Exonic
954540880 3:51392267-51392289 GCCGCTGCTGCCGCCGCCGTGGG + Exonic
954615554 3:51967340-51967362 GCCGCCGCCGCCGCCGCCGCAGG - Exonic
954838952 3:53494708-53494730 GCCGCCGCCCGCGCCGCCGCTGG - Intronic
955387610 3:58492063-58492085 GCCGCCGCCGCCGCCGTCGCCGG + Intergenic
955911574 3:63863959-63863981 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
955911611 3:63864056-63864078 GCTGCAGCCGGGGCCGCCGCCGG - Intergenic
956658970 3:71581589-71581611 GCTGCCGGCGCCTCCTCCGCGGG - Intronic
956659485 3:71583797-71583819 GCCGCCGCCGCCACCGGCGCTGG - Intronic
956659488 3:71583803-71583825 GCCGCCGCCGCCGCCGCCACCGG - Intronic
957350637 3:79018947-79018969 GCTGCTATCGCCGCCGCCGCGGG - Intronic
958718935 3:97821903-97821925 CCGGGCGCAGCCGCCACCGCTGG - Intergenic
959591896 3:108090924-108090946 GGGGTCGCCGCCGCCGCCGCAGG + Exonic
961202480 3:125055812-125055834 GCTGCTGCTGCTGCCGCCGGCGG - Exonic
961368635 3:126416393-126416415 CCAGCTGCAGCTGCCGCCGCAGG - Exonic
961536264 3:127572877-127572899 GCTGCCGCTGCCCCTGCCCCTGG - Intergenic
961698838 3:128726199-128726221 TCCGCCGCTGCCGCCGCCTCAGG - Exonic
961835142 3:129651732-129651754 GCTGCAGCAGCAGCAGCAGCAGG - Exonic
962722314 3:138187514-138187536 GCTGCTGCAGGCGCCGGCGCGGG - Exonic
962793990 3:138835005-138835027 GCCGCCGCCGCCGCCACCGCGGG - Intergenic
963038510 3:141051893-141051915 GCTGCCGCCGCCGCCCACTCAGG - Exonic
963236737 3:142963695-142963717 GCCTCCGCCGCCGCCGCCCCCGG + Intergenic
963253093 3:143120069-143120091 GCAGCCGCCGCCGCCGCTGCGGG + Exonic
963602553 3:147390832-147390854 GCTGCTGCCGCCGCCGCCTCCGG - Intronic
963904452 3:150762655-150762677 GCCGGCCCCGCCGCCGCCGCCGG + Exonic
964201452 3:154122397-154122419 GCCTGCGCCGCCGCCGCCGCCGG + Exonic
964720622 3:159764765-159764787 GCCCCCGCCGCCGCCGCTGCGGG - Exonic
964819691 3:160755987-160756009 GCCGCCGCAGCAGCAGCCGCTGG - Intronic
965648415 3:170908606-170908628 GCGGCCGCCACCGCCGCTGCCGG - Exonic
966180445 3:177183620-177183642 CCTGCCTCAGCCTCCGCAGCTGG + Intronic
966182199 3:177197561-177197583 GCCGCCGCCGCCGCCGCCGCGGG - Intergenic
966355168 3:179071891-179071913 GCTACCGCTGCCACCGCTGCCGG - Exonic
966362780 3:179148394-179148416 GCTGCTGCTGCCGCGGCCGCTGG + Intronic
966911420 3:184562256-184562278 GCCGCCGCCGTCGCCGCCGCCGG + Exonic
967858259 3:194134283-194134305 GGAGTCGCCGCCGCCGCCGCCGG - Intergenic
967916715 3:194583886-194583908 GCAGCCGCCGCCGCAGCCGAAGG - Intergenic
968092796 3:195909057-195909079 GCTGCTGCAGCAGCCTCCGCGGG + Intronic
968178173 3:196568994-196569016 GCTGCCCCAGCCCCCGGGGCCGG - Exonic
968225216 3:196968834-196968856 GGGGCCGCCGCCGCCGGCGCAGG + Intronic
968433817 4:575186-575208 GCTGCAGCCGCCGCCCCCGCCGG + Intergenic
968562223 4:1290068-1290090 GCTCCCGCCGCCCTCGCCGCTGG - Intronic
968674716 4:1871348-1871370 CCCGCCGCCGCCGCCGCAGCCGG - Intergenic
968701300 4:2059401-2059423 GCCGCCGCCGCCGCCGCCGCGGG + Intergenic
968835882 4:2963878-2963900 GCCGCCGCCGCCGCCTCCGCAGG - Exonic
968835922 4:2964046-2964068 CCTGGCGCCGCCGCCGCCGGCGG - Exonic
968850569 4:3074975-3074997 GCTTCCTCAGCCGCCGCCGCAGG + Exonic
969330821 4:6472630-6472652 GCCGCCGCCGCCGCTGTCGCAGG + Intronic
970195212 4:13544910-13544932 GCTACCGCCGCCGCCGCCGGGGG - Exonic
970195215 4:13544913-13544935 GCGGCTACCGCCGCCGCCGCCGG - Exonic
970195218 4:13544928-13544950 GTAGCCGCGGCCGCGGCCGCTGG + Exonic
970202885 4:13627497-13627519 GCAGCCACCGCCGCCGCCGCCGG - Exonic
970202901 4:13627551-13627573 ACAGCCGCAGCCGCCTCCTCCGG - Exonic
970332791 4:15002876-15002898 GCTGCCCGCGCCGCCGCCGAGGG - Exonic
970333085 4:15003950-15003972 GCCGCCGCTGCCGCCGCCCGGGG - Exonic
970456346 4:16226983-16227005 GCTGGCGCGGCCGCGGCGGCGGG + Intronic
971195705 4:24470765-24470787 GCTGCTGCTGCCGCGGCGGCGGG + Intergenic
