ID: 1097244794

View in Genome Browser
Species Human (GRCh38)
Location 12:57601614-57601636
Sequence CTTGAACATCAGAGAGAACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 195}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097244794_1097244800 1 Left 1097244794 12:57601614-57601636 CCTGGTTCTCTCTGATGTTCAAG 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1097244800 12:57601638-57601660 TGGTGGGGTTCTGAGACACTTGG 0: 1
1: 0
2: 0
3: 15
4: 168
1097244794_1097244802 3 Left 1097244794 12:57601614-57601636 CCTGGTTCTCTCTGATGTTCAAG 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1097244802 12:57601640-57601662 GTGGGGTTCTGAGACACTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 149
1097244794_1097244804 12 Left 1097244794 12:57601614-57601636 CCTGGTTCTCTCTGATGTTCAAG 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1097244804 12:57601649-57601671 TGAGACACTTGGGGGAATTGTGG 0: 1
1: 0
2: 1
3: 18
4: 202
1097244794_1097244806 14 Left 1097244794 12:57601614-57601636 CCTGGTTCTCTCTGATGTTCAAG 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1097244806 12:57601651-57601673 AGACACTTGGGGGAATTGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 208
1097244794_1097244805 13 Left 1097244794 12:57601614-57601636 CCTGGTTCTCTCTGATGTTCAAG 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1097244805 12:57601650-57601672 GAGACACTTGGGGGAATTGTGGG 0: 1
1: 0
2: 0
3: 7
4: 147
1097244794_1097244801 2 Left 1097244794 12:57601614-57601636 CCTGGTTCTCTCTGATGTTCAAG 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1097244801 12:57601639-57601661 GGTGGGGTTCTGAGACACTTGGG 0: 1
1: 0
2: 0
3: 11
4: 177
1097244794_1097244803 4 Left 1097244794 12:57601614-57601636 CCTGGTTCTCTCTGATGTTCAAG 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1097244803 12:57601641-57601663 TGGGGTTCTGAGACACTTGGGGG 0: 1
1: 0
2: 0
3: 16
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097244794 Original CRISPR CTTGAACATCAGAGAGAACC AGG (reversed) Exonic
900921667 1:5675904-5675926 CTTGAACCTCCCACAGAACCAGG - Intergenic
901218198 1:7566529-7566551 GTTGATGAGCAGAGAGAACCTGG + Intronic
901337450 1:8463434-8463456 TTTGCACATCAGAAAGAGCCTGG - Intronic
908600021 1:65728452-65728474 CTTGCAGATCAGAGAGAAGAGGG - Intergenic
910143259 1:84050626-84050648 CTTATACATCAGAGACAACGTGG + Intergenic
910541061 1:88357825-88357847 CCTGAACATCACAGAGGCCCTGG + Intergenic
911757238 1:101572757-101572779 GTAGAACCTCAGAGAAAACCTGG + Intergenic
912244795 1:107950191-107950213 TTAGAATCTCAGAGAGAACCAGG - Intronic
913440707 1:118894182-118894204 CTGAAACAACAGAGAGAACGAGG + Intronic
915553762 1:156649893-156649915 CTTGAACCTCAGGGAGCACTTGG + Intronic
916388747 1:164306902-164306924 ATTGAACTTCAGTGAGAGCCAGG + Intergenic
916787515 1:168097177-168097199 CATGAAGATCACAGGGAACCGGG - Exonic
