ID: 1097247044

View in Genome Browser
Species Human (GRCh38)
Location 12:57612413-57612435
Sequence ATAGAGGAGGCCAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 1, 2: 2, 3: 55, 4: 617}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097247044_1097247056 6 Left 1097247044 12:57612413-57612435 CCCTCCTCACTGGCCTCCTCTAT 0: 1
1: 1
2: 2
3: 55
4: 617
Right 1097247056 12:57612442-57612464 TACGCATGTGTTGGGGAGGTGGG 0: 1
1: 0
2: 1
3: 11
4: 170
1097247044_1097247053 -1 Left 1097247044 12:57612413-57612435 CCCTCCTCACTGGCCTCCTCTAT 0: 1
1: 1
2: 2
3: 55
4: 617
Right 1097247053 12:57612435-57612457 TTGGGTCTACGCATGTGTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1097247044_1097247051 -3 Left 1097247044 12:57612413-57612435 CCCTCCTCACTGGCCTCCTCTAT 0: 1
1: 1
2: 2
3: 55
4: 617
Right 1097247051 12:57612433-57612455 TATTGGGTCTACGCATGTGTTGG 0: 1
1: 0
2: 0
3: 3
4: 43
1097247044_1097247055 5 Left 1097247044 12:57612413-57612435 CCCTCCTCACTGGCCTCCTCTAT 0: 1
1: 1
2: 2
3: 55
4: 617
Right 1097247055 12:57612441-57612463 CTACGCATGTGTTGGGGAGGTGG 0: 1
1: 1
2: 3
3: 32
4: 239
1097247044_1097247054 2 Left 1097247044 12:57612413-57612435 CCCTCCTCACTGGCCTCCTCTAT 0: 1
1: 1
2: 2
3: 55
4: 617
Right 1097247054 12:57612438-57612460 GGTCTACGCATGTGTTGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 82
1097247044_1097247052 -2 Left 1097247044 12:57612413-57612435 CCCTCCTCACTGGCCTCCTCTAT 0: 1
1: 1
2: 2
3: 55
4: 617
Right 1097247052 12:57612434-57612456 ATTGGGTCTACGCATGTGTTGGG 0: 1
1: 0
2: 2
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097247044 Original CRISPR ATAGAGGAGGCCAGTGAGGA GGG (reversed) Intronic
900166718 1:1246900-1246922 AGTGAGGAGGCCAGAGAGGACGG - Intergenic
900554048 1:3270906-3270928 ACAGAGGAGGACAGTGGGGGAGG + Intronic
900877028 1:5350169-5350191 ATACTGGAGATCAGTGAGGAAGG + Intergenic
900977649 1:6027125-6027147 ATGGAGGAGGCAAGTGAGAGGGG - Intronic
901243603 1:7710719-7710741 ATAGAGGAGGAGAGTGGGGTGGG - Intronic
901498573 1:9637240-9637262 ATAGAAGAGGCCAGGTATGATGG + Intergenic
901652967 1:10753589-10753611 ATAAAGCAGGCCAGGGAGGCGGG + Intronic
901668923 1:10842814-10842836 AGAGACGAGGTCAGTGAGGTTGG - Intergenic
901670462 1:10853024-10853046 GTGGAGGAGGCTAGTGAGGGTGG - Intergenic
902079151 1:13809302-13809324 AGTGAGAAGTCCAGTGAGGAAGG + Intronic
902388685 1:16090376-16090398 AGAGAGCAGGCAAGTGAGGCAGG - Intergenic
902422185 1:16289623-16289645 ATAGTGGAGGGAAGTGAGAATGG - Intronic
902677405 1:18018351-18018373 ATTGAGGAAGGGAGTGAGGAAGG - Intergenic
902775379 1:18671224-18671246 AGAGAGGGGGCCAGTGATGGAGG + Intronic
902868597 1:19298118-19298140 ATAGAGCAGGCAAGAGAAGATGG + Intergenic
902882646 1:19382937-19382959 AGAGAGAAGTCCAGTGAAGATGG - Intronic
903030567 1:20461198-20461220 CTAGAGGAGGCCAGAGGGTAGGG + Intergenic
903179751 1:21599239-21599261 AGAGAGGAGACTAGAGAGGAAGG + Intronic