971757562 4:30721979-30722001 GCCGCCGCTGCCGCCGCCTCCGG - Exonic
972312072 4:37891129-37891151 CCTGTTGCTGCCGCCGCCGCGGG + Exonic
972321550 4:37977358-37977380 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
972686915 4:41360777-41360799 GCCGCCGCCGTCGCCGCCGCAGG - Exonic
972725774 4:41745776-41745798 GCCGCCGCCGCCGCCGCCGCAGG + Exonic
974047167 4:56908005-56908027 GCTGCCGCAGCCGAGACGGCAGG + Exonic
974385652 4:61200512-61200534 GCCGCCGCCGCCGCTGCTGCTGG + Intergenic
975131869 4:70839503-70839525 GCTGCCGCAGTCGCTGGCGGCGG - Exonic
975342578 4:73258586-73258608 CCCGCCACAGCCGCCACCGCCGG + Exonic
975342592 4:73258628-73258650 GCAGCCGTCGCCGCCGCCACCGG + Exonic
975689527 4:76950032-76950054 ACAGCCGTCGCCGCCGCCGCGGG - Intronic
975779093 4:77820043-77820065 GCTGGGGCTGCCGCCGCTGCGGG + Intergenic
976199148 4:82561950-82561972 GCCGCCGCCGCCACCGCAGCAGG - Intronic
976246815 4:83012842-83012864 GCCGCCGCCGCCGCTGCTGCTGG - Intronic
976337403 4:83906217-83906239 GCTGCAGCAGCTGCTGCTGCTGG + Intergenic
976389364 4:84493328-84493350 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
976774826 4:88697258-88697280 GCTGCGGCAGAGGCTGCCGCGGG - Exonic
976830340 4:89307868-89307890 GACGCCGCCGCCGCCCCCGCCGG + Exonic
977257545 4:94757911-94757933 GCCGCCGCCGCCGCCACCGCGGG - Intergenic
978072534 4:104491317-104491339 GCCGCCGCCGCCGCCACCGCCGG + Exonic
978072536 4:104491320-104491342 GCCGCCGCCGCCACCGCCGGCGG + Exonic
978126984 4:105146674-105146696 GCTGCCACTGCCGCTACCGCCGG - Exonic
978617932 4:110614368-110614390 GATGCCCCCGCCGCCGTCGCCGG - Intergenic
978619330 4:110622919-110622941 GCAGCGGCTGCTGCCGCCGCAGG - Exonic
978777206 4:112516022-112516044 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
980053841 4:128061665-128061687 TCTGCCCCAGCCGCCCCAGCCGG - Intronic
980130065 4:128809970-128809992 GCCGCCGCCGTCGCCGCCGCGGG - Intronic
980920914 4:139084467-139084489 GCTGTGGCGGCCGCCGCAGCTGG + Intronic
981270747 4:142845728-142845750 GCCGCCGCCGCCGCCGCCGCCGG - Intronic
981550601 4:145937743-145937765 GCCGCCGCCGCCGCTGCCGCCGG + Intronic
981550603 4:145937746-145937768 GCCGCCGCCGCTGCCGCCGGCGG + Intronic
982712252 4:158769132-158769154 GCCACCGCGGCCGCCGCCCCCGG + Exonic
982745878 4:159103650-159103672 GCTTGCGCAGCCGCCGCCCAGGG - Intergenic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
983538020 4:168878329-168878351 GCTGCCCTCGCAGCCGCCGCCGG + Intronic
983538021 4:168878332-168878354 GCCCTCGCAGCCGCCGCCGGCGG + Intronic
983904497 4:173169410-173169432 GATGCCGATGCCGCCACCGCTGG + Intronic
983923433 4:173371258-173371280 GCGGCCGCCGCCGCCTCGGCGGG + Exonic
983940284 4:173529557-173529579 GCCGCCGCCGCCGCCGCCTCCGG + Exonic
984063350 4:175019562-175019584 GCTGCTGCTGCCGCTGCTGCAGG - Intergenic
984462994 4:180059163-180059185 GGAGCCGCCGCCGCCGCGGCCGG - Intergenic
984917011 4:184734035-184734057 GCGGCCGCCGCCGCCCCCGCGGG + Exonic
985896184 5:2751181-2751203 GACGCCGCCGCCGCCGCCGCCGG - Exonic
985995492 5:3595123-3595145 GCAGGCGCAGTCGGCGCCGCGGG - Intergenic
986297082 5:6448723-6448745 GCCGCCGCCGCCGCAGCCGCCGG - Exonic
986297120 5:6448810-6448832 CCCGCCGCCGCCGCCACCGCCGG - Exonic
986330464 5:6713471-6713493 GCCGCCGCCGCCGCCGCCGCAGG + Intergenic
986330585 5:6713851-6713873 GCCGCCGCCGCCGCCGCCACCGG + Intergenic
986813659 5:11385160-11385182 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
986859023 5:11904513-11904535 GCGGCAGCAGCGGCAGCCGCGGG + Intergenic
987258264 5:16179467-16179489 GCCGCCGCCGACGCCGCCGCCGG - Exonic
988437528 5:31193800-31193822 GCCGCCGCCGCCGCGGTCGCCGG - Exonic
988825299 5:34929659-34929681 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
989812670 5:45696208-45696230 GCCGCCGCCGCCGCCGCGACGGG - Intergenic
