ID: 1097240035

View in Genome Browser
Species Human (GRCh38)
Location 12:57568866-57568888
Sequence CTCAGTCCACGGAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097240035_1097240041 -7 Left 1097240035 12:57568866-57568888 CCTTCCTTCCTCCGTGGACTGAG 0: 1
1: 0
2: 1
3: 25
4: 257
Right 1097240041 12:57568882-57568904 GACTGAGCCCTGGAACGAGGTGG 0: 1
1: 0
2: 3
3: 11
4: 161
1097240035_1097240040 -10 Left 1097240035 12:57568866-57568888 CCTTCCTTCCTCCGTGGACTGAG 0: 1
1: 0
2: 1
3: 25
4: 257
Right 1097240040 12:57568879-57568901 GTGGACTGAGCCCTGGAACGAGG 0: 1
1: 0
2: 0
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097240035 Original CRISPR CTCAGTCCACGGAGGAAGGA AGG (reversed) Intronic
900471326 1:2856417-2856439 CAGAGTCCAGGAAGGAAGGAAGG - Intergenic
901237743 1:7676498-7676520 CAGAGTCCTCGGAGGAAAGATGG + Intronic
901319939 1:8333733-8333755 CTCACTCCAAGGAGGAAACAGGG - Intronic
901742816 1:11353344-11353366 CTCTGCCCACTGAGGAAGGAAGG - Intergenic
902089670 1:13893190-13893212 CTCAGTCCAGGGAGGCAGGCAGG - Intergenic
902640053 1:17761370-17761392 CTCAGTCCCCGGAGGTAGGAGGG - Intronic
903740716 1:25556949-25556971 CCCAGGCCAGGCAGGAAGGAAGG - Intronic
905233320 1:36529193-36529215 CTCTGTCCTCTGAGGAAGGGGGG + Intergenic
906054490 1:42904585-42904607 CTCCCTCCAGGGAGGTAGGAGGG - Intergenic
907645715 1:56241166-56241188 CTCAGGGGACGGAGGCAGGAGGG + Intergenic
908910905 1:69071691-69071713 CCCAGCCCAGTGAGGAAGGATGG + Intergenic
912607573 1:111008138-111008160 CCCTGTCCAGTGAGGAAGGATGG - Intergenic
913186486 1:116373956-116373978 CTCAGGGCACGGAGGGCGGAGGG - Exonic
916610939 1:166390873-166390895 CTCAGACCTCAGAGAAAGGAAGG + Intergenic
917024861 1:170631084-170631106 CCCCGCCCACTGAGGAAGGATGG + Intergenic
918215451 1:182389710-182389732 CCTGGTCCACGGAGGGAGGAGGG - Intronic
919849570 1:201663569-201663591 CTCAGCCCTGGGAGGAAGCATGG - Intronic
919919529 1:202160002-202160024 CTCTGTCCAGGGAGGTAGGCTGG + Intronic
920243261 1:204569301-204569323 ATCACTCCACAGGGGAAGGAGGG - Intergenic
924814104 1:247427514-247427536 ATCTGTCCTCAGAGGAAGGAAGG - Intronic
924814132 1:247427660-247427682 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814146 1:247427733-247427755 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814158 1:247427806-247427828 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814185 1:247427952-247427974 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814199 1:247428025-247428047 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
1062939102 10:1408758-1408780 CTCAGTCCACAGAGGCTGGGAGG - Intronic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1070312263 10:75282348-75282370 TTCAGTCCAGGGAGGGAAGAGGG - Intergenic
1070650848 10:78235151-78235173 CTCAGTCCAGTGGGGAAGGCAGG - Intergenic
1070979675 10:80634149-80634171 CACAGTCCAGGGTGGCAGGAAGG - Intronic
1071134560 10:82438274-82438296 CCCAGCCCACTGAGGAAGGATGG + Intronic