917278829 1:173359865-173359887 CTGGAACATCAGGGAGCACGTGG - Intergenic
922517674 1:226220654-226220676 CTTGAACAACAAAGAGAGCCCGG + Intergenic
922522804 1:226271873-226271895 TTTTAACATCAGAGAAAAACAGG - Intronic
924896527 1:248342689-248342711 ATAGAACAGGAGAGAGAACCAGG - Intergenic
1063016846 10:2087010-2087032 TTTGAACATGAACGAGAACCTGG + Intergenic
1063074316 10:2699885-2699907 CCTGAACATCATATAGAACATGG + Intergenic
1063203253 10:3806219-3806241 CATGAACCTCAGAGACAGCCTGG - Intergenic
1067300846 10:45007799-45007821 CTTAAATCCCAGAGAGAACCTGG + Intergenic
1067711327 10:48653505-48653527 CTGGAACAGCACAGAGAACGGGG + Intronic
1069206793 10:65699462-65699484 CTTCAACATCAGAGAAAAAGTGG + Intergenic
1069692837 10:70365031-70365053 GTTGAATCTCAGAGAGGACCTGG - Intronic
1070356869 10:75648384-75648406 CTTGAGAATCAAAGAAAACCCGG + Intronic
1070447756 10:76524106-76524128 AATAAACATCAGAGGGAACCGGG + Intronic
1073890063 10:108091002-108091024 AGTGAACATCAGAGGTAACCAGG + Intergenic
1076198891 10:128541873-128541895 TTTGAACACAAGAAAGAACCAGG + Intergenic
1079631325 11:22680348-22680370 CTTGAAAATCAGTGTGAAGCAGG + Intronic
1084934868 11:72581461-72581483 CTTCACCATCAAACAGAACCTGG + Exonic
1088790339 11:113220064-113220086 TCTGAACATCAGAGACAATCGGG + Intronic
1092903603 12:13082712-13082734 CCTTAACATAACAGAGAACCAGG - Exonic
1093486846 12:19661690-19661712 CTTGAACCTGGGAGTGAACCTGG + Intronic
1096133273 12:49178127-49178149 CTTTATCATCAAATAGAACCAGG + Intergenic
1096537955 12:52287359-52287381 GATGAGCATCAGAGAGACCCAGG - Intronic
1097158391 12:57028863-57028885 CTTGAACCTCACTGAGAACCTGG + Exonic
1097244794 12:57601614-57601636 CTTGAACATCAGAGAGAACCAGG - Exonic
1098132355 12:67363842-67363864 CTTCAACATCAGCAAAAACCTGG + Intergenic
1100633199 12:96408509-96408531 ATTGAAAATCAGAGAGGGCCGGG + Intergenic
1101210812 12:102533732-102533754 CCTCACCTTCAGAGAGAACCTGG + Intergenic
1101700143 12:107165925-107165947 CTTTAACATTAAACAGAACCTGG + Intergenic
1104594243 12:130109666-130109688 CTTGAACATAGGAGAGACGCTGG + Intergenic
1107808199 13:44174536-44174558 CGTGAACATCAGTGATAGCCAGG - Intergenic
1108491830 13:50989961-50989983 CTGGAACATTGGAGAGGACCGGG + Intergenic
1109680817 13:65749413-65749435 GTTGAACATAATAGAGAGCCTGG - Intergenic
1111336246 13:86827698-86827720 TGTGAATATTAGAGAGAACCAGG + Intergenic
1111639364 13:90947639-90947661 ATTGAACATCAGAGGTAGCCAGG + Intergenic
1112250741 13:97776997-97777019 CTGGAACAGAATAGAGAACCTGG - Intergenic
1114397608 14:22380975-22380997 CAGGATCATCAGAGAGAATCTGG + Intergenic
1115040684 14:28922329-28922351 CTTGAACATTAAAGAGAAAATGG + Intergenic
1117869782 14:60188028-60188050 CTCGATGATCAGAGAGAATCAGG - Intergenic
1117935372 14:60899085-60899107 GTGGAACATAATAGAGAACCCGG - Intronic
1120356048 14:83435440-83435462 ATGGAACAGAAGAGAGAACCTGG + Intergenic
1120867096 14:89304690-89304712 CTTGGAAACCAGAGAAAACCTGG + Intronic
