ID: 1097233117

View in Genome Browser
Species Human (GRCh38)
Location 12:57523853-57523875
Sequence CTTTCCAAGCCCAGTCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097233117_1097233122 21 Left 1097233117 12:57523853-57523875 CCCTAGGGACTGGGCTTGGAAAG 0: 1
1: 0
2: 0
3: 17
4: 168
Right 1097233122 12:57523897-57523919 CAGATCCCCGAGATCTTTATAGG 0: 1
1: 0
2: 1
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097233117 Original CRISPR CTTTCCAAGCCCAGTCCCTA GGG (reversed) Intronic
900476562 1:2878957-2878979 CTGTCCAAGCCAAGCCACTATGG - Intergenic
901441250 1:9279867-9279889 CTCCCCAAGGCCAGACCCTAAGG + Intergenic
903810039 1:26030060-26030082 CTTTCCCACTCCAGTCCCCATGG - Intronic
903918267 1:26780238-26780260 GTTTCCAAGACCAGTCTCTGCGG - Exonic
906566462 1:46804573-46804595 CTGTCCAAGACCAGTCCATCTGG - Intronic
907774100 1:57496187-57496209 CTTTGAAAGCCCAGTCCCAAGGG - Intronic
909023156 1:70454379-70454401 CTTTCTGAACCCAGTCCCCATGG + Intergenic
909098368 1:71318604-71318626 CTTTCTACTCCCAATCCCTATGG - Intergenic
909363036 1:74787478-74787500 GTTGCCAATCCCTGTCCCTAGGG + Intergenic
909615798 1:77606559-77606581 CTAACCAAGCCCAGTCCCAGTGG + Intronic
909773368 1:79454559-79454581 CTTTCCAAGCCTAGACTCCAGGG + Intergenic
909828264 1:80153689-80153711 CTCAGGAAGCCCAGTCCCTAGGG - Intergenic
911249512 1:95559035-95559057 GTTTCAAAGCCCTTTCCCTATGG + Intergenic
911432699 1:97812209-97812231 CTTTCAAAGCTTAGTGCCTAGGG - Intronic
913671885 1:121104894-121104916 CTCTCCAAGCCCTGTCCTTTTGG + Intergenic
914662136 1:149800284-149800306 CTCTCCAAGCCCTGTCCTTTTGG + Intronic
914829402 1:151159641-151159663 CTGTCCAAGCTCTGTCTCTAAGG - Exonic
915324911 1:155076726-155076748 CTTTGCAGGCTCAGTCCCTAGGG - Intergenic
915523248 1:156460802-156460824 TTTTCCAGGCTTAGTCCCTATGG - Intergenic
915826337 1:159081826-159081848 CCTTCCCAGCCAAGTCCCTGGGG + Intronic
916027664 1:160848719-160848741 CTCTCCAAGCCCAGTCCTCTTGG - Intronic
916127270 1:161582367-161582389 CTCTCCAAGCTCAGTTCCTGGGG + Intronic
916137189 1:161664171-161664193 CTCTCCAAGCTCAGTTCCTGGGG + Intronic
917432681 1:174987120-174987142 CATTCCAGGCCAAATCCCTAGGG - Intronic
917983094 1:180285433-180285455 ATTTCAAATCCCAGTTCCTAAGG - Intronic
918211883 1:182358420-182358442 CTAGCCAAGCCCAGGCCCAAAGG - Intergenic
920170002 1:204065963-204065985 CTTCCCAAGCTCATTCCCTGTGG + Intergenic
920366510 1:205450773-205450795 CATCCCCAGCCCAGTCCCTCTGG - Intronic
923987767 1:239401046-239401068 CTTTTCAAGCCTAGACCCTTGGG - Intronic
1062880070 10:971044-971066 CGTTTCATGCCCAGTCCCTCTGG + Intergenic
1063825692 10:9895553-9895575 CCTTCCATGCCCAGTCCCTGTGG + Intergenic
1067064146 10:43094203-43094225 CTTTCCACCCCCAGCCCCCAGGG + Intronic