990955145 5:61332804-61332826 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
991435907 5:66596841-66596863 GCCGCCGCCGCCGCCGCCGTTGG + Exonic
991676507 5:69094102-69094124 GCCGCCACTGCCGCCGTCGCCGG - Exonic
991676557 5:69094287-69094309 GCCGCCGCCGCCGCCGGGGCCGG - Exonic
992105725 5:73448042-73448064 GCCGCCGCCGCCGCCCCCACCGG + Exonic
992269709 5:75052745-75052767 GCTGCCCGAGCCCCCGCCCCTGG - Intergenic
992528079 5:77630563-77630585 GCTGCCTCTGCCGCCGGCGCTGG - Exonic
992528099 5:77630655-77630677 GCCGCCGCTGCCGCCGCCATGGG - Exonic
993900507 5:93581272-93581294 GCCGCCGCTGCCGCCGCCGGGGG - Intergenic
993901218 5:93585112-93585134 GGCGCCGCCGCCGCCGCCGCGGG - Exonic
995106245 5:108381032-108381054 GCAGCCCCCGCCGCCGCAGCGGG + Exonic
995571697 5:113488355-113488377 GCCGCCGCCGCCGCCGCTGCTGG + Exonic
996404174 5:123090170-123090192 GCCGCCGCCGCCCCCGCCCCCGG + Exonic
996442951 5:123512481-123512503 GCCGCCGCCGCTGCCCCCGCCGG + Intronic
996790755 5:127290707-127290729 GCTGCTGCAGCTGCTGCTGCCGG - Intergenic
997013381 5:129904559-129904581 GCTGCCGCCACCGCCGCCGCCGG + Exonic
997319160 5:132963582-132963604 GCTGCCGTCGCCGCCGCCAGCGG - Exonic
997568194 5:134905280-134905302 GGTCCCTCAGCCGACGCCGCCGG - Intronic
997975415 5:138439078-138439100 GCCGCTGCAGCAGCCGCCGCGGG - Exonic
998199415 5:140107826-140107848 GCCGCCGCCGCCGCCGCAGACGG - Intronic
998406653 5:141878192-141878214 GCTGCTGCCTCCACCGCCGCCGG + Intronic
998424194 5:142013005-142013027 GCAGTCGCTGCAGCCGCCGCGGG - Intronic
999768178 5:154756070-154756092 GCTGCCGGAGCCGCGGGCGCGGG + Intronic
999868628 5:155728278-155728300 GCTGCCGCTGCTGCCGCTGCCGG + Intergenic
1000209892 5:159099251-159099273 GCAGCGGCAGCTGCTGCCGCGGG - Intronic
1000319026 5:160119160-160119182 GCCGCCACCGCCGCCGCCGGGGG - Exonic
1000319030 5:160119163-160119185 CCCGCCGCCACCGCCGCCGCCGG - Exonic
1002021191 5:176365476-176365498 GCGGCCGCAGCAGTCGCAGCGGG + Exonic
1002054414 5:176590449-176590471 GCTGACGCAGCTGCTGCAGCTGG + Exonic
1002159699 5:177307877-177307899 GCTGCTCCAGCTGCCGCTGCAGG + Exonic
1002591075 5:180291982-180292004 GCCGCCGCCGCCGCCGCAGTGGG + Exonic
1002591099 5:180292058-180292080 GCTGCCGCCGCCGCGGCGCCCGG + Exonic
1002666773 5:180831185-180831207 CCCGCCGCCGCCGCCGCCTCGGG + Intergenic
1002888205 6:1313543-1313565 CCTTCCGCAGCCGCCGCCTCAGG + Exonic
1002898159 6:1390846-1390868 GTCGCCGCCGCCGCCGCCCCCGG - Exonic
1002991873 6:2245756-2245778 CCTGCCGCCGCCACCGCCTCAGG + Intergenic
1003274335 6:4636665-4636687 GCTGGCACAGCCCCCGCCTCTGG + Intergenic
1003603808 6:7542007-7542029 GCTGGTGCCCCCGCCGCCGCTGG - Exonic
1003624091 6:7727052-7727074 GCTGCCGCGGCCGCCGCCGCCGG + Exonic
1003624094 6:7727055-7727077 GCCGCGGCCGCCGCCGCCGGGGG + Exonic
1003874780 6:10425932-10425954 GCTGCAGCAGCCCCAGCCTCAGG + Intergenic
1004044709 6:12012518-12012540 GCTGCCGCTGCAGCCGGCCCTGG - Exonic
1004174560 6:13328512-13328534 GCTGCCGCTGCCGCCGCCGCCGG + Intronic
1004216840 6:13711430-13711452 GCTGTCGCCGCCACCGCCGGCGG - Exonic
1004395894 6:15246048-15246070 GCCGCCGCCGCCGCCGCCGCTGG + Intergenic
1004660719 6:17706770-17706792 GCTGCCGCAGTTGAAGCCGCTGG + Exonic
1004924053 6:20402374-20402396 GCCGCCGCTGCCGCCGCCCCGGG + Exonic
1004924106 6:20402568-20402590 GCTGCAGCAGCCACCAGCGCTGG + Exonic
1006302353 6:33200322-33200344 GCCGCCGCCGCCGCCGCTGCGGG + Exonic
1006472660 6:34237335-34237357 CCCTCCGCCGCCGCCGCCGCGGG - Intronic
1006725401 6:36196503-36196525 GGCGCCGCCGCCGCCGCCACGGG - Intergenic
1006860802 6:37170511-37170533 GCTGCCGCAGGAGCCGGAGCCGG - Exonic
1007409387 6:41653217-41653239 CCTGCTGCTGCCGCTGCCGCAGG + Intronic
1007595464 6:43048408-43048430 GCTGCCGCTGCAGCTGCAGCAGG + Exonic
1007600163 6:43076369-43076391 GCCGCAGCAGCAGCCGCAGCCGG - Intronic
1007614349 6:43171588-43171610 GCCGCCGCAGCCGCCGCCATCGG - Exonic