903627528 1:24742309-24742331 AGAAAGGAGGCCAGTGAAGCTGG + Intergenic
904322607 1:29707300-29707322 AGAGAGGAGGGGAGTGGGGAGGG + Intergenic
904558229 1:31379553-31379575 ATAGGGAAGGCCAGGGAAGATGG - Intergenic
904754942 1:32763406-32763428 AGAGAGGAGGCCAGTATGGCTGG - Intronic
905162539 1:36049197-36049219 AGAGAGGAGGGCAGGGGGGATGG + Intronic
905325980 1:37152272-37152294 AGAGAGGAGGGAAGGGAGGAAGG - Intergenic
905508855 1:38502735-38502757 ATAGAGGAGGAGGGGGAGGAAGG - Intergenic
905685648 1:39905721-39905743 AAAGAGGGTGCCAGTTAGGAGGG + Intergenic
906144764 1:43553427-43553449 ATAGGAATGGCCAGTGAGGAAGG - Intronic
906164162 1:43673248-43673270 ATAGAAGAAGCCAGTGCAGAAGG + Intronic
907316390 1:53575367-53575389 ATGGAGGAGGCCAAAGAGGCAGG - Intronic
907817730 1:57936911-57936933 AGAAAGGAGGCCAGTGTGGCTGG - Intronic
908450305 1:64247900-64247922 AGAGAGGAGGCAAGAGAGGGAGG - Intronic
909300522 1:74007631-74007653 ATAGAGGGGCCCACTGAGGCAGG - Intergenic
910489540 1:87753493-87753515 TTACAGGAGACAAGTGAGGAAGG + Intergenic
910581102 1:88825849-88825871 AGAGATGTGGCCAGAGAGGAAGG - Intronic
911370558 1:96989676-96989698 AGAGAAGGGTCCAGTGAGGAGGG + Intergenic
911731434 1:101296049-101296071 ATCCAGGAGGCCAGTGTGGTTGG + Intergenic
912044513 1:105437433-105437455 AGAGAGGAGACCAGTGACCAAGG - Intergenic
912439342 1:109686972-109686994 AGAGAGCAGGCGAGGGAGGATGG - Intronic
912442652 1:109711412-109711434 AGAGAGCAGGCGAGGGAGGATGG - Intergenic
912670832 1:111622375-111622397 ATGTAGGAGGCCAGTGTGGCTGG - Intronic
913089751 1:115468494-115468516 AAAGGGGAGGCCAGTGTGGACGG + Intergenic
913264105 1:117027620-117027642 AGAGATGAGACCAGTGAGGAGGG + Intronic
913318741 1:117574324-117574346 TGATAGGAGGCCTGTGAGGAGGG - Intergenic
913968819 1:143398417-143398439 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
914063198 1:144224016-144224038 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
914115952 1:144742338-144742360 TGAGATGAGGCCAGAGAGGAGGG + Intergenic
914915625 1:151817486-151817508 ACAGAGGAGGGGAGTGTGGAGGG + Intronic
915168176 1:153960110-153960132 GAAGAGCAGGCCAGTGAGCAGGG + Exonic
915316706 1:155032919-155032941 GTGGAGGAGGCCAGAGAGCAAGG + Intronic
915595445 1:156894022-156894044 GTGGAGGGGGCCAGAGAGGATGG + Intronic
915603886 1:156938916-156938938 ATAGATGAGCCCAGGGAGGAAGG - Intronic
916289272 1:163146655-163146677 GTGGAGGGGGCCAGTGAGGAAGG + Intronic
916511323 1:165474577-165474599 AGGGAGGAGGCCAGTGTGGCTGG + Intergenic
917063480 1:171066318-171066340 ATATGGGAGGTCAGTGAGAAAGG + Intergenic
917621563 1:176801654-176801676 AGAGAGGAGGCCAGGGAAGGAGG + Intronic
917904949 1:179579403-179579425 AAAGAGGAGGCCGGAGAGGTAGG + Intergenic
918237203 1:182592185-182592207 AGCAAGGAGGCCAGTGAGGCTGG + Intergenic
919850352 1:201668179-201668201 AAAGAGCAGGCCAGCAAGGAGGG + Intronic
920038125 1:203078588-203078610 ATACAGGAGGCTGGTGTGGAGGG - Exonic
920264795 1:204713697-204713719 ACAGAGGAGGGGAGAGAGGAAGG + Intergenic