1071169175 10:82843346-82843368 ATCAGTCCATGATGGAAGGAAGG - Intronic
1073667093 10:105545788-105545810 GTCAGTGAATGGAGGAAGGAAGG + Intergenic
1074003363 10:109393881-109393903 CCCTGCCCACTGAGGAAGGATGG - Intergenic
1075045143 10:119140629-119140651 GGCATTACACGGAGGAAGGATGG + Intergenic
1076430657 10:130399621-130399643 CTCAGTGCACAGTGAAAGGAAGG - Intergenic
1077544662 11:3164277-3164299 CTCAGCCCAAGGATGAGGGAGGG + Intronic
1077544673 11:3164306-3164328 CTCAGCCCAGGGACGAGGGAGGG + Intronic
1077555571 11:3224447-3224469 CTCCGACCTGGGAGGAAGGAGGG - Intergenic
1083541608 11:63515484-63515506 CTCAGCCCCCAGGGGAAGGATGG - Intronic
1085019773 11:73198600-73198622 CTCAGACCAGGAAGAAAGGATGG - Intergenic
1087680017 11:101210041-101210063 CACAGTCCATGAAGGAGGGAGGG - Intergenic
1088481062 11:110296684-110296706 CTCAGTCCGCGGCGCGAGGACGG - Exonic
1089158103 11:116417321-116417343 CTCATGCCATGCAGGAAGGAAGG - Intergenic
1089327005 11:117664140-117664162 CTCAGTCCAGAGAGGAATGGTGG + Intronic
1090061303 11:123466267-123466289 CTCTGTCAAGGAAGGAAGGAAGG + Intergenic
1091996541 12:4998192-4998214 CTCAGTCCCCTGAGGAAGGGTGG - Intergenic
1093069423 12:14693157-14693179 CTCATTCCTGGGAGGATGGATGG + Intronic
1093886642 12:24468937-24468959 CACAGACCAGGGTGGAAGGATGG + Intergenic
1093900876 12:24630655-24630677 CTCAGCCCAGAGGGGAAGGAGGG + Intergenic
1096590727 12:52657564-52657586 CTCAGTCCACAGGGGAGGAAAGG - Intergenic
1096654464 12:53079726-53079748 TTCAGTCCAGCGCGGAAGGAGGG - Intergenic
1096757514 12:53812562-53812584 CTCTGTCAAAGAAGGAAGGAAGG - Intergenic
1097240035 12:57568866-57568888 CTCAGTCCACGGAGGAAGGAAGG - Intronic
1098695444 12:73548123-73548145 CTCAGTCCAGAGAGAAAGGAAGG + Intergenic
1101717106 12:107320554-107320576 CGCAGTGCACGGGGGAAGGAGGG + Intronic
1101883344 12:108640916-108640938 CTCTGTCCACGCAGAAATGATGG + Intergenic
1102188528 12:110968233-110968255 CTCATTCCAGGGAGGAAAAAGGG + Intergenic
1102724680 12:115050696-115050718 CACACTCCAAGAAGGAAGGAGGG - Intergenic
1102742550 12:115221243-115221265 TTCAGCCCTTGGAGGAAGGAGGG - Intergenic
1102900220 12:116630859-116630881 CAGGGTCCAGGGAGGAAGGAGGG + Intergenic
1102915632 12:116750032-116750054 CCGCGTCCAGGGAGGAAGGAGGG + Exonic
1106558142 13:30827654-30827676 CCCAGTCCACCCAGCAAGGATGG + Intergenic
1106890113 13:34235955-34235977 CCCAGTCCACTGAGGAGGAATGG + Intergenic
1108160410 13:47632736-47632758 CCCAGCCCAATGAGGAAGGATGG - Intergenic
1109710503 13:66152660-66152682 CTTGGTCCAGGAAGGAAGGAAGG + Intergenic
1112435787 13:99390393-99390415 CTCCTGCCACTGAGGAAGGATGG + Intergenic
1113579715 13:111420458-111420480 CACAGTACACGGAGGACAGAGGG - Intergenic
1114705980 14:24726928-24726950 CCCAGCCCACTGAGGAAGGATGG - Intergenic
1116560914 14:46377327-46377349 CCCTGCCCATGGAGGAAGGATGG + Intergenic
1117846005 14:59912641-59912663 CACAGACCACGGAGGGAAGAAGG - Intergenic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1119644900 14:76341130-76341152 CTCAGTCCATGAAGACAGGAAGG - Intronic
