ID: 1097243239

View in Genome Browser
Species Human (GRCh38)
Location 12:57590849-57590871
Sequence TACCGAATGGGGGTTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097243239_1097243250 27 Left 1097243239 12:57590849-57590871 CCCTTCCCAACCCCCATTCGGTA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1097243250 12:57590899-57590921 CGAGGTTACTCATTAGAAACTGG 0: 1
1: 0
2: 0
3: 3
4: 60
1097243239_1097243251 28 Left 1097243239 12:57590849-57590871 CCCTTCCCAACCCCCATTCGGTA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1097243251 12:57590900-57590922 GAGGTTACTCATTAGAAACTGGG 0: 1
1: 0
2: 0
3: 12
4: 128
1097243239_1097243248 9 Left 1097243239 12:57590849-57590871 CCCTTCCCAACCCCCATTCGGTA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1097243248 12:57590881-57590903 TCGCATTAGCATCAGGTCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 30
1097243239_1097243247 2 Left 1097243239 12:57590849-57590871 CCCTTCCCAACCCCCATTCGGTA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1097243247 12:57590874-57590896 AATGCTTTCGCATTAGCATCAGG 0: 1
1: 0
2: 0
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097243239 Original CRISPR TACCGAATGGGGGTTGGGAA GGG (reversed) Intergenic
900688415 1:3964443-3964465 CACCGAATGAGGGCTGAGAAGGG + Intergenic
902238485 1:15073259-15073281 TACAGGATGGGGCCTGGGAATGG - Intronic
906615408 1:47229936-47229958 TACAGAAATGGAGTTGGGAAGGG + Intronic
909848858 1:80434465-80434487 TACCGCCTGGGGTTTGGGGAGGG + Intergenic
909966148 1:81913133-81913155 TACCGAATGGGGTATAGAAAGGG - Intronic
912446354 1:109739948-109739970 TAGCGGGCGGGGGTTGGGAATGG - Intronic
916664784 1:166956911-166956933 TAAACAATGGGGGTTGGGAAGGG + Intronic
917642456 1:176996424-176996446 CATGGGATGGGGGTTGGGAAGGG - Intronic
920404608 1:205699771-205699793 TACAGAAAGGGGAATGGGAAGGG + Intergenic
924619972 1:245651831-245651853 GACCCAATGGGAGTAGGGAATGG - Intronic
1063282735 10:4648477-4648499 TAGCAAATGAGGGTTGGGGATGG - Intergenic
1063429442 10:5976787-5976809 GACCGGATGGGGGTGGGGAGTGG - Intronic
1063631004 10:7733750-7733772 GACAGAATGAGGCTTGGGAATGG - Intronic
1071486778 10:86107497-86107519 TACAGAATGGGGGAAGGGAAGGG + Intronic
1073072235 10:100802039-100802061 TACAGAATGGGAGCTGGGCAGGG + Intronic
1075345950 10:121682019-121682041 TGCCCAATGGGGGATGGAAATGG + Intergenic
1076269796 10:129141774-129141796 AATTGAATGGGGGTTGGGAAGGG + Intergenic
1077947080 11:6911516-6911538 TACTGATTGGGGGTTGGAAGCGG + Intergenic
1079239561 11:18712999-18713021 GATGGAATGGGGATTGGGAATGG - Intronic
1081420722 11:42873153-42873175 TACAGAATGGGGGATGTGGAGGG - Intergenic
1084189002 11:67490542-67490564 CTCAGAATGGGGGTTGTGAAAGG - Intronic
1088490204 11:110379453-110379475 CACCGAATGGTGGTTGGGTAGGG - Intergenic
1088597883 11:111453378-111453400 TACATAATGGGGAGTGGGAAGGG - Intronic
1089457647 11:118634785-118634807 GACAGAATGGGGGTCGGCAATGG - Intronic