920612695 1:207456867-207456889 AAAGAGAAGGCCAGTGTGGCTGG - Intronic
920989532 1:210923448-210923470 ATTGTGGTGGCCACTGAGGAAGG - Intronic
921224608 1:213005805-213005827 AGTGAGGAGGCCAGTGAGATTGG - Intronic
921273083 1:213490119-213490141 AAAGAGCTGGGCAGTGAGGATGG + Intergenic
921312323 1:213856484-213856506 ATAGAGGAGGGAAGGAAGGAAGG - Intergenic
921412475 1:214850513-214850535 ATGGAGGAGGGCAGAGAAGAAGG - Intergenic
921678253 1:218001511-218001533 AAAGAGAAGGCCAGTGTGGCTGG - Intergenic
921852028 1:219941504-219941526 AGAGAGGAAGGCAGAGAGGAAGG - Intronic
921852045 1:219941576-219941598 AGAGAGGAAGGCAGAGAGGAAGG - Intronic
921951432 1:220934357-220934379 TGAGAGGAGCCCAGTGGGGAGGG - Intergenic
922113091 1:222581811-222581833 AACAAGGAGACCAGTGAGGATGG + Intronic
922633570 1:227140549-227140571 AGAAAGGAGGCCTGTGTGGATGG + Intronic
923265426 1:232309047-232309069 TAAGAGGAGGCCAGTGTGGTGGG - Intergenic
923445416 1:234066350-234066372 CTAGATGAGGCCAGAGAGGTGGG - Intronic
923852780 1:237815620-237815642 ATGAAGGAGAGCAGTGAGGAAGG + Intronic
924124957 1:240840567-240840589 ACAAAGAAGGCCAGTGAGGCCGG - Intronic
924768129 1:247053155-247053177 ATGCAGGAAGCCAGTGAGAAGGG + Intronic
924948208 1:248859807-248859829 ATAGAAGGAGCCAGTGAGGAGGG - Intergenic
1063101198 10:2951378-2951400 GAAGAGGAGGGCAGAGAGGAAGG - Intergenic
1063330806 10:5157496-5157518 AGGGAGGAGGGCAGTGTGGAAGG - Intergenic
1064058542 10:12118175-12118197 ATAGAGGAGGCCAGGCATGGTGG - Intronic
1064134168 10:12736193-12736215 AGAGAGGAGGCAAGTGAGCATGG - Intronic
1064158201 10:12921202-12921224 ATTAAGGAGGCAATTGAGGAAGG + Intronic
1064407313 10:15075628-15075650 ATAGTGGTTGCCAGGGAGGAGGG - Intergenic
1065699635 10:28412180-28412202 TTGGAGGAGTCCAGAGAGGATGG - Intergenic
1067070171 10:43125349-43125371 CTGGAGGAGGGCAGTGAGTAAGG + Intronic
1067224195 10:44364683-44364705 TAAGAGGAGGCCAGTGTGGCTGG + Intergenic
1067360688 10:45575367-45575389 ATAGAGTGGGCCTGTGAGGCTGG - Intronic
1069386093 10:67884680-67884702 GCAGAGGAGGCGAGGGAGGAGGG + Exonic
1069613361 10:69790275-69790297 AAAGAGGAGGCCCCTGAGCAAGG + Intergenic
1069758473 10:70789861-70789883 ATAGAGGAGGCCAGGCACGATGG - Intergenic
1069802435 10:71090474-71090496 TGAAAGGAGGCCAGTGAGGCTGG + Intergenic
1070092542 10:73302277-73302299 ATAAAGAAGGCCAGGGAGGGAGG + Intronic
1070299288 10:75191265-75191287 ATACAGGAGACCAATGAGAAGGG - Intergenic
1070356493 10:75645438-75645460 GTAGAAGAGGCCAGAGAGGAGGG + Intronic
1073059294 10:100723964-100723986 AGAGAGGAGGCCCGCGAGGTGGG + Intergenic
1073494598 10:103879754-103879776 ACTGAGGAGGCCGGGGAGGAGGG + Intergenic
1073788750 10:106918593-106918615 ATAGAGGAGGAGAGGGAGAAAGG + Intronic
1074255705 10:111800267-111800289 AAAGAGGCGGCCTCTGAGGATGG + Intergenic
1074376560 10:112945763-112945785 ATAGAGGATGCCTGTGAAGTGGG + Intergenic
1074765568 10:116697448-116697470 ATAGAGGAGGAGGGGGAGGAGGG + Intronic