1121965571 14:98301092-98301114 CTTGAATATCCGAGAAAAGCCGG + Intergenic
1126716483 15:51523741-51523763 CTTGAATATCAGAAAGAGCATGG + Intronic
1127035581 15:54913453-54913475 ATGGAACATAATAGAGAACCTGG + Intergenic
1127531222 15:59845441-59845463 CTTGGAAATCAGAGATAACTAGG + Intergenic
1128124127 15:65178441-65178463 AGTGAACATAAGAGAGAATCAGG + Intronic
1128408391 15:67367600-67367622 CTTGTACATCAGAGCCAACCTGG - Intronic
1130525942 15:84706365-84706387 CCTGACCATCAGAGAGAAATAGG + Intronic
1131291033 15:91107242-91107264 CTTTAGCATCAGACAGAACTGGG + Intronic
1135604697 16:23813305-23813327 CTTGAAAATCAGACAGCATCCGG - Intergenic
1136399229 16:30008886-30008908 CTTGAGCATCAGAGAGGTACGGG + Intronic
1136571836 16:31102695-31102717 CATGAACAACAGAGACAAGCAGG - Intergenic
1136907942 16:34119503-34119525 CTTGAACCTCCCACAGAACCAGG - Intergenic
1139311661 16:66032915-66032937 CTGGAACCTCAGACAGGACCTGG + Intergenic
1140746818 16:77987829-77987851 CTTGGACATTAGAGAGAACTTGG - Intergenic
1145904010 17:28506551-28506573 CTTGAGCTGCAGTGAGAACCTGG - Intronic
1149298463 17:55282992-55283014 GCTGAACACCAGAGAGAATCTGG - Intronic
1149610107 17:57953769-57953791 CTTGAATAGAAGAGAGACCCTGG - Intronic
1152126620 17:78451000-78451022 CTGGAACCTCAGAGAGGCCCTGG + Intronic
1152401164 17:80067077-80067099 CTGGACCCTCAGAGAGAACCTGG - Intronic
1153495494 18:5694118-5694140 AGTGAACATCACAGAGCACCTGG - Intergenic
1155740888 18:29286279-29286301 CTTAAAAATCAGAGAGGACCGGG - Intergenic
1157095712 18:44683804-44683826 CCTGAGCATCAGAGAAAACAGGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1161573029 19:5040710-5040732 CGTGAACCTCAGAGAGCAACAGG - Intronic
1163441045 19:17322797-17322819 CATGAACATCAGAAGGCACCTGG - Exonic
1165550964 19:36585319-36585341 CTTGACCAGCAGAGAGCCCCAGG + Intronic
1167749782 19:51372592-51372614 CTTGAATCTCAGAGAGAAGGAGG + Exonic
925519231 2:4723309-4723331 CTTGGACATCAGAGAGATGGAGG - Intergenic
926754909 2:16226845-16226867 CTGGTGCATCAGACAGAACCCGG + Intergenic
927202994 2:20590051-20590073 CTAGCACATCAGAGACCACCCGG + Intronic
928814085 2:35268726-35268748 ATGGAACAGAAGAGAGAACCTGG - Intergenic
931250516 2:60527209-60527231 CTTGAAAATCAGTGAAAATCAGG - Intronic
934011792 2:87827360-87827382 CTTTTAAATCAGAGATAACCTGG + Intergenic
937459178 2:122070625-122070647 GTTAAACATCAGAGATATCCTGG + Intergenic
940805619 2:158183402-158183424 CTGAAACTTCAGTGAGAACCGGG + Intronic
942119269 2:172760818-172760840 TTTGAACAACAGAGAGAAGATGG + Intronic
943055089 2:182967306-182967328 CTTGCAGATCACAGAGAACTTGG - Exonic
943838454 2:192546272-192546294 CTTGAACTCCAGTGAGAAACTGG + Intergenic
944940545 2:204620481-204620503 CTTTAACATCAGAGGGGACAGGG + Intronic
946146130 2:217732377-217732399 GTTGAGCCACAGAGAGAACCAGG - Intronic
947197153 2:227579709-227579731 CTAAAACATCAGAGAAAAGCAGG - Intergenic