1072190901 10:93075354-93075376 CTTTCCAAGCGCTGTTCCTGGGG + Intronic
1073630233 10:105141045-105141067 CTTTCCAAGCCATCTCCCTGAGG + Intronic
1075545223 10:123350201-123350223 CTTTCCCATCCCAGGCACTATGG + Intergenic
1075941210 10:126391763-126391785 CTCTCCAAGCACAGTTCCCAAGG + Intergenic
1076715924 10:132363680-132363702 CCTTCCAAGCTCAGGCCCCACGG - Intronic
1077535910 11:3123948-3123970 CTTTCTAACCTCAGTGCCTAAGG - Intronic
1078180532 11:9006323-9006345 CTGTCCCAGCCCAAGCCCTAGGG - Intergenic
1078540170 11:12206823-12206845 CTTTCCAATTCCAATCCCTCTGG + Intronic
1079494217 11:21022931-21022953 CTTTCCTATCACAGCCCCTAGGG - Intronic
1080625560 11:34027753-34027775 CTTTCCAAAACCAGTCCTTTTGG + Intergenic
1083257111 11:61503301-61503323 CTTTCCCATCCCAGGCCCCAGGG - Intergenic
1083707195 11:64524772-64524794 CTCTCCAAACCCAGTCCTTTTGG - Intergenic
1084178928 11:67437155-67437177 CGTTCCACTCCCAGTCCCTGAGG + Intronic
1084725253 11:70937549-70937571 CTTGCCAAGGCCAGGCCCTCTGG - Intronic
1085452673 11:76644851-76644873 CTCTCCAAACCCAGTCCTTTCGG - Intergenic
1085776608 11:79372195-79372217 TTTTCCAATCCCAGTCTCAAAGG + Intronic
1087155473 11:94897494-94897516 ATTTCCAAGTCCAGATCCTAGGG - Intergenic
1088754716 11:112876322-112876344 CTTTCCAAGCCCAGCATCAACGG + Intergenic
1089428423 11:118400622-118400644 TTTTTCAAGCCCAGTCTCAATGG + Intronic
1090921233 11:131207561-131207583 CTTTCCAACTTCAGTCCCTCTGG - Intergenic
1093635282 12:21459290-21459312 CTCTCCAAACCCAGTCCTTTTGG - Intronic
1095389343 12:41687279-41687301 TTTTTCAAACCCAGTCCCTTTGG + Intergenic
1097233117 12:57523853-57523875 CTTTCCAAGCCCAGTCCCTAGGG - Intronic
1108306004 13:49133594-49133616 CTTTCCATGCACAATCCATATGG + Intronic
1108832762 13:54499980-54500002 CTGTGCAAGGCCAGTCCCCATGG + Intergenic
1112908951 13:104458575-104458597 ATTTCCAAGCCCAGTAGCTGGGG - Intergenic
1113031530 13:105998422-105998444 CTTCTCAAACCCAGTCCCAAAGG + Intergenic
1113736317 13:112680920-112680942 CATTCCCAGCCCGGTCCCTGCGG - Intronic
1114616157 14:24069462-24069484 CTATCCACCCCCAGTCCCCAGGG + Exonic
1114814514 14:25941696-25941718 CTTTCAAAGAACAGTGCCTAGGG - Intergenic
1117075346 14:52097343-52097365 CTTTCCAAGCCCTGTCTCAAGGG + Intergenic
1117809622 14:59532803-59532825 CTTTCCCAGTCCAGGCCATAGGG - Intronic
1119572540 14:75688311-75688333 CTCTCCAAACCCAGTCCTTTTGG - Intronic
1119724477 14:76913832-76913854 CTTTACTTCCCCAGTCCCTAGGG - Intergenic
1121453125 14:94022098-94022120 CTTTCAAAACCCAGGCCCTGCGG + Intergenic
1122275549 14:100589108-100589130 CCTTCCCTCCCCAGTCCCTAAGG + Intergenic
1122542323 14:102505339-102505361 CTTTCCAAGCCCAATTCTTGGGG - Exonic
1127119456 15:55758549-55758571 CTTCTCAGGCCCAGTCCCAAGGG + Intergenic