1119667620 14:76496552-76496574 GTCAGTACAGGGAGGCAGGAAGG + Intronic
1119726906 14:76926952-76926974 CTCAGGCAGCTGAGGAAGGAAGG - Intergenic
1122977904 14:105178491-105178513 CTCAGTGAACGGAGGAGGCAGGG + Intronic
1123045453 14:105511056-105511078 CTCAGTAGACGGAGAATGGAAGG - Intergenic
1202941501 14_KI270725v1_random:152117-152139 CTGAGTCACCGGAGGAACGATGG + Intergenic
1123944119 15:25230754-25230776 CTCAGTCCAGGGCGCCAGGAAGG - Intergenic
1124120652 15:26885717-26885739 ATCAGTCCATGGAAAAAGGAAGG + Intronic
1124956396 15:34363307-34363329 CTCAGTCCTCAGATGAAGAAGGG + Intronic
1125476487 15:40051167-40051189 CACAGCCAACAGAGGAAGGAGGG + Intergenic
1125672893 15:41486398-41486420 CCCAGTCCACGCAGCAAGGGAGG + Intergenic
1125726142 15:41869138-41869160 CTCATTGCATGGAGGAAGGAAGG + Intronic
1126335025 15:47577618-47577640 CACAGTCCAGGGAGGATGGTGGG + Intronic
1126917673 15:53483987-53484009 TTCAGCCCGAGGAGGAAGGATGG + Intergenic
1127687697 15:61364841-61364863 CTCACCCCAGTGAGGAAGGATGG + Intergenic
1127842739 15:62845046-62845068 CCCAGTCCAAACAGGAAGGAGGG - Intergenic
1127877726 15:63125079-63125101 GGGAGTCCAGGGAGGAAGGATGG + Intronic
1128511092 15:68314251-68314273 CTGTGCCCACGGAGGAGGGATGG + Intronic
1129171341 15:73810018-73810040 CTCAGGAGAGGGAGGAAGGAAGG + Intergenic
1130552028 15:84895382-84895404 CCCAGGCCATGGAGCAAGGAGGG + Intronic
1131079340 15:89521750-89521772 CTAATTGCAGGGAGGAAGGAGGG - Intergenic
1132569625 16:638440-638462 CACAGGCCAGGGAGGCAGGACGG - Intronic
1133461248 16:5988499-5988521 CTAAGTTCCCAGAGGAAGGAGGG + Intergenic
1133748976 16:8709909-8709931 CTCAGGCGGCGGAGGGAGGATGG - Intronic
1135170115 16:20176490-20176512 CTCTGTCCACCTTGGAAGGATGG - Intergenic
1137408534 16:48208663-48208685 CTCAGTCCCTGGAGGCAGGTGGG + Intronic
1138413269 16:56856160-56856182 CCCAGTCCAGGGAGTGAGGAAGG - Intergenic
1141260730 16:82451447-82451469 CACAGTTCAGGGAGGTAGGAGGG + Intergenic
1142130700 16:88430402-88430424 CTGAGGCCCCGGAGGAACGACGG + Exonic
1142132057 16:88435658-88435680 CTGTGTCCAGGGAGGATGGATGG + Exonic
1142852370 17:2710513-2710535 GACAGTCGACGGAGGAGGGAGGG + Intronic
1143146943 17:4782688-4782710 CCCAGTCCACGGGGGAAGGGCGG - Intronic
1144117052 17:12105991-12106013 CACAGTCCACTGAGGATGGTGGG + Intronic
1145242672 17:21248907-21248929 CTCAGGCCCAGGAGGGAGGAGGG - Intronic
1145266660 17:21382979-21383001 CACAGTTCCCGGAGGAAGGCTGG + Intronic
1145279674 17:21458173-21458195 CTCAGGGCAGGGAAGAAGGAGGG + Intergenic
1145925432 17:28643503-28643525 CACAATCCAAGGAGGAAGGGAGG - Intronic
1148018449 17:44538708-44538730 CTCAGTCCACAGGGAAAGGAAGG + Intergenic
1148292820 17:46471073-46471095 CTCAGTCAACGAAGAAAGGAGGG + Intergenic
1148315005 17:46688770-46688792 CTCAGTCAACGAAGAAAGGAGGG + Intronic
1148638277 17:49165707-49165729 CTTTGTCCTTGGAGGAAGGAAGG - Intronic
1149736711 17:59001708-59001730 CTCATTCCTGGCAGGAAGGAAGG + Exonic