947924059 2:233905591-233905613 CTTGACCACCAGAGAGACACGGG + Intergenic
948630333 2:239298389-239298411 CTTGCACCTCAGAGGGAAACAGG + Intronic
1169113504 20:3047749-3047771 CTTCATCACCCGAGAGAACCTGG + Exonic
1170043348 20:12061069-12061091 CTTGAACATGACAGAGCTCCAGG + Intergenic
1170604106 20:17863162-17863184 CCTGAACAACAGTGAGAACCAGG - Intergenic
1171815058 20:29778652-29778674 CTTGAACCTCCCACAGAACCAGG + Intergenic
1173577437 20:44122145-44122167 CTTGGACATCAGACAGCTCCAGG - Intronic
1173890089 20:46500558-46500580 CTTGAACAACAAAGAGAATTTGG - Exonic
1174281186 20:49440735-49440757 CTTTGACATCAGACAGACCCTGG - Intronic
1174917447 20:54668549-54668571 CCTGAACCTCAGAGAGACCGAGG - Intergenic
1177073972 21:16548816-16548838 CTTGAAAATCTGACAGAGCCTGG - Intergenic
1177329364 21:19636403-19636425 CACGCACATCAGGGAGAACCAGG - Intergenic
1180318493 22:11299206-11299228 CTTGAACCTCCCACAGAACCAGG + Intergenic
1180336775 22:11584026-11584048 CTTGAACCTCCCACAGAACCAGG - Intergenic
1181444775 22:22960588-22960610 CTAGTTTATCAGAGAGAACCAGG + Intergenic
1183515351 22:38262382-38262404 CTTGAAAGTCAGACAGGACCTGG + Intronic
951449151 3:22817313-22817335 CTTGAACATCTCAGAGAGCCGGG + Intergenic
952673921 3:36003361-36003383 CTTGAACATCTGAGAAAATATGG + Intergenic
955202830 3:56866473-56866495 CTTGTCCAGCAGGGAGAACCTGG + Intronic
955805473 3:62729500-62729522 CTTTAATATCAGAGAGACCTTGG + Intronic
958666058 3:97139165-97139187 CATGGACCTCAGAGAGCACCAGG + Intronic
959985881 3:112570839-112570861 CTTGACCATTTAAGAGAACCTGG - Intronic
961491635 3:127260573-127260595 CTTGAAAATAAGAGAGGAGCTGG + Intergenic
961919809 3:130414057-130414079 CTTGTTCATCAGGGAGAACCAGG + Exonic
961955108 3:130793656-130793678 CTTGAACATTAGAAAAAACTTGG + Intergenic
962000764 3:131293723-131293745 CTTCCACATCAGAAAGCACCAGG - Intronic
963226811 3:142870932-142870954 CTTTACCATCAGGGAGAACAGGG - Intronic
966638797 3:182165559-182165581 CCAGAACTGCAGAGAGAACCTGG + Intergenic
966690955 3:182740909-182740931 CAGGAACATCAGGGAGAACAGGG - Intergenic
967668702 3:192206088-192206110 CTTTAGCAGCAGACAGAACCAGG + Intronic
968252920 3:197238244-197238266 CTTGAAAATCACTGAGAACCAGG + Intronic
968477510 4:819052-819074 CTGGGACATCAGACAGAACAGGG - Intronic
968674358 4:1869982-1870004 CATGAACAGAATAGAGAACCCGG - Intergenic
969718453 4:8879844-8879866 CTAGAGCCTCAGAGAGAGCCTGG + Intergenic
970759297 4:19464959-19464981 CTTGAAGCTCAGGGAGAACAAGG - Intergenic
970765084 4:19538731-19538753 CTTCTACATCAGAGAGAGTCAGG + Intergenic
970955842 4:21810388-21810410 CTTAAAAATCAGAGAGAATTTGG + Intronic
974877484 4:67716673-67716695 CGTGAAGATCAGAGTGAAACAGG - Intergenic
975432557 4:74311694-74311716 TTTGTACATCAGAGAGAATCAGG + Intronic
976711076 4:88072324-88072346 CTAGTTCACCAGAGAGAACCAGG - Intronic
977183767 4:93910624-93910646 ATGGAACATAATAGAGAACCTGG - Intergenic