1128216036 15:65934764-65934786 CTTTCCAAACCCTGTCCTTTGGG - Intronic
1129443287 15:75598233-75598255 CTTTCCAAACCCAGTCCAGCTGG - Exonic
1130116891 15:81013303-81013325 CTTTCCAATGACAGTTCCTATGG + Intronic
1130719690 15:86374513-86374535 CTTTCCCATCCCAGTCCCTCTGG + Intronic
1132138440 15:99367772-99367794 CTCTCCAAACCCAGTCCTTTGGG + Intronic
1132665808 16:1080854-1080876 CTCTCCAAGCCCTGACCCTCAGG - Intergenic
1132710217 16:1263078-1263100 CCGTCCTAGCCCAGTCCCTGAGG + Intergenic
1133820565 16:9232526-9232548 ATTTCCAAGCCCGTTCCCAAGGG - Intergenic
1134441773 16:14302843-14302865 ATTTCCAAGCCCAGGCACTAGGG - Intergenic
1137927578 16:52555250-52555272 CTTTGCCAGACCAGTCCCTCCGG - Intergenic
1140588060 16:76318093-76318115 CATTCCAGGCCCTGTACCTATGG + Intronic
1141034907 16:80618496-80618518 CTTTGCACGCCCAGTCTCTCTGG - Intronic
1141232558 16:82183096-82183118 TTTTCTCAACCCAGTCCCTATGG - Intergenic
1141808206 16:86356141-86356163 GGTTCCAAGCCCAGGCCTTAAGG - Intergenic
1142596032 17:1030487-1030509 CTCTGCTAGCCCAGTCCCCAGGG + Intronic
1142804143 17:2362692-2362714 CTCACGAAGCCCAGTCCCTAAGG + Intronic
1144768305 17:17745056-17745078 CTTTACAGGCCCACTCCCCATGG - Intronic
1147156535 17:38546979-38547001 CTCCCCAAGCACAGTCCCCAGGG + Intronic
1149164624 17:53736461-53736483 CTTTTCAAACCCAGTTTCTATGG + Intergenic
1149895077 17:60422681-60422703 CTTTCCAAAACCAGCCCCTCCGG - Intronic
1151822993 17:76507106-76507128 CTTTCAAAGTCCATTCCCAAGGG - Intergenic
1152937022 17:83145105-83145127 CATGCCAAGCCTAGTCCCCAGGG + Intergenic
1153551111 18:6262592-6262614 ATTTCCAGGCCCAGCCCCTGAGG + Intronic
1154235741 18:12603933-12603955 CTCCCCAAACCCAGTCCCTTTGG - Intronic
1157289017 18:46396954-46396976 CTTTGCAAGCCCAATCGCTCTGG + Intronic
1157768206 18:50319471-50319493 CTCTCCAAACCCAGTCCTTTTGG - Intergenic
1157990772 18:52493088-52493110 CTTTCCTTGGCCATTCCCTATGG - Intronic
1158151716 18:54381465-54381487 CTTGCCAAGACCAGTCACTCTGG - Exonic
1160682056 19:416460-416482 CTCTCCAAGTCCAGGCCCTTAGG + Intergenic
1162460214 19:10810285-10810307 CCTTCTAAGCCCAGTCCCATTGG + Intronic
1164574930 19:29400532-29400554 CTTCCCCAGGCCAGACCCTACGG + Intergenic
1164929767 19:32166430-32166452 ATTTCCAACTCCAGTCCCGAGGG + Intergenic
1166685324 19:44793179-44793201 CTTTCCAGGCTCAGACCCTCAGG - Intronic
926106848 2:10157828-10157850 CTTTACAAGTTCAGTTCCTATGG - Intronic
930816884 2:55607627-55607649 CTCTCCAAACCCAGTCCTAATGG + Intronic
933167478 2:79092347-79092369 CTTCTCAGGCCCAGTCCCAAGGG - Intergenic
934025507 2:87998818-87998840 CTCTCCAAGCCCTGTCCTTTTGG - Intergenic
939588441 2:144033533-144033555 CTTTCCAAACCCTGTCCTTTTGG + Intronic