1007625341 6:43243506-43243528 GCTGCCGCCGCCGTCGCCCAAGG + Intergenic
1007784201 6:44270777-44270799 ACCGCCGCCGCCGCCGCCGGCGG - Exonic
1007784203 6:44270780-44270802 GCCACCGCCGCCGCCGCCGCCGG - Exonic
1009702338 6:67200917-67200939 GCAGCAGCAGCAGCCGCCTCAGG - Intergenic
1009905641 6:69867385-69867407 GCAGCCACCGCCGCCGCCGCCGG + Intronic
1010141879 6:72622131-72622153 GAGGCCGCTGCCCCCGCCGCAGG + Exonic
1010141881 6:72622137-72622159 GCTGCCCCCGCCGCAGGCGCTGG + Exonic
1011416222 6:87122656-87122678 GTGGCCGCAGCCGCCGCCTGGGG - Intergenic
1011470334 6:87701848-87701870 GCCGCCGCTGCCTCCGCGGCAGG + Exonic
1011515058 6:88144825-88144847 ACTCCCGCAGCCTCCGCTGCAGG - Exonic
1011640359 6:89411960-89411982 GCTGGGGAAGCCGCAGCCGCAGG - Exonic
1011643057 6:89433159-89433181 CCCGCCGCGTCCGCCGCCGCAGG - Intronic
1012399997 6:98835070-98835092 GCCCCCGCCGCCGCCGCCGTGGG - Exonic
1012400119 6:98835590-98835612 GCCGCCCCCGCCGCCCCCGCAGG + Exonic
1012475914 6:99614302-99614324 GCCTCCGCTGCCGCCGCCCCCGG - Exonic
1012939654 6:105403131-105403153 CTTGCCGCCGCCGCCGCCGCTGG - Intergenic
1013117807 6:107115542-107115564 GCGGCCGCCGCCCCCGCCCCGGG - Intergenic
1013155803 6:107490254-107490276 GCTCCCGCCGCCGCCGCCGCCGG - Exonic
1013155878 6:107490561-107490583 GCTGCTGCCGCCGCCGGCGGTGG - Exonic
1013242710 6:108260928-108260950 GTAGCTGCTGCCGCCGCCGCGGG + Exonic
1013273404 6:108561604-108561626 GCTGCCACCGCCGCAGCCGGGGG + Exonic
1013366229 6:109440515-109440537 GCTGCCGGAGCGGCCGCTGCAGG - Exonic
1013575832 6:111483055-111483077 GCTGCTGCCGCCGCCTCCTCAGG + Exonic
1013575849 6:111483136-111483158 GCCGCCACTGCCGCCACCGCCGG + Exonic
1013793611 6:113860181-113860203 GCTGCGGCCGCCGCCGAGGCGGG + Exonic
1014079132 6:117268234-117268256 GCTGCCGCTGCCACTGCTGCTGG - Exonic
1014137540 6:117907190-117907212 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1014632436 6:123803587-123803609 GCAGCCGCTGCAGCAGCCGCCGG + Intergenic
1014632529 6:123803895-123803917 GCTGCCGCTGCTGCCCCTGCGGG + Intergenic
1015148928 6:130018509-130018531 GCCGCCGCCGCCGCCGCTGCCGG - Exonic
1015251828 6:131135526-131135548 GCCGCTGCTGCCGCTGCCGCGGG + Intergenic
1015497039 6:133892980-133893002 TCTGGCGCATCGGCCGCCGCGGG - Exonic
1016738970 6:147508626-147508648 GCCGCCGACGCTGCCGCCGCGGG - Intergenic
1017164149 6:151391525-151391547 GCTGCTGCTGCCGCCGCGGTCGG + Exonic
1017662430 6:156687455-156687477 GCCGCCGAGGCCGCCGCGGCCGG - Intergenic
1017672044 6:156777942-156777964 GCGGGCGCCGCGGCCGCCGCCGG + Exonic
1017672239 6:156778731-156778753 TCCGCCTCCGCCGCCGCCGCCGG + Exonic
1017672281 6:156778840-156778862 GCCGCCGCCGCCGCCCGCGCCGG - Exonic
1017793625 6:157823034-157823056 GCCGCCGCCGCCGCCGCCCCCGG - Intronic
1018400331 6:163414610-163414632 GCCGCTGCTGCCGCCGCCGCTGG + Intronic
1018400494 6:163415143-163415165 GCCGCCGCCGCCGCCGCCGCCGG - Exonic
1019253770 7:35468-35490 GCTGCTGCCGCCGCCGCCGCCGG + Intergenic
1019279505 7:192862-192884 GCGCTCGCAGCCGCCGGCGCGGG - Intergenic
1019298497 7:291161-291183 CGCGCCGCCGCCGCCGCCGCCGG - Intergenic
1019343660 7:519754-519776 GCCTCCGCCGCAGCCGCCGCCGG + Intronic
1019474247 7:1236432-1236454 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1019485112 7:1285734-1285756 GCTGCCCCTGCGTCCGCCGCTGG - Intergenic
1019539953 7:1547006-1547028 GCTCCCGCCGGAGCCGCCGCTGG + Exonic
1019590175 7:1827036-1827058 GCTCCTGCAGCCGCAGCCGGAGG + Intronic
1019909866 7:4093669-4093691 GCTGTCGCTGTCGACGCCGCCGG - Intronic
1019989560 7:4682263-4682285 GCCGCTGCAGCCGCCGCCGCCGG + Intergenic
1019989562 7:4682266-4682288 GCTGCAGCCGCCGCCGCCGGAGG + Intergenic
1020727336 7:11832140-11832162 GCCGCCGCCGCCGCCGCCTCTGG + Exonic
1021451254 7:20785340-20785362 GCCGCCGCCGCCGCTGCCCCCGG + Exonic