981636605 4:146888229-146888251 GTAGAACTACAGAGAGAACCTGG + Intronic
983028125 4:162762848-162762870 ATTGAACATCAGAGAAAATAAGG - Intergenic
984489870 4:180419462-180419484 CTTGAACTTGAGAGAGAAATGGG + Intergenic
985301375 4:188493667-188493689 TGTGAATATCAGAGAAAACCAGG - Intergenic
990063766 5:51686168-51686190 CTTGAACACTAGAAATAACCAGG - Intergenic
994957052 5:106545689-106545711 CTTCAACATCACAGAGAGGCTGG + Intergenic
995480328 5:112586456-112586478 CTGCAACACCAGTGAGAACCTGG + Intergenic
995922497 5:117330664-117330686 CTAGAATATCAGAGATAAGCAGG + Intergenic
997373168 5:133375346-133375368 ATTTACCATCAGAGAGAACCAGG - Intronic
998245341 5:140497119-140497141 CTTGAACTTCAGAAAGTATCAGG + Exonic
998950790 5:147391401-147391423 CGTGGCCCTCAGAGAGAACCGGG + Exonic
999023743 5:148201224-148201246 CTTGAAGATCAGAGGAAAGCAGG + Intergenic
1000907486 5:166979839-166979861 GATGAACATTAGAGAGAAACCGG - Intergenic
1001196684 5:169679297-169679319 CTTGAACAGAAGAGAGCACTGGG + Intronic
1003939205 6:11007523-11007545 CTAGAACCTCAGAGGGAACAAGG + Intronic
1004857069 6:19762076-19762098 CTTCAAGATCACAGAGAAACTGG + Intergenic
1005058274 6:21751763-21751785 CTTGCACATCACAGAAAGCCAGG + Intergenic
1005708467 6:28480779-28480801 CTTGAACCTCAGAGAGGGCATGG + Intergenic
1006924427 6:37646774-37646796 CGAGAACAACAGAGAGACCCTGG + Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1008034409 6:46731108-46731130 CTTGCACATCAGAGTGAGTCAGG + Intronic
1008779368 6:55084141-55084163 CTTAAACTTCAGAGAGAAAACGG + Intergenic
1012243836 6:96903948-96903970 CTTGAAAATTATAGAGAATCTGG + Intergenic
1012505806 6:99944847-99944869 CTTGAGCAGCAGGCAGAACCAGG - Intronic
1013715412 6:112955283-112955305 CTTTACCATCAGAGTGAACAGGG + Intergenic
1015322468 6:131891813-131891835 TCTGAACAACAGAGAGAAGCAGG - Exonic
1015571590 6:134626663-134626685 CTTGAATGCCAGAGAGAGCCAGG - Intergenic
1017314857 6:153019101-153019123 CTTGAACATCACAGATATCACGG + Intronic
1017770806 6:157643111-157643133 CTTAAACCTCAGAGTGACCCAGG - Intronic
1018689319 6:166332200-166332222 CTTCAACATGAAAGAAAACCTGG + Intronic
1018730916 6:166649805-166649827 CTTGGAAAGCACAGAGAACCTGG + Intronic
1019131895 6:169883042-169883064 CACACACATCAGAGAGAACCAGG - Intergenic
1020591214 7:10139701-10139723 CTTGAACATCAAACAGAACCAGG + Intergenic
1021281857 7:18729504-18729526 TCTGAATATTAGAGAGAACCTGG + Intronic
1021296677 7:18916628-18916650 ATTGAGCTTCAGAGAGAAACGGG + Intronic
1021896419 7:25240204-25240226 CTGGCACAGAAGAGAGAACCAGG + Intergenic
1022699120 7:32740760-32740782 ACTGAACATAAGAGAGAAGCAGG - Intergenic
1022753056 7:33252348-33252370 CTTGAGCCCCAGAGAAAACCTGG - Intronic
1022845732 7:34207906-34207928 CTTGAACAGCTGAGAGAAGAAGG - Intergenic
1023081598 7:36531985-36532007 CTTGAGGAGCCGAGAGAACCTGG - Intronic
1024981648 7:55162076-55162098 GTTGAACATCAAACAGTACCAGG + Intronic