939744975 2:145957369-145957391 CTTAGCAAGCCCTGTCCCTAGGG - Intergenic
940890454 2:159030822-159030844 GGTTCCAAGCCCAGTGCCTCCGG - Intronic
1171523837 20:25794766-25794788 CTGCCCCAGCCCAGTCCCTTTGG + Intronic
1171552990 20:26061117-26061139 CTGCCCCAGCCCAGTCCCTTTGG - Intergenic
1175611283 20:60353251-60353273 CTCTCCAAGCCAAGGTCCTATGG - Intergenic
1177193765 21:17880811-17880833 CTTTCCATGCCCAGTCACTGGGG - Intergenic
1178003403 21:28190126-28190148 ATTTCCAAATACAGTCCCTATGG + Intergenic
1178518613 21:33268496-33268518 CTTTCACAGCTCAGTACCTAAGG + Exonic
1181648717 22:24247391-24247413 CCTTCCAAACCCACTCCCTCTGG + Intergenic
1182366395 22:29782253-29782275 CTCTCCCAGCCCGGTCCCTGTGG + Intergenic
1182443518 22:30377399-30377421 CTTTCCCATCCCTGTCCCTTGGG + Intronic
1182768834 22:32778974-32778996 CGTTCTAACCCCAGTGCCTAAGG - Intronic
1185026681 22:48418010-48418032 CTTTGTAAGCCCAGTCACCATGG - Intergenic
954263161 3:49454657-49454679 CTTTCCTAGCCCAACCCCTCAGG + Intergenic
954316738 3:49805632-49805654 CTTTCACAGCCCACTCCCAAGGG - Intronic
956082086 3:65568045-65568067 CTTTCAAAGCACAGTCCTAAGGG + Intronic
962406424 3:135104309-135104331 CTTTCCCAGCCCACTCATTACGG - Intronic
963986075 3:151596611-151596633 CTTTCTATTCCCAATCCCTAAGG + Intergenic
967895135 3:194389327-194389349 CTTTCCAAGTCCAGGCTCTGGGG - Intergenic
969650136 4:8461481-8461503 CTGTGTAAGCCCAGACCCTAGGG + Intronic
970414238 4:15840693-15840715 CCTTCCAAGCCGAGTCCAGAAGG + Intronic
970478348 4:16448460-16448482 ATTTCCAAGGTCAGTCCCTGCGG + Intergenic
970769896 4:19599206-19599228 TTTTCTAATCTCAGTCCCTATGG - Intergenic
978397216 4:108294260-108294282 CTTTGCAACCCCATTCCCAACGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
987788902 5:22538088-22538110 CCTTCCAACATCAGTCCCTAAGG - Intronic
988680867 5:33482487-33482509 CATTGCAAGCACAGTCCTTAAGG + Intergenic
988955106 5:36308108-36308130 TTCTCCAAGCCCAGTCTCTCTGG - Intergenic
989757777 5:44976171-44976193 ATTTCCAAATCCAGTCTCTATGG - Intergenic
991544378 5:67765279-67765301 CTTACCAAGGCCAGTCCATCTGG + Intergenic
994639331 5:102386611-102386633 AGTTCCCAGCCCAGTGCCTAGGG + Intronic
998608888 5:143666138-143666160 CTTTCCTAGCCCGGTCCCACTGG - Intergenic
999127197 5:149254431-149254453 CTCTCCCAGCCCAGACCCTGTGG - Intronic
1001985336 5:176069826-176069848 CTCTCCAAGCCCAGTCACTTTGG - Intronic
1002231534 5:177768293-177768315 CTCTCCAAGCCCAGTCACTTTGG + Intronic
1002263807 5:178015455-178015477 CTCTCCAAGCCCAGTCACTTTGG - Intronic
1003183314 6:3810250-3810272 CATTCAAAGCCCAGGCCCTTGGG + Intergenic
1004931125 6:20464135-20464157 CTCTCCAAACCCAGTCCTTCGGG + Intronic
1007896824 6:45370930-45370952 CTTTGCAAAAACAGTCCCTAAGG + Intronic
1011155433 6:84325046-84325068 CTTTCCTAGCCCTTCCCCTAAGG + Intergenic