1021452778 7:20798060-20798082 GCTGCGGCGGCCGCGGGCGCGGG + Intergenic
1021827986 7:24573546-24573568 GCCGCCGCTGCCGCCGCTCCCGG - Exonic
1022739726 7:33109417-33109439 GCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1023418298 7:39951393-39951415 GCAGCAGCAGCGGCGGCCGCCGG + Exonic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1023773689 7:43583336-43583358 CCGGCCGCCGCCGCCGCCCCAGG + Exonic
1024082421 7:45866155-45866177 GCTGCCGCTGCCGCTGCCGCTGG + Intergenic
1026732647 7:72925128-72925150 GCTCCAGCCGCCGCAGCCGCCGG - Intronic
1026906037 7:74063318-74063340 GCTGCGGCAGCGGCGGCGGCGGG - Exonic
1027111417 7:75442691-75442713 GCTCCAGCCGCCGCAGCCGCCGG + Intronic
1027283646 7:76627224-76627246 GCTCCAGCCGCCGCAGCCGCCGG + Exonic
1027374541 7:77537199-77537221 GCCGCCGCCGCCGCCGCCTCAGG - Intergenic
1027374583 7:77537374-77537396 GCCGCCGCAGCCGCCGCCTAGGG + Exonic
1027421156 7:78019492-78019514 GCTGCCGCCGCCGCCCGGGCCGG + Exonic
1027421282 7:78019934-78019956 TCTCCCGCTGCCGCCGCCCCAGG - Exonic
1028268564 7:88759234-88759256 GCTGCCGCTGCAGCCGCGGGGGG - Intergenic
1028561265 7:92179013-92179035 GGAGCCGCAGCCGCCGCGGGAGG - Exonic
1028621485 7:92833563-92833585 GTCGCCGCCGCCGCCGCCGCCGG + Exonic
1028621486 7:92833566-92833588 GCCGCCGCCGCCGCCGCCGGAGG + Exonic
1028922341 7:96322038-96322060 GCCCCCACCGCCGCCGCCGCCGG - Exonic
1029276555 7:99408556-99408578 GCCGCCGCCGCCGCAGCCGCCGG - Exonic
1029281561 7:99438949-99438971 GCCGCCGCCGCCGCCGCCCGAGG - Intronic
1029390750 7:100272320-100272342 GCTGCTGCTGCTGCCGCCGCCGG + Intergenic
1029484072 7:100828684-100828706 GCAGCCGCAGCCCCAGCCTCAGG - Intronic
1029495743 7:100894939-100894961 GCTGCCGTGCACGCCGCCGCCGG + Intronic
1029640413 7:101816428-101816450 GCCGCCGCCGTTGCCGCCGCGGG + Intronic
1029640537 7:101816753-101816775 GCCGCCGCCGCCGCCGCCGGTGG - Intronic
1029640538 7:101816756-101816778 CGCGCCGCCGCCGCCGCCGCCGG - Intronic
1030018115 7:105244722-105244744 CCAGGCACAGCCGCCGCCGCGGG + Intronic
1030055880 7:105583281-105583303 GGAGCCGCAGCTGCCGCAGCCGG - Intronic
1031604144 7:123748695-123748717 GCAGCCGCCGCCGCCGCGGAGGG - Exonic
1031604229 7:123749033-123749055 GCGGCCGCCGCCGCCGCTGCGGG - Exonic
1031899309 7:127392377-127392399 GCTGCCGCCGCCACCACCGAAGG + Exonic
1031966578 7:128031733-128031755 GCTGCGGCCGCCGCCGCCGCCGG - Intronic
1032159880 7:129502297-129502319 GCTGCCGGAGCGGCGGGCGCGGG - Intergenic
1032194369 7:129780818-129780840 GCCACCGCTGCCGCCGCCGCCGG + Intergenic
1033186571 7:139231835-139231857 GCAGCCGCCGCGGCCGCCGAGGG + Exonic
1034147255 7:148884210-148884232 CGCGCCGCCGCCGCCGCCGCCGG + Exonic
1034342766 7:150368837-150368859 CCTGCCGCTGTCGCCGCGGCGGG + Exonic
1034418751 7:150978268-150978290 GCTGCCCGAGCCGCGGGCGCTGG - Exonic
1034458738 7:151186561-151186583 GCCGCCTCAGCAGCAGCCGCAGG + Exonic
1034522624 7:151632319-151632341 GAGGCCGCCGCCGCCGCCGCAGG + Intronic
1034522625 7:151632322-151632344 GCCGCCGCCGCCGCCGCAGGTGG + Intronic
1035169537 7:157009944-157009966 GCCGCCGCCGCCGCCGCTGGGGG - Exonic
1035169541 7:157009947-157009969 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1035169608 7:157010207-157010229 GCCGCCGCCGCCGCCACCTCCGG + Exonic
1035581041 8:738993-739015 GACGCCGCCGCCGCCGCCGCCGG + Intergenic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1036482477 8:9151059-9151081 GCCGCCGCAGCCGCAGCTCCCGG + Intronic
1036642160 8:10591447-10591469 GCTGCCGCTGAGGCTGCCGCTGG - Intergenic
1036723697 8:11200976-11200998 GCCGGAGCCGCCGCCGCCGCAGG - Exonic
1036723756 8:11201217-11201239 GCCGCCGCAGCCGCCTCCCCCGG + Exonic
1036789545 8:11708835-11708857 GCAGCCGCCGCCGCCTCCGCCGG + Exonic
1037273726 8:17156504-17156526 GCCGCCGCCTCCGCCTCCGCCGG + Exonic
1037535227 8:19817436-19817458 GCCGCCGCCGCCGCCACCGCGGG - Exonic