1089660683 11:119983227-119983249 TCCCCAAAGGGGGTGGGGAAAGG + Intergenic
1091580252 12:1782847-1782869 GACCTAATGGGGGTGGGGGATGG - Intronic
1092525732 12:9309151-9309173 TTCCCTATGGGGGTGGGGAATGG - Intergenic
1092541555 12:9422664-9422686 TTCCCTATGGGGGTGGGGAATGG + Intergenic
1094191579 12:27703470-27703492 TACAGAATGGGGGTTGTAATTGG + Intergenic
1094511487 12:31099838-31099860 TTCCCTATGGGGGTGGGGAATGG - Intronic
1096512008 12:52135788-52135810 TACAGAAGGAGGGTTGGGCATGG - Intergenic
1097243239 12:57590849-57590871 TACCGAATGGGGGTTGGGAAGGG - Intergenic
1097894263 12:64808754-64808776 TACTGAATGGGGGTTGCCAGGGG - Intronic
1104109371 12:125690458-125690480 CACCTATTGGGGGTGGGGAAAGG - Intergenic
1106016111 13:25870419-25870441 TACAGAATGGGGGAAGGGCATGG - Intronic
1108422543 13:50265751-50265773 TAGTGAAAGGGGGCTGGGAAGGG - Intronic
1108639127 13:52365612-52365634 TATGGAATTGGGGTTGGGAGAGG + Intergenic
1111251558 13:85608359-85608381 TACTGAATGGGGGTGTTGAATGG - Intergenic
1111453896 13:88454154-88454176 TACAGAATGGGGGGTGGGATGGG + Intergenic
1115051362 14:29067829-29067851 CAACAAATGGGGGTGGGGAAGGG + Intergenic
1118205351 14:63717642-63717664 AACCGAATGGAAGTGGGGAAGGG + Intronic
1118420327 14:65594875-65594897 CACAGAATGGGGGTTGGGACGGG + Intronic
1119046171 14:71320668-71320690 TACCGCATGGGGGAGGGGACAGG - Intronic
1120120366 14:80671980-80672002 TACCGAATTGGAATTGTGAAAGG - Intronic
1121658347 14:95615319-95615341 TGCCAAATGGGGATTGGGAAAGG - Intergenic
1122423939 14:101594774-101594796 TGCCGCATGGGGGTCGGCAATGG - Intergenic
1202835025 14_GL000009v2_random:71556-71578 TAGAGAATGGGGGTTGGAAGGGG + Intergenic
1125832581 15:42727459-42727481 TACTGAATGGGGGTTAGGTAGGG - Intronic
1128631232 15:69269990-69270012 GTCACAATGGGGGTTGGGAAGGG - Exonic
1128926190 15:71658409-71658431 AACAGACTGGAGGTTGGGAAGGG + Intronic
1132008931 15:98257159-98257181 TATCGAAATGGGGGTGGGAAAGG - Intergenic
1132066274 15:98733503-98733525 GACCACATGGGGGTTTGGAAGGG - Intronic
1133586179 16:7197882-7197904 AACAGAATGGGGGTTGCCAAGGG + Intronic
1136631045 16:31489427-31489449 TCTCGACTGAGGGTTGGGAATGG + Intronic
1139065618 16:63310008-63310030 TTCCGAAGGGGTGGTGGGAAAGG - Intergenic
1141863623 16:86734728-86734750 TCCTGCATGGGGGTAGGGAAAGG + Intergenic
1144526814 17:15997608-15997630 TGAAGAATGGGGGTTAGGAAGGG + Intronic
1145835596 17:27952225-27952247 TACCCAGTGGGGGATGGGAGTGG + Intergenic
1146507816 17:33420762-33420784 CACAGAATGGGAGTTGGGACGGG + Intronic
1147133107 17:38420303-38420325 CCCCAAGTGGGGGTTGGGAAGGG - Intergenic
1148232856 17:45947933-45947955 TAGGGAATGGGAGTGGGGAAGGG - Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1150845858 17:68657295-68657317 TAAGGAATGGGGGTTGTGGATGG - Intergenic
1154430443 18:14304157-14304179 TAGAGAATGGGGGTTGGAAGGGG + Intergenic
1154432685 18:14320484-14320506 TAGAGAATGGGGGTTGGAAGGGG + Intergenic