1015697433 6:135997011-135997033 CTTTAATAGCCCAGTCCCGATGG + Intronic
1017891843 6:158645164-158645186 CATGCCAATCCCAGTCCCCAAGG - Intergenic
1018245358 6:161817365-161817387 TTTCCCATGCCCAGTCCCCAGGG + Intronic
1019559600 7:1649368-1649390 CTTTCCAAGCACCGGCCCTAAGG - Intergenic
1019626365 7:2017909-2017931 CTTCCCAAGCCCAGGCCCAAGGG - Intronic
1020223222 7:6257914-6257936 ATTTCCAAGCCCACACCCTGAGG - Intronic
1021115158 7:16739019-16739041 CTTTCCAAACCCTGTCCTTTTGG - Intergenic
1023908249 7:44536979-44537001 CTGGCCCTGCCCAGTCCCTATGG + Intronic
1024011570 7:45271337-45271359 CTATCCCACCCCAGTTCCTATGG - Intergenic
1028254164 7:88571671-88571693 TTTTAAAAGCCCAGTCCCTATGG + Intergenic
1029597392 7:101545131-101545153 CCTTCCCAGCCCAGTCCAGAGGG - Intronic
1031033712 7:116764586-116764608 CCTTCCAAGCACAGTCTTTATGG + Intronic
1032159263 7:129498236-129498258 CTTGCCAAGCCCTGTCTCTCTGG - Intergenic
1033229092 7:139582815-139582837 CTTTTCCAGCCCAGTGCCTCAGG - Intronic
1034138678 7:148796465-148796487 CTTTCCTAACTCAGTCCATAAGG - Intronic
1034939312 7:155220222-155220244 CGCTCCAAGCCCAGTCCCCCAGG + Intergenic
1037695208 8:21217498-21217520 CTCTCCAAACCCAGTCTCTCGGG + Intergenic
1037877540 8:22555268-22555290 CCTTCCATCCCCAGTCCCTGTGG - Intronic
1038491491 8:27975187-27975209 CTCTCCAAACCCAGTCCTTTTGG - Intronic
1038865185 8:31431832-31431854 CTTTGCAAGCCCAGACCTAATGG - Intergenic
1049357930 8:142197946-142197968 CTTCCCGAGCCCAGTGCCTGTGG - Intergenic
1050422768 9:5484113-5484135 CATTCAGAGCCCATTCCCTATGG - Intergenic
1055615582 9:78068740-78068762 CTTTCTAAGAAAAGTCCCTATGG - Intergenic
1058124267 9:101173509-101173531 CTTCCCAAGCCCAGAGTCTACGG - Intronic
1058923375 9:109639482-109639504 CCTTTCAACCCCAGTCCCTCAGG + Intergenic
1059367190 9:113795421-113795443 CATTCCACACCCAGTCCCTCAGG - Intergenic
1187390574 X:18884081-18884103 CTTTGCAACCCCAGGCCCTTGGG + Intergenic
1189198077 X:39168337-39168359 CTTTCCAAGTCCAGTCACCAGGG - Intergenic
1189949537 X:46214439-46214461 CTTCCCAAACCCAGTCCTTTGGG - Intergenic
1190396873 X:49993904-49993926 CTCTCCAAGGCCATTCCCTGTGG - Intronic
1190869509 X:54413438-54413460 CTTTCCAAGCCAAGTGCCATGGG - Intergenic
1192840537 X:74850335-74850357 CTTTCCAAGCCCACTGCCCAGGG + Intronic
1197858835 X:130948379-130948401 CTCTCCAAGCCCTGTGCCCATGG + Intergenic
1199685155 X:150258903-150258925 CTTTGCAGGCCCAATCCCAAAGG + Intergenic
1200714499 Y:6521796-6521818 TTTCCCAAGGCCAGTCCTTAGGG + Intergenic
1200850759 Y:7880807-7880829 CTTTCTAAGCCCAGCCCAAAAGG - Intergenic
1201019325 Y:9639361-9639383 TTTCCCAAGGCCAGTCCTTAGGG - Intergenic
1201943322 Y:19483063-19483085 CTTTCCTTACCCAGTACCTAAGG - Intergenic