1037879425 8:22565754-22565776 GCAGCCGAGGCCGCCGCCTCCGG - Intronic
1037887906 8:22604767-22604789 GCCGCTGCTGCCGCCGCCACCGG - Exonic
1037928847 8:22865548-22865570 GGTGCCGGTGCCGCAGCCGCCGG + Intronic
1037928851 8:22865554-22865576 GGTGCCGCAGCCGCCGGGGAAGG + Intronic
1037935274 8:22911352-22911374 GCTGCTGCAGCCCCCTCCTCTGG + Intronic
1038304030 8:26383276-26383298 GCAGCCCCGGCCGCCGCCACCGG + Intronic
1038535725 8:28351703-28351725 GCTGCTGCTGCTGCTGCCGCAGG - Exonic
1038727615 8:30095462-30095484 GCTGCTGCCGCCGCCGCCTCGGG + Exonic
1038972069 8:32647249-32647271 GCCGCCGCCGCCACCGCCGCTGG + Intronic
1039453883 8:37695805-37695827 GCCGCCGCCGCCACCGCCGCTGG - Exonic
1039921425 8:41896688-41896710 GATGGCGCTGCCGCCGCGGCCGG + Exonic
1039921460 8:41896784-41896806 TTCGCCGCCGCCGCCGCCGCAGG - Intergenic
1040038833 8:42896740-42896762 GCCGCCGCCGCCGCTGCCGCCGG - Intronic
1040415238 8:47189238-47189260 GCTGCTGCGGCGGCCGCGGCCGG - Intergenic
1040951144 8:52939994-52940016 GGCGCCGCTGCCGGCGCCGCTGG + Exonic
1041059500 8:54022274-54022296 GCCGCCGCCGCCGCCGCCGCGGG - Exonic
1041552680 8:59119259-59119281 GCCGCCGCTGCCGCCGCCGCCGG + Intergenic
1041673634 8:60516913-60516935 GCGGCCGCCGGCGCCGCCGGAGG - Exonic
1041673635 8:60516916-60516938 TCTGCGGCCGCCGGCGCCGCCGG - Exonic
1041696461 8:60741927-60741949 ACAGCCGCAGCCACCGCAGCCGG + Exonic
1041910730 8:63086023-63086045 GCGGCCGCAGCAGCGGCGGCGGG - Exonic
1042155691 8:65841973-65841995 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1042532864 8:69833000-69833022 GCCGCCGCCGCCGCCGCCGCTGG + Exonic
1043388245 8:79768285-79768307 GCCGCCGCCGTCGCCGTCGCCGG - Intergenic
1043769714 8:84183304-84183326 GCTGCCGCTGCTGCCGCCACTGG + Intronic
1043847275 8:85177486-85177508 GCCGCCGCCGCAGCCTCCGCAGG + Exonic
1044340438 8:91040851-91040873 GCTGCTGCTGCTGCCGCCTCCGG + Exonic
1045516294 8:102863626-102863648 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1045516298 8:102863629-102863651 GCCGCCGCCGCCGCCGCCGGGGG + Intronic
1045738014 8:105318843-105318865 GCCGCCGCCGCCGCCGCCGCTGG - Exonic
1046654212 8:116874720-116874742 GCTCCCGCCGCCGCCACAGCCGG + Exonic
1046871190 8:119207851-119207873 GCTGCAGCAGCCACTGGCGCGGG - Intronic
1047493075 8:125390229-125390251 GCTGCTGCTGCCGCTGCCACCGG + Intergenic
1047615100 8:126557233-126557255 GGAGCCGCAGCCGCCGCCTCAGG - Exonic
1047961801 8:130016498-130016520 GCTGCTGCTGCCGCCGCGGCGGG - Intronic
1048244141 8:132775396-132775418 GCCGCCGCCGCCTCCGCCGCCGG - Exonic
1048345595 8:133572265-133572287 CGCGCCGCAGCCGCCGCCTCCGG - Intergenic
1048981170 8:139703915-139703937 GCCGCCGCGCCCGCCGCCCCCGG - Intergenic
1049145970 8:141001239-141001261 CGCGCCGCCGCCGCCGCCGCCGG - Intronic
1049194594 8:141308384-141308406 TATGCAGCACCCGCCGCCGCGGG + Intergenic
1049218365 8:141417889-141417911 GCTGCCGCCACCGCCGCCTGCGG - Intronic
1049427594 8:142544309-142544331 GCCGCTGCAGCCGTCGCCGCTGG + Exonic
1049435023 8:142582508-142582530 GCAGCCGCATCCCCCGCCTCTGG - Intergenic
1049587519 8:143438903-143438925 GCTGCTGGAGCGGCCACCGCAGG - Intronic
1049620819 8:143597677-143597699 GCTGCCGGACCCGCCCCCACCGG - Intronic
1049639333 8:143707569-143707591 GCTGACGGCGCCCCCGCCGCAGG - Exonic
1049681182 8:143919075-143919097 GCCGCCGTGGCTGCCGCCGCCGG + Exonic
1049682172 8:143924282-143924304 GCTCCTCCAGCCGCCGCCGCTGG + Exonic
1049788396 8:144462224-144462246 GGGGCTGCAGCCCCCGCCGCGGG - Intronic
1049828614 8:144685814-144685836 GCGTCCTCCGCCGCCGCCGCCGG + Intergenic
1050357006 9:4792975-4792997 GCAGCCCGAGCCGCCGCCGTCGG + Exonic
1051170173 9:14313779-14313801 GCCGAGGCCGCCGCCGCCGCCGG + Intronic
1051170304 9:14314287-14314309 GCAGCCGCCGCCGCCCGCGCCGG + Intronic
1051351048 9:16198159-16198181 GCTGCCGCCGCCGCTGCCCTGGG + Intergenic