1074845512 10:117393962-117393984 TGAGAGAAGGCCAGTGAGGCTGG - Intergenic
1075014269 10:118898760-118898782 ATAGAGTGGGCCTGTGAGGCTGG - Intergenic
1075388839 10:122077665-122077687 ATGAAGGGGGCCAGAGAGGATGG + Intronic
1075985327 10:126780088-126780110 ATAGAGATGGAAAGTGAGGAAGG - Intergenic
1076290886 10:129344497-129344519 AGGAAGGAGGTCAGTGAGGATGG - Intergenic
1077242947 11:1520576-1520598 ACAGAGCAGGACCGTGAGGATGG - Intergenic
1079019625 11:16898769-16898791 AGCAAGGAGGCCAGTTAGGAGGG - Intronic
1079055921 11:17207060-17207082 ATTGAGGAGGGAAATGAGGAAGG - Intronic
1079221747 11:18568833-18568855 ATATTGGAGTCCAGTGAGGTTGG - Intronic
1079492742 11:21007559-21007581 GAAGAGAATGCCAGTGAGGAAGG - Intronic
1079804500 11:24912148-24912170 AAAGAGGAGGAAAGAGAGGAAGG - Intronic
1079944330 11:26722817-26722839 ATGGAGAAGGCCACTGAAGAAGG - Intronic
1080924327 11:36740253-36740275 ATCAAGGAGGCCAGTGTGGCTGG + Intergenic
1081159138 11:39732355-39732377 AGGGAGGCAGCCAGTGAGGATGG + Intergenic
1081258008 11:40921344-40921366 ATGGAGGAGGCCAGGGACCAAGG + Intronic
1081405959 11:42698132-42698154 AGAAAGGAGGCCAGGAAGGAAGG + Intergenic
1082944624 11:58745055-58745077 ACAGAGGAAGACAGTAAGGAAGG + Intergenic
1083053017 11:59793591-59793613 ATACTGGAAGCCAGTGAGGTAGG + Intronic
1083170017 11:60918240-60918262 ATGGACGAGGACAGTGAGCAAGG - Intronic
1083181531 11:60988915-60988937 CTGGAGGAGGGGAGTGAGGAGGG - Intronic
1083856752 11:65396813-65396835 ACAGAGGTGGGCAGGGAGGAAGG - Exonic
1083926269 11:65808946-65808968 AGAGAGGGGGCGAGTGATGAAGG - Intergenic
1083996490 11:66275620-66275642 ATGGAAGAGGGCAGGGAGGAAGG + Intronic
1084036731 11:66515806-66515828 ATGGAGGAGGGCAGCGAGGCCGG + Intronic
1084160923 11:67349670-67349692 ACTGAGGAGGCCAGTGAGGCTGG - Intronic
1084472853 11:69373322-69373344 ATGGAGGAGGCAAGAGAAGAAGG + Intergenic
1084497749 11:69514862-69514884 TTCCAGGAGCCCAGTGAGGAAGG + Intergenic
1084948693 11:72652920-72652942 CTTGAGGAGGCAAGAGAGGAGGG - Intronic
1085735867 11:79038504-79038526 AGAAAGAAGGCCAGTGAAGAGGG - Intronic
1086024224 11:82270572-82270594 AGAGAGGAAGCCAGAGAGAAGGG - Intergenic
1086959686 11:92969595-92969617 AGGGAGGAGGCCAGTGGGGAGGG - Intergenic
1087899858 11:103628183-103628205 AAAGAGGAAGACAGTGAGGGAGG + Intergenic
1087989499 11:104730643-104730665 ACAAAGGAGGCCTGTGGGGAAGG + Intergenic
1087998062 11:104836703-104836725 ATAGAGGAGCCCATAGAAGAGGG - Intergenic
1088634548 11:111807315-111807337 AAACAGGAGGCCAGTGAGGCTGG - Intronic
1088739647 11:112756763-112756785 ACATAGCAGGACAGTGAGGACGG + Intergenic
1088752503 11:112856406-112856428 TTAGAGGAGGCCAGGGTGGGAGG + Intergenic
1089787859 11:120920927-120920949 CAAGAGGAGGCCAGTGAGTGTGG - Intronic
1089809630 11:121121110-121121132 ATAGATGAGGAAATTGAGGATGG - Intronic
1090076764 11:123584603-123584625 AAAGAGGAGACCAGTCAGGGAGG + Intronic
1090257733 11:125297648-125297670 ATAGATGAGGCTGGTGAGGAAGG - Intronic