1025960995 7:66221403-66221425 CTTGAGAATCAGAGAGAAAGTGG + Intronic
1026234723 7:68516960-68516982 CTTTAACATCAGTAAGTACCAGG - Intergenic
1026514662 7:71058484-71058506 CTTAAACATCAGAGGGAGTCAGG + Intergenic
1026793127 7:73347989-73348011 CTTGAGCAACAGGGAGTACCTGG - Intronic
1028145637 7:87317323-87317345 CTTGTACTTCAGAGAGCACAAGG - Intergenic
1034383668 7:150720499-150720521 CGTGAGCAACACAGAGAACCGGG + Exonic
1034678689 7:152911408-152911430 CCTGAACTTCAGAAAGAGCCAGG + Intergenic
1036519678 8:9479542-9479564 CATTAACATGAGAGAGAGCCAGG + Intergenic
1037464907 8:19150306-19150328 ATTGAACTTCATAGAGAACCTGG - Intergenic
1038179516 8:25213269-25213291 TTTGGACATCAGAGAGACCCCGG - Intronic
1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG + Intronic
1046993289 8:120486144-120486166 CTAGTTCATTAGAGAGAACCTGG - Intronic
1048794726 8:138139200-138139222 CTTGAAAATAAGAGAGAAGTAGG + Intronic
1048826612 8:138433687-138433709 CTTGAACATCAAAGAGATTTGGG - Intronic
1052844477 9:33322877-33322899 CTAGTTCATCAGAGAGAATCAGG + Intronic
1053168772 9:35863505-35863527 CTGGGACATCAGATAGAAGCTGG + Intergenic
1055991927 9:82115630-82115652 CTTGCAGCTCAGAGAGAAGCTGG + Intergenic
1056589588 9:87955400-87955422 CTTCTCCAACAGAGAGAACCCGG + Intergenic
1058710536 9:107675186-107675208 CTAGAAGGTCAGAGAGAACTGGG + Intergenic
1062133150 9:134911074-134911096 CTTGGAAAGCAGAGAGAACCTGG - Intronic
1062283172 9:135760895-135760917 CTCGCTCATCAGCGAGAACCAGG - Intronic
1185467013 X:361231-361253 CTATAACCTCAGAGAAAACCTGG + Intronic
1185598781 X:1325005-1325027 CTTTAAAAGAAGAGAGAACCTGG - Intergenic
1189163215 X:38832487-38832509 CTTTAAAATCAGAGAGACCCTGG + Intergenic
1190202475 X:48375039-48375061 CTGGAACAAAACAGAGAACCTGG - Intergenic
1190208063 X:48420371-48420393 CTGGAACAAAACAGAGAACCTGG + Intergenic
1190669292 X:52725629-52725651 CTGGAACAAAACAGAGAACCTGG - Intergenic
1190670125 X:52732775-52732797 CTGGAACAAAACAGAGAACCTGG + Intergenic
1192442325 X:71183703-71183725 CTTGACAATCAGAGACAACAAGG + Intergenic
1192742674 X:73908518-73908540 ATAGAACATAATAGAGAACCCGG - Intergenic
1194035137 X:88861587-88861609 TGTAAACATCAGAGAGAACCTGG - Intergenic
1195385488 X:104310037-104310059 CCTGATCCTCAGAGTGAACCTGG - Intergenic
1196085901 X:111681805-111681827 CTTGATCAACTGCGAGAACCGGG - Intronic
1198089338 X:133312317-133312339 CTTAAACATCAGGCAGAAACTGG + Intronic
1198452292 X:136778986-136779008 CTTGAAAAGCTGAGAGAACTTGG - Intronic
1198801635 X:140453695-140453717 CTTGTTTATCAGAGAGAACCAGG - Intergenic
1199132692 X:144211181-144211203 CTTTTAAATCAGAGATAACCTGG - Intergenic
1199575071 X:149306206-149306228 TTTGAACATCAGAGAGAAGGAGG + Intergenic
1200147006 X:153931563-153931585 CTAGCACACTAGAGAGAACCTGG - Intronic
1201071958 Y:10155260-10155282 CTTGAACCTCCCACAGAACCAGG - Intergenic
1201937996 Y:19428095-19428117 CTTGACCATGACACAGAACCAGG - Intergenic