1051585059 9:18718633-18718655 GCTGCCGCCGCCGCTCCAGCTGG + Intronic
1051936378 9:22447252-22447274 GCCGCCGCTGCCGCCACCTCGGG + Exonic
1052192790 9:25678178-25678200 CACGCCGCCGCCGCCGCCGCTGG + Exonic
1052295450 9:26892500-26892522 GCTGCCGCCGCTCCCACCGCCGG + Exonic
1052362157 9:27573213-27573235 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1053114608 9:35490118-35490140 GCCGCCGCCGCCGCCGCCGCCGG + Intronic
1053181272 9:35972342-35972364 GAAGCCGCAGCTGCCGCAGCCGG - Intergenic
1054172815 9:61856454-61856476 GCTGCCGCCGCGGCGGCGGCTGG - Intergenic
1054664725 9:67724347-67724369 GCTGCCGCCGCGGCGGCGGCTGG + Intergenic
1054775656 9:69121691-69121713 GCGGCCGCCGCCGCGGCCGGCGG - Intronic
1054781993 9:69174195-69174217 GCTGACGCCGCCGCCGCCGCGGG + Intronic
1054835570 9:69672286-69672308 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1054835654 9:69672553-69672575 GGTGCCGCCGCCGCCGCCGCGGG - Intergenic
1054870294 9:70043059-70043081 GCTGCGGCAGCAGCAGCCTCTGG + Intergenic
1054914213 9:70480831-70480853 GCTGCCGCGGCGGCAGCAGCAGG - Intergenic
1055090997 9:72364836-72364858 GGTGGCGCCGCCGCCGCCGCGGG + Intronic
1055091117 9:72365283-72365305 CCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1055514278 9:77020633-77020655 GCGGCCGCCGCAGCCGCAGCCGG + Exonic
1056143686 9:83708275-83708297 GCAGGCGCAGCCGCGGCCGCAGG - Intergenic
1056186814 9:84143284-84143306 GCTGCAGCAGCCCCTGCCCCTGG + Intergenic
1056773941 9:89498043-89498065 CCAGCCGCCGCTGCCGCCGCCGG - Intronic
1057313375 9:93954986-93955008 GCAGCCGCCGCTGCCGCGGCGGG - Exonic
1057489145 9:95508368-95508390 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1057489190 9:95508557-95508579 GCTGCGGCCGCGGCCGCTGCCGG + Exonic
1057490369 9:95515931-95515953 GCGGGAGCAGCCGCAGCCGCAGG - Intronic
1057758318 9:97853932-97853954 GCCGCCGCCGCCGCAGCCGGAGG + Exonic
1057869698 9:98708632-98708654 GCTGCCGCTGCTGCTGCCTCTGG - Exonic
1057869883 9:98709252-98709274 GCTGGCGCTGCGGCGGCCGCGGG + Intergenic
1058467562 9:105244657-105244679 GTAGCCGCCGTCGCCGCCGCCGG + Exonic
1058467565 9:105244660-105244682 GCCGCCGTCGCCGCCGCCGGGGG + Exonic
1058885942 9:109321021-109321043 GCCGCCGCCGCCGCTGCCGCCGG + Intergenic
1058912580 9:109534356-109534378 GGAGCCGCAGCTGCCGCAGCCGG - Intergenic
1059483711 9:114611526-114611548 GCCGCCGCCGCCGCCACCCCGGG - Exonic
1059633937 9:116154346-116154368 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1059633959 9:116154397-116154419 CCTCCCGCTGCTGCCGCCGCCGG - Exonic
1059769832 9:117414794-117414816 GCTGCCGCCGCCGCCGCTGCTGG - Exonic
1060389890 9:123268525-123268547 GCCGCCGCAGCCGCCGCCGCTGG - Intronic
1060554956 9:124503474-124503496 GCCGCCCCAGCCGCTGTCGCCGG + Intronic
1060700546 9:125746770-125746792 GAAGTCGCCGCCGCCGCCGCCGG - Intergenic
1060713081 9:125889935-125889957 GCAGCCGGGGCCGCCGGCGCGGG - Intronic
1060811700 9:126614138-126614160 GCTGCTGCAGACGGAGCCGCGGG - Intergenic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic
1060832205 9:126723518-126723540 GCTGCCACACACGCGGCCGCCGG + Intergenic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1061541080 9:131278038-131278060 GCCGCCGCCGCCGCCGCCTGCGG - Intergenic
1061559673 9:131394344-131394366 TCTCCCGCGGCCGCCGCCGGGGG + Intronic
1062022595 9:134326513-134326535 GCCGCCGCCACCGCAGCCGCCGG + Intronic
1062212194 9:135371172-135371194 GCTGCCCAGGCCGCCGCCACAGG + Intergenic
1062314800 9:135961345-135961367 GCCGCCGCAGCAGCCGCCGGGGG + Exonic
1062499062 9:136844612-136844634 CCTGCCGGAGCCACCGCCGCCGG + Exonic
1062560407 9:137139195-137139217 GGAGCCGCCGCCGCCGCCGCCGG + Intronic
1062579206 9:137222093-137222115 GCGGCCGCCGCCGGAGCCGCCGG - Intergenic
1062659136 9:137619185-137619207 GCCGCCGCTGCCGCCGCCTCAGG + Intronic