1090297213 11:125599326-125599348 AGAGAGGTGGGCAGAGAGGACGG + Intronic
1090531935 11:127600140-127600162 GCAGAGGAAGCCAGAGAGGATGG + Intergenic
1091669028 12:2439171-2439193 ATAGAGGAGGTCAGTGGAGAAGG + Intronic
1092068005 12:5608127-5608149 ATTGAGCCTGCCAGTGAGGAAGG - Intronic
1092192482 12:6531055-6531077 AGTGATGAGTCCAGTGAGGAAGG + Exonic
1092763418 12:11830016-11830038 AGAGAGCAGGCCGGTGGGGAAGG + Intronic
1092778614 12:11965182-11965204 ATAGAGGGAGAAAGTGAGGAAGG - Intergenic
1093203409 12:16217543-16217565 ATAGAGGAGGACATTGAGGCTGG - Intronic
1093546878 12:20359204-20359226 ATGGAGCACTCCAGTGAGGAAGG + Intergenic
1093854828 12:24088870-24088892 ATTCAGAAGGCCAGTGAAGAAGG - Intergenic
1094016965 12:25875136-25875158 CTGGAGGAGGCCAGTCAGGATGG - Intergenic
1094188001 12:27665359-27665381 ATAGAGGAGGAGAGTGAAGAAGG + Intronic
1094475660 12:30838857-30838879 ATATAGGAGGTCAGTGGGGAGGG + Intergenic
1094503338 12:31039274-31039296 GTACAGGAGGTCAGTGGGGAGGG + Intergenic
1095957794 12:47816763-47816785 CTGGAGGAGGGCAGTGGGGATGG + Intronic
1096281171 12:50255141-50255163 AGAGAGGAGGCCACTGAGATCGG - Intronic
1096804097 12:54129777-54129799 GTACAAGAGGCCAGTGAGGCAGG + Intergenic
1097035425 12:56120629-56120651 AGCGAGGAGGCCAGTGGGGCAGG + Exonic
1097247044 12:57612413-57612435 ATAGAGGAGGCCAGTGAGGAGGG - Intronic
1097451670 12:59744393-59744415 AAAGAGGAGTCCAGCGGGGAAGG + Intronic
1098033329 12:66277243-66277265 ATATGGGAGGCCAATCAGGAAGG - Intergenic
1098048632 12:66428886-66428908 AGAGAGGTGGGCTGTGAGGAAGG + Intronic
1098904174 12:76144843-76144865 TTAGGTGAGGCCTGTGAGGAGGG + Intergenic
1100497408 12:95138644-95138666 ATAAAGAAGGCCAGTGTGGTGGG - Intronic
1100957200 12:99922060-99922082 ATAGAGGAGGAAACTGAGCAGGG - Intronic
1101897295 12:108766267-108766289 GTGGAGGAGACCAGTAAGGATGG - Intergenic
1102236427 12:111297052-111297074 AGAGAGGAGGCCTGTCTGGAAGG - Intronic
1102254536 12:111407820-111407842 GTGGAGGAGGATAGTGAGGAGGG + Intronic
1102260236 12:111438865-111438887 AGAGTGGAGGCCAGTGTGGCTGG + Intronic
1102425101 12:112837906-112837928 ATAGAGGAAGGGAGGGAGGAAGG - Intronic
1102500823 12:113351152-113351174 ATCAAGGAGGCCAGGGTGGATGG + Intronic
1102517210 12:113457716-113457738 ATGGAGGAGGAAAGGGAGGAGGG + Intergenic
1103340782 12:120220129-120220151 AGAGATGAGGGGAGTGAGGACGG + Intronic
1103712325 12:122922002-122922024 ATAGAGGCGGCTAGGGAGGGAGG + Intronic
1103757801 12:123223524-123223546 ACAGAGGATGCCCGTGAGGCAGG - Intronic
1104676461 12:130715103-130715125 ATGGAGCAGGCCTGAGAGGAGGG - Intronic
1104756585 12:131273449-131273471 GGAGAGGAGGCCAGAGAGAAGGG + Intergenic
1104757427 12:131277871-131277893 ATGGGGGAGGCCCGTGAGGGAGG + Intergenic
1105950151 13:25223054-25223076 ATAAAGGAGGCCAGAGAGGTAGG + Intergenic
1106387231 13:29299639-29299661 ATAGAAGTGGCCGGTGATGATGG + Intronic
1106753429 13:32797457-32797479 ATAGAGGAGGGCAGAGGGAAGGG + Intergenic