1151214355 17:72567667-72567689 CTCAGTCGAAGGAGACAGGAAGG - Intergenic
1152435859 17:80275568-80275590 CTCAGTGCAGGCTGGAAGGAAGG + Intronic
1152520959 17:80856625-80856647 CTGAGTCATCGGAGGAAGGCTGG + Intronic
1152812621 17:82389120-82389142 CTCTGTCCACGCAGGTAGCAGGG + Intergenic
1153678900 18:7481281-7481303 TTCAGTCCATGGTGGAAGGAGGG + Intergenic
1155876980 18:31101146-31101168 CTAAATCTTCGGAGGAAGGAAGG - Intronic
1156346147 18:36258795-36258817 CTCATTCAACAGAGGAAGGGTGG - Intronic
1158498970 18:57983118-57983140 CTAAGCCGATGGAGGAAGGATGG + Intergenic
1160991116 19:1860725-1860747 TTCAGCCCCCGGAGGAGGGAGGG - Intronic
1161308435 19:3579821-3579843 GTCAATCCACAGAGGCAGGAAGG - Intergenic
1161568821 19:5018754-5018776 GCCAGTCCACAGAGGCAGGAAGG - Intronic
1162182519 19:8879853-8879875 CTCTGCCCACTGAGGAAGGATGG - Intronic
1162402368 19:10453954-10453976 CTCTGTCCAGGGAAGCAGGAGGG - Intronic
1165454087 19:35900693-35900715 CTCAGTCCCCCCGGGAAGGAGGG + Intronic
1168008344 19:53509219-53509241 CGCAGCTCACAGAGGAAGGAGGG - Intergenic
1168199297 19:54803472-54803494 ATCAGTCAAGGGAGGAATGAGGG - Intronic
1168376967 19:55888236-55888258 GTGAGTTCATGGAGGAAGGACGG + Intergenic
925079564 2:1053110-1053132 TTTTGTCCACGTAGGAAGGAGGG + Intronic
925911199 2:8574658-8574680 CTGTGTCCAAGGAGGAAGGCGGG + Intergenic
926272689 2:11378577-11378599 CTCAGTCCTCTGATGAGGGAGGG + Intergenic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
927948274 2:27150324-27150346 CGGAGTCCACGCAGGAAGGGCGG - Exonic
928132361 2:28661828-28661850 CCGAGTCCATGGAGGAAGGCAGG - Intergenic
928255469 2:29718550-29718572 CTGAGTGCAGGGAGGAGGGAAGG + Intronic
929869342 2:45745208-45745230 CTCAGTCGCTGCAGGAAGGAGGG - Intronic
932653060 2:73580990-73581012 CTCAGTACAAGTAGGAAGCAAGG - Intronic
933870284 2:86559315-86559337 CTCAGTCCAGGGTTGAAGGCCGG - Intronic
935704009 2:105840262-105840284 TTCAGTCCACGGAGGAGGACAGG + Intronic
937910034 2:127071052-127071074 CTCAGCCCAGGAAGGAAGGCAGG + Intronic
938101421 2:128500330-128500352 CTCAGTCCACACAGGGAAGAGGG + Intergenic
938168573 2:129055394-129055416 CAAAGACCAGGGAGGAAGGAAGG - Intergenic
946817062 2:223589984-223590006 GTCAGTGCACCTAGGAAGGAGGG + Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
947937631 2:234021688-234021710 CTCAGTCCTCTGAGGAAGAAGGG - Intergenic
948665941 2:239535114-239535136 ATGGGTCCACGGGGGAAGGACGG - Intergenic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
949041492 2:241851891-241851913 CTCTGCCCACCCAGGAAGGAAGG + Intronic
1168854149 20:997194-997216 TTGAGGCCACTGAGGAAGGAGGG - Intronic
1169226999 20:3863178-3863200 CTCAGTCCCCAGAGGAAGTAAGG + Intronic
1169346908 20:4835919-4835941 CTCTGTGCACGGAGGAGGGTGGG - Intergenic
1170165432 20:13357077-13357099 CTCATTCCATGGAGTAGGGAAGG + Intergenic