1062746626 9:138217075-138217097 GCTGCTGCTGCCGCCGCTGCCGG - Intergenic
1185464539 X:346631-346653 GTTTCTGCAGCGGCCGCCGCGGG - Intronic
1186496375 X:10015309-10015331 GCCGCCGCCGCCGCCGCTGCCGG - Intergenic
1186496467 X:10015599-10015621 GCTGTCCCCGCCGTCGCCGCCGG - Exonic
1187064822 X:15823133-15823155 GCCGCAGGAGCCGCCGCAGCCGG + Exonic
1187067462 X:15854722-15854744 TTCGCCGCCGCCGCCGCCGCCGG - Exonic
1187281539 X:17861234-17861256 GCTGTCGCCGCCGCCGCTGCTGG + Exonic
1187518154 X:19990952-19990974 GCCGCCGCCGCCGCCGCCGCCGG + Intergenic
1187547312 X:20266715-20266737 GCCGCCGCCGCCGCTGCCGTGGG - Exonic
1187826178 X:23334758-23334780 GCCGCCGTCGCCGCCGCCGCGGG + Exonic
1188835457 X:34948713-34948735 GCTGCTGCAGCAGCTGCTGCTGG + Intergenic
1189137119 X:38561513-38561535 GCCGCCGCCGCCGCCGCCGCCGG + Exonic
1189320141 X:40082900-40082922 GCTGCCTCAGCCTCCCCCGCAGG - Intronic
1189407113 X:40735350-40735372 GCTGCCCCCGCCGCCGCCTCCGG + Exonic
1190008058 X:46758942-46758964 GCTGCTGCTGCCGCTGCTGCTGG - Exonic
1190337462 X:49270769-49270791 GCTGCGGCAGCTGCTGCTGCTGG - Exonic
1190337463 X:49270772-49270794 GCAGCAGCAGCTGCCGCAGCTGG + Exonic
1190542864 X:51496501-51496523 GCCGCTGCCGCTGCCGCCGCCGG + Exonic
1192361754 X:70445113-70445135 ACCACCGCCGCCGCCGCCGCCGG - Exonic
1192925022 X:75747168-75747190 GCCGCCGCCGCCGCCACCTCCGG + Intergenic
1193117144 X:77786143-77786165 GCTACCACTGCCACCGCCGCAGG + Exonic
1193819919 X:86148784-86148806 GTTGCCCCTGCCGCCGCCTCCGG - Exonic
1194325874 X:92515501-92515523 GCTGTAGCCGCCGCCGCCGCGGG + Intronic
1194666821 X:96685068-96685090 GCTCCCGACGCCGCCGCCCCGGG - Exonic
1194977594 X:100409721-100409743 GCCGCCGCCGCCGCCGCCGCGGG + Exonic
1194977596 X:100409724-100409746 GCCGCCGCCGCCGCCGCGGGAGG + Exonic
1195803260 X:108735674-108735696 GCTGCCGCCGCCAGCGCGGCCGG + Exonic
1196031073 X:111096310-111096332 GCGGCCGCAGCCGCAGCCCCGGG - Intronic
1196214623 X:113035928-113035950 GCTGCTGCTGCCGCCACTGCTGG + Intergenic
1196684023 X:118495703-118495725 GCTGCCGCCGCCGACGCCGTGGG + Intergenic
1196684067 X:118495881-118495903 GCAGCGGCCGCGGCCGCCGCGGG + Intronic
1196871244 X:120115604-120115626 GCAGCCGCAGCCCCCGCCGGAGG - Exonic
1197754469 X:129984227-129984249 GCCGCCGCCGCCGCCGCTTCTGG + Intronic
1197962868 X:132024092-132024114 GCCGCCGCCGCCGCCACCCCTGG - Intergenic
1198158511 X:133985356-133985378 GCAGCCCCCGCCGCCGCCGCCGG - Exonic
1198263473 X:134987623-134987645 GCTGTCACAGCCACCGCCCCTGG + Intergenic
1198276332 X:135098371-135098393 TCCGCGGCCGCCGCCGCCGCCGG + Intergenic
1198310177 X:135422372-135422394 GCCTTCGCCGCCGCCGCCGCCGG - Intergenic
1198312312 X:135435002-135435024 CCTGCCGCAGCCGGCCCTGCAGG - Intergenic
1198807156 X:140504015-140504037 GCAGCCGCGGCCGCCGCCTACGG - Exonic
1198807171 X:140504066-140504088 GCCGCGGCCGCCGCCGCCTCGGG - Exonic
1199136591 X:144261049-144261071 GCCGCCGTCGCCGTCGCCGCCGG + Intergenic
1199500389 X:148500732-148500754 CCCGCCGCCGCTGCCGCCGCCGG + Exonic
1199500410 X:148500793-148500815 GCTGCGGCGGCAGCCGCTGCGGG - Exonic
1199736866 X:150693540-150693562 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1199772739 X:150984398-150984420 GCTGTCGCCGCCGCCCGCGCCGG + Intronic
1200092948 X:153644279-153644301 GCCCCCGCACCCGCCCCCGCCGG - Intronic
1200100650 X:153687984-153688006 GCGGCTGCAGCCGCCGCCGCCGG + Intronic
1200155580 X:153972934-153972956 GCCGCCGCCGCCGCCGCGCCCGG - Intronic
1200231028 X:154443988-154444010 CCCGCCCCAGCCCCCGCCGCCGG - Intergenic
1200292661 X:154887037-154887059 ACTGCCGCCGCCCCCGCCGCCGG + Exonic
1200339505 X:155382777-155382799 ACTGCCGCCGCCCCCGCCGCCGG + Exonic
1200346965 X:155457916-155457938 ACTGCCGCCGCCCCCGCCGCCGG - Exonic
1200634596 Y:5634659-5634681 GCTGTAGCCGCCGCCGCCGCGGG + Intronic