1158892142 18:61882769-61882791 TACCAAGTGGGGGTTGGGAAGGG - Intronic
1161004467 19:1927843-1927865 TACCGAAGGGGTGTGGGGATGGG + Intergenic
1162486213 19:10961777-10961799 GCCCGAATTGGGGTTGGGGATGG + Intronic
1163094793 19:15049242-15049264 TATGGGATGGGGGTTGGGAGAGG + Intergenic
1165984801 19:39758625-39758647 TACAGAGTGTGGCTTGGGAAAGG + Intergenic
1167880592 19:52454081-52454103 TAAGGAATGTGGGTTGTGAAGGG - Intronic
1202637601 1_KI270706v1_random:55792-55814 TAGAGAATGGGGGTTGGAAGGGG - Intergenic
932576457 2:72964921-72964943 TACGGAAGGGGGGAAGGGAAGGG + Intronic
935257842 2:101328174-101328196 GAAGGAGTGGGGGTTGGGAAGGG + Intergenic
944437927 2:199711347-199711369 TATCTAATGGGGGTTGTGAGGGG + Intergenic
946033778 2:216725644-216725666 AATAAAATGGGGGTTGGGAAGGG + Intergenic
946384941 2:219377631-219377653 TCCTGAAATGGGGTTGGGAATGG + Intronic
946647349 2:221852064-221852086 CACTGAGTGGGGGTTGGGATGGG - Intergenic
1169996523 20:11563598-11563620 TACAGTCTGGGGATTGGGAATGG + Intergenic
1171884177 20:30639881-30639903 TAGAGAATGGGGGTTGGAAGGGG - Intergenic
1172321405 20:33997812-33997834 TAACAACTGGGGGTTGGGAGAGG + Intronic
1172642001 20:36446139-36446161 TACAGAATGGATGTTGGGAAAGG - Intronic
1174013928 20:47472671-47472693 TACTGTATGGGGATTGGGTATGG - Intergenic
1176586062 21:8587165-8587187 TACCTAATGGGTTTTTGGAAGGG - Intergenic
1176847046 21:13884787-13884809 TAGGGAATGGGGGTTGGAAGGGG - Intergenic
1178939832 21:36896056-36896078 AAAGGTATGGGGGTTGGGAATGG + Intronic
1180268869 22:10564071-10564093 TACCTAATGGGTTTTTGGAAGGG - Intergenic
1183762075 22:39830483-39830505 TACCTAATTGGGTTGGGGAAAGG + Intronic
949902394 3:8827767-8827789 TCCCTTATGGGGGTTGGGGAGGG - Intronic
957405442 3:79769377-79769399 TACTGATTGGGGGAAGGGAAGGG - Intergenic
959894608 3:111592087-111592109 AACATAATGTGGGTTGGGAATGG - Intronic
960530536 3:118759042-118759064 TAAAGAATGGGGGCTGGGCATGG - Intergenic
962240290 3:133746267-133746289 TAAGGAAGGGGGGTTGGGAGAGG + Exonic
971149251 4:24013684-24013706 TACCGAAGCAGGATTGGGAATGG - Intergenic
971175408 4:24277768-24277790 TACCAAATGGGGGTCAGGACAGG + Intergenic
971465134 4:26949792-26949814 TAATGAATGGGGGATGGGATGGG - Intronic
971554944 4:28002069-28002091 CACCGAATGGGTGCTGGGATGGG + Intergenic
973367841 4:49222154-49222176 TAGAGAATGGGGGTTGGAAGGGG - Intergenic
973393212 4:49573272-49573294 TAGAGAATGGGGGTTGGAAGGGG + Intergenic
975394849 4:73863098-73863120 TACCTAAGGTGAGTTGGGAAGGG - Intergenic
980700891 4:136428686-136428708 TAAGGAATGGGGGTAGGGGATGG - Intergenic
983576304 4:169264929-169264951 TAGGGAATGGGGGCTGGGCAGGG - Intronic
984292101 4:177808405-177808427 GACAGAATGGGGGATGGGACAGG + Intronic
984833568 4:183998830-183998852 AACCTAATGTGGGTTGGGCATGG - Intronic
985059716 4:186065130-186065152 TTCTGAATGGGGGCTGTGAAGGG + Intergenic
1202764919 4_GL000008v2_random:141647-141669 TAGAGAATGGGGGTTGGAAGGGG - Intergenic
988313058 5:29587144-29587166 TACCAAATGGGCTTGGGGAAAGG - Intergenic