1172188747 20:33048970-33048992 CCCATGCCACAGAGGAAGGAGGG + Intergenic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173564063 20:44026822-44026844 CTCACCCCACAGAAGAAGGAAGG - Intronic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174127395 20:48317053-48317075 CTGAAGCCACGGAGGAAGCATGG + Intergenic
1175538917 20:59736140-59736162 CTCAGTCCTCAGATGATGGATGG - Intronic
1176026877 20:62990307-62990329 CTCAGACCAAGGAGCACGGAGGG - Intergenic
1176878607 21:14164296-14164318 CTCATTACATGGAAGAAGGATGG + Intronic
1176984534 21:15420785-15420807 CTCAGGTCACTGAGGGAGGATGG + Intergenic
1177956661 21:27606555-27606577 CACAGTCCACAGAGAAAGCATGG + Intergenic
1178826860 21:36024525-36024547 CTCAGGAGACGGAGGCAGGATGG + Intergenic
1179120849 21:38544284-38544306 CTCAGGCCCTGGAGGAAGGCTGG + Intronic
1180927752 22:19567820-19567842 CTCAGTCCAGGGAATAATGAGGG + Intergenic
1181733536 22:24864884-24864906 CTCAGGCCACAGAGCTAGGAAGG - Intronic
1181983374 22:26782124-26782146 TTCCATCCACGGAGGAGGGAAGG - Intergenic
1183349713 22:37328211-37328233 ATGAGTCAACGGAGGAAGGAAGG + Intergenic
1183774268 22:39953021-39953043 ATCACTCCAAGGTGGAAGGAAGG - Intronic
1184148595 22:42625688-42625710 CTGAGGTCACGGAGGAAGGTAGG + Intronic
1184804965 22:46788883-46788905 CTCACTCCACAGAGGAAGATTGG - Intronic
949195452 3:1300442-1300464 GTCAGTTCAGGAAGGAAGGAAGG + Intronic
950791347 3:15474773-15474795 CTCAGTCCACTGACAAAGGGTGG + Intronic
951464772 3:22990184-22990206 CCCAGTCCAAGCAGGAAGTACGG + Intergenic
952408462 3:33026247-33026269 CTCCGACCTCGGAGCAAGGATGG + Intronic
954336666 3:49922473-49922495 CTCTGTAAAGGGAGGAAGGAAGG + Intronic
954680218 3:52341770-52341792 CTGAGTCAAGTGAGGAAGGATGG + Intronic
954684934 3:52365251-52365273 CTCAGCCCACACGGGAAGGAGGG - Intronic
959723511 3:109518303-109518325 CTCATTGCAGGAAGGAAGGAGGG - Intergenic
959918791 3:111848115-111848137 CTCAGTACAAGAAAGAAGGAAGG - Intronic
960565344 3:119126292-119126314 CCCCGCCCACTGAGGAAGGATGG - Intronic
961101241 3:124201082-124201104 CCCATTCTAGGGAGGAAGGAGGG - Intronic
964086753 3:152827932-152827954 CTCAGACCCTGGAGGAAGGCAGG + Intergenic
964932502 3:162044483-162044505 CTCAGATCAGGAAGGAAGGAAGG - Intergenic
965694236 3:171390461-171390483 CTCAGTCCATGAGGGAATGACGG - Intronic
966881123 3:184351911-184351933 CTCAGGCCAGTGGGGAAGGAGGG - Intronic
967220688 3:187245685-187245707 ATAAGTCAACGGAGGAAGCAGGG - Intronic
969249604 4:5958281-5958303 CTCTGTTCTCGGTGGAAGGAAGG + Exonic
969703557 4:8780496-8780518 CACAGTTCCTGGAGGAAGGAGGG - Intergenic
970444155 4:16110128-16110150 CTCTGTCAAGGAAGGAAGGAAGG + Intergenic
970724654 4:19029464-19029486 ATCAGACCAAGGAAGAAGGATGG + Intergenic
971315985 4:25568517-25568539 CTCAGTCAAAGCAGGAAAGAGGG + Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
972403096 4:38723376-38723398 CTCACTCCCAGGAGGAAGAAAGG + Intergenic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
976538196 4:86242571-86242593 ATCCGCCCACTGAGGAAGGATGG + Intronic
978656839 4:111074961-111074983 CCCCGCCCACTGAGGAAGGATGG - Intergenic
979197825 4:117941524-117941546 CCCTGTCCACTGAGAAAGGATGG + Intergenic
980108717 4:128613886-128613908 CTCAGACAACAGAGAAAGGACGG + Intergenic
981429275 4:144641587-144641609 GTGATTCCACAGAGGAAGGACGG - Intergenic
982694399 4:158582806-158582828 TTCAGCCCAAGGAGGAGGGAAGG + Intronic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984215762 4:176911068-176911090 CCCTGACCACTGAGGAAGGATGG - Intergenic
986298064 5:6455911-6455933 AGCAGTCCAGGGAGGAAGGCTGG - Intronic
986338222 5:6770229-6770251 CTCAGGCCACGGACCAAGGAAGG - Intergenic
987150106 5:15029775-15029797 CTCAATACAGGTAGGAAGGAGGG + Intergenic
987453875 5:18119620-18119642 CCCCGCCCACTGAGGAAGGATGG - Intergenic
989494105 5:42091069-42091091 CTCAGTCAACTGAGAAAGAATGG - Intergenic
989981900 5:50655494-50655516 GTCAGTCCAGGGAGGGAGGGAGG - Intergenic
991107695 5:62862376-62862398 CTCAGCTCATGGAGGAAGGTTGG - Intergenic
993117248 5:83733703-83733725 CCCCATCCACTGAGGAAGGATGG + Intergenic
993567684 5:89495301-89495323 CTCAGTCCTCTGAGGATTGAAGG + Intergenic
993654016 5:90556157-90556179 CTCAGTACATGAAGGAAGGAAGG - Intronic
994344540 5:98669012-98669034 CTCCATCCACTGAGGAAGGATGG - Intergenic
996976472 5:129440505-129440527 CTCAGTCCAAGGCTGAAGGCTGG + Intergenic
998490610 5:142543071-142543093 TTCAGTTCAGGGAGGAAGGAAGG - Intergenic
1000147189 5:158464995-158465017 CTCAGTCAAATGAGGCAGGAAGG - Intergenic
1000172188 5:158713036-158713058 CTCGGTCCACGCAGGGATGATGG - Exonic
1000339027 5:160262821-160262843 CACAGTCCCAGGAGGAAGGGAGG - Intronic
1001839691 5:174864700-174864722 CCCTGCCCACTGAGGAAGGATGG + Intergenic
1001922272 5:175610008-175610030 CACAGTCCAGGGAGGCTGGAGGG - Intergenic
1001946259 5:175780770-175780792 CTCAGAACACAGAGAAAGGATGG - Intergenic
1002067965 5:176661794-176661816 CTGGGTCCAGGAAGGAAGGAAGG + Intergenic
1002193901 5:177492115-177492137 CTCAGTCCACGCAGGACCGAGGG + Intronic
1002718867 5:181246177-181246199 CTCAGTCCACAGCGGGAGGCGGG - Intronic
1003619995 6:7691347-7691369 GTCAGTGGACAGAGGAAGGAGGG - Intergenic
1004734102 6:18387500-18387522 CGCAGAGCACGGAGGAAAGACGG + Exonic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1007512126 6:42381694-42381716 CTCCCTCAACGGAGGAGGGAAGG + Intronic
1011314527 6:86016791-86016813 CACAGACCAGGGAGGAAGGGGGG + Intergenic
1012067090 6:94561430-94561452 CTGAGGCCACAGAGGTAGGAAGG - Intergenic
1014677929 6:124390814-124390836 TTCAGTCTACAGAGTAAGGAAGG + Intronic
1014999988 6:128202624-128202646 CTCCGTCCACCTAAGAAGGACGG + Intronic
1017317110 6:153044115-153044137 CTCATTTCACTAAGGAAGGAGGG + Intronic
1018728766 6:166633261-166633283 CTAAGTCCACAGAGCAAGAAAGG + Intronic
1021935864 7:25630640-25630662 CTGAGTCCCCTGGGGAAGGAAGG + Intergenic
1021949354 7:25759958-25759980 AGGAGTCCACTGAGGAAGGAAGG + Intergenic
1022675041 7:32491485-32491507 CTCAGTCTATGAAGGAATGATGG - Intronic
1026620479 7:71945861-71945883 CACAGACCAGTGAGGAAGGATGG - Intronic