995177802 5:109198715-109198737 TAGAGAATGAGGTTTGGGAATGG - Intergenic
997299609 5:132792940-132792962 TATGGAATGGGAGGTGGGAAAGG + Intronic
999315471 5:150580733-150580755 CACCCAATGAGGGGTGGGAATGG - Intergenic
999397617 5:151240068-151240090 TACTGAATTTGGGTTGGGTATGG + Intronic
1001010679 5:168095170-168095192 TACAGACTGGGGCTTGGGGATGG - Intronic
1001110620 5:168893288-168893310 TGCCCAGTGGGGTTTGGGAAAGG + Intronic
1001377407 5:171274973-171274995 GTCCTAGTGGGGGTTGGGAAGGG - Intronic
1001633957 5:173196629-173196651 CACTGAATGGGAGTTGGTAAAGG - Intergenic
1003018942 6:2493158-2493180 TACTGAATGGGGTTTGGCAGCGG - Intergenic
1003177131 6:3760780-3760802 TACTAAATGTGGGTTGGAAATGG + Intergenic
1014259314 6:119197741-119197763 CACAGAATGGGGGTTGGGGCAGG + Intronic
1015073175 6:129122639-129122661 TACTGAACAGGGGTTGTGAAGGG + Intronic
1019272662 7:159184-159206 TACCAAAAGGGGGCTGGGGAGGG - Intergenic
1024705904 7:51959428-51959450 CACCGCATGGGGTTGGGGAAAGG + Intergenic
1025051228 7:55736684-55736706 CACGGAATGGGGGATGGGAGGGG - Intergenic
1032314929 7:130828957-130828979 TATCCAATGGAGGCTGGGAAGGG - Intergenic
1032795214 7:135270865-135270887 TCCCAAACGGGGCTTGGGAAAGG + Intergenic
1034859702 7:154584525-154584547 AACCGCATGGGGGTGGGGGACGG - Intronic
1035997268 8:4561950-4561972 TACCGGATGGGCGTTGTGAGGGG - Intronic
1036664337 8:10729251-10729273 GACCGGGTGGGGTTTGGGAAGGG + Intronic
1045098428 8:98822149-98822171 TACCTTTTGGGGGATGGGAAGGG + Intronic
1045379098 8:101605201-101605223 GACCCAATGGAGGTGGGGAAGGG + Intronic
1048055885 8:130864535-130864557 AAGTGAATGGGGGTTGGGCAGGG - Intronic
1051017481 9:12496672-12496694 TATACAATGGAGGTTGGGAAGGG - Intergenic
1051538661 9:18189536-18189558 TACCAAATTGGGGGTGGAAAAGG - Intergenic
1052300443 9:26947186-26947208 TACGGAAGGGCGGCTGGGAAGGG + Exonic
1055087059 9:72325090-72325112 TATAGAATGGAGGTTAGGAAGGG - Intergenic
1055116028 9:72606300-72606322 CATGGAATGGGGGTTGGGGATGG + Intronic
1057635068 9:96757057-96757079 TAGCTAATGGGGTTTGGCAATGG - Exonic
1058844327 9:108941021-108941043 GAGCAAGTGGGGGTTGGGAAGGG - Intronic
1203545669 Un_KI270743v1:126535-126557 TAGAGAATGGGGGTTGGAAGGGG - Intergenic
1188588453 X:31804673-31804695 CACTGAGTTGGGGTTGGGAATGG - Intronic
1188606300 X:32035276-32035298 GAAAGAATTGGGGTTGGGAAAGG + Intronic
1192285121 X:69727274-69727296 TACAGGATGGGGGTTGTGGAGGG + Intronic
1192454100 X:71263172-71263194 TACCCAGTGGGGGCTGGGCATGG + Intergenic
1196358015 X:114817676-114817698 TACTGGATGGGGGAAGGGAAGGG + Intronic
1197609347 X:128621737-128621759 TACATAATGGGAGGTGGGAATGG - Intergenic
1198388359 X:136148397-136148419 TGGCGAATGGGGGTGGGGAGGGG + Intronic
1198760694 X:140029409-140029431 AACAGAATGGGGGCTGGGCATGG - Intergenic
1200845767 Y:7831082-7831104 TTACAAAAGGGGGTTGGGAAAGG - Intergenic
1201349594 Y:13024491-13024513 CCCTGAATGGTGGTTGGGAAAGG - Intergenic