1028442524 7:90880354-90880376 CCCCATCCACTGAGGAAGGATGG - Intronic
1029620828 7:101688815-101688837 CCCAGTCCACGGAGTAAGGGAGG + Intergenic
1031028956 7:116713677-116713699 CTCACTCCACGGTGGCAAGATGG + Intronic
1031049962 7:116935001-116935023 CACATTCCAGGGAGGAAGAAGGG - Intergenic
1033658886 7:143390562-143390584 CGCAGTCCTGGGAAGAAGGAAGG - Exonic
1035466115 7:159079032-159079054 CAGTGTCCATGGAGGAAGGATGG + Intronic
1037487084 8:19357777-19357799 CTCACACGACGGAGGAAGCAGGG - Intronic
1038034953 8:23679720-23679742 CCCAGTCCACTGAGCAAGCAAGG - Exonic
1039923714 8:41910567-41910589 GTCAGCACACGGATGAAGGATGG - Intergenic
1040531154 8:48267409-48267431 CTCTGCCTAGGGAGGAAGGAAGG + Intergenic
1040581321 8:48700908-48700930 CTTAGTCGACAAAGGAAGGATGG + Intergenic
1043223837 8:77699429-77699451 TCCTGTCCACTGAGGAAGGATGG + Intergenic
1048132324 8:131711404-131711426 CTCTGTCGAGGGAGTAAGGAAGG - Intergenic
1048306349 8:133287323-133287345 CTGAGTTCACGGAAGCAGGATGG + Intronic
1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG + Intronic
1052067033 9:24034660-24034682 CTATGTCCAGGGAGGGAGGAAGG + Intergenic
1055398793 9:75901036-75901058 CTCAGACTAAAGAGGAAGGAAGG + Intronic
1056131014 9:83586514-83586536 CTCAGGCCACAGAGGCAGGAAGG + Intergenic
1056803740 9:89712444-89712466 CTCTGGCCGCGGAGGGAGGAGGG - Intergenic
1057896560 9:98913549-98913571 CTCATGCCACAGAGGAAGGTAGG + Intergenic
1058000615 9:99861503-99861525 CTCTGTCAAGGAAGGAAGGAAGG + Intronic
1058132181 9:101265555-101265577 CTCAGGACAGGGAGGAAGAAAGG + Intronic
1059097789 9:111437547-111437569 CTCAGTTCAGGGAGGATTGAAGG - Intronic
1060952682 9:127613405-127613427 CTCAGACCACGGTGGCAGGGAGG + Intronic
1061252942 9:129437261-129437283 ATCAGCCCACGGAGGGAGGGCGG + Intergenic
1061730995 9:132613886-132613908 CTCACTCCAACAAGGAAGGAGGG + Intronic
1061943346 9:133894566-133894588 CTCTGTCCAGGGAGGCATGAGGG + Intronic
1061972477 9:134052519-134052541 CTCAGTCCACTTGGGAAGGTCGG - Intronic
1062549887 9:137081088-137081110 CTCAGTGCACTGAGGGAGGCAGG + Intronic
1185517991 X:715345-715367 CTCAGTCCATCCAGGGAGGAGGG - Intergenic
1185518033 X:715501-715523 CTCAGTCCATCCAGGGAGGAGGG - Intergenic
1185799185 X:2994242-2994264 CTCAGTGCAGGGAGCCAGGATGG - Intergenic
1186770297 X:12811581-12811603 CCCAGTCCAGTGAGGAAGCAAGG + Intronic
1187747049 X:22420780-22420802 CCCAGGCCACTGAGGAAGAAAGG + Intergenic
1193170580 X:78331170-78331192 CACAGACCACCTAGGAAGGATGG + Intergenic
1193601552 X:83512625-83512647 CTCATTCCCCTGAGGAGGGATGG + Intergenic
1193719503 X:84971390-84971412 CCCTGCCCACTGAGGAAGGATGG + Intergenic
1197046469 X:122004066-122004088 CCCTGCCCACTGAGGAAGGATGG + Intergenic
1198081717 X:133246308-133246330 CTCAGTCAAAGGATGAAGCATGG - Intergenic
1198512255 X:137364276-137364298 CACAGACCACGTAGGAAAGATGG - Intergenic
1199560030 X:149152048-149152070 CTCAGTCTATGGAGGGAGGGAGG - Intergenic
1200149886 X:153946215-153946237 CTCAGTCTGGGGAGGCAGGAGGG - Intergenic