1107034184 13:35883394-35883416 AGAGAGGAGGCAAGGGAGAAGGG - Intronic
1108131005 13:47300376-47300398 ATAGCTGAGGACAGTGTGGAGGG + Intergenic
1108867791 13:54942392-54942414 ATAGAGGGGGCGAGCTAGGAGGG + Intergenic
1109187522 13:59288224-59288246 ATAGGGCAGGCAAGTGATGATGG + Intergenic
1110792215 13:79599079-79599101 ATAGATGAGGCAAATGAGAAAGG + Intergenic
1111069766 13:83150372-83150394 ATACAGCAGGCCAGGGTGGAAGG - Intergenic
1111261762 13:85749691-85749713 ATAAAGCAGGCAAGAGAGGATGG - Intergenic
1111686539 13:91508406-91508428 ATAAAGGAGGGCAGACAGGATGG + Intronic
1112407673 13:99135542-99135564 ATGGAGGAGGCCAGTGGCAAGGG + Intergenic
1113036681 13:106057441-106057463 ATAGAGGGGGTCATGGAGGATGG + Intergenic
1113179481 13:107609120-107609142 TTAGAGGTGGCCAGGGAGGGAGG - Intronic
1113598897 13:111554491-111554513 GGAGAGGAGGCCAGACAGGAGGG - Intergenic
1114199935 14:20510625-20510647 AAAGCTGAGGCCACTGAGGAGGG + Exonic
1114421407 14:22586634-22586656 ATGGAGGAGTCCAGTGAGCTGGG - Intronic
1115288209 14:31741345-31741367 AGGGAGGAGGGCAGTGAGCAGGG - Intronic
1117942728 14:60985887-60985909 AGAGAGGAAGCGAGAGAGGAGGG + Intronic
1118022270 14:61729711-61729733 AGAGAGGAGGCCAGGGAGAAAGG + Intronic
1118229694 14:63936597-63936619 ATACAGGAGGCCAGAGTGGTTGG + Intronic
1118812044 14:69282329-69282351 AGAAAGGAGGTCAGTGTGGAAGG - Intronic
1118888621 14:69888066-69888088 GTAGAGGATGTCAGTGTGGAGGG + Intronic
1119204345 14:72783010-72783032 AGAAAGGAGTGCAGTGAGGATGG - Intronic
1119412510 14:74442464-74442486 AGAAAGAAGGCCAGTGAGGTGGG + Intergenic
1119549232 14:75496405-75496427 ACAGATGAGGCCACTGAGGCTGG + Intergenic
1119726144 14:76922879-76922901 AGAGGGGAGGACAGGGAGGAGGG - Intergenic
1120504030 14:85332064-85332086 AGAGAGGAGACAAGTGAGAAGGG - Intergenic
1120691480 14:87598009-87598031 AGAGAGGAAGCCAGAGAGAAAGG - Intergenic
1121410847 14:93747179-93747201 ACAGGGGAGGCTTGTGAGGAAGG + Intronic
1121726112 14:96151360-96151382 AGGGGGGAGGCCAGTGAGCAGGG - Intergenic
1122120686 14:99552003-99552025 TAAGAGGAGGCCAAGGAGGATGG + Intronic
1124141424 15:27080533-27080555 ATTCAGGAGGCCAGGGTGGAAGG + Intronic
1124381619 15:29172486-29172508 TTGGAGCAGGCCAGTGGGGATGG + Intronic
1125193838 15:37023883-37023905 GAAAAGGAGGCCAGTGAAGATGG - Intronic
1125267310 15:37897983-37898005 AGAGAGGAGGCCAATGTGGCTGG - Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1125605513 15:40937823-40937845 ATGGAGGAAGCCAGTGGGAAGGG - Intronic
1125724984 15:41863596-41863618 ACAGGAGAGGCCAGTGAGGGGGG + Intronic
1125815369 15:42579579-42579601 AGAGAGGAAGACAGTGAGGGAGG + Intronic
1126131735 15:45348451-45348473 AGCGAGGAGGCCTGTGAGGCTGG + Intergenic
1126196286 15:45935633-45935655 ATAGAGGAGGGGAGGGAGGGAGG + Intergenic
1126858704 15:52863164-52863186 CTAGAAGGGGCCAGTGTGGAGGG + Intergenic
1127500911 15:59553466-59553488 ATGGAAGAGGCCAAAGAGGAAGG + Intergenic
1128028953 15:64462156-64462178 TTGGAGGAGGCCAGAGAGAAAGG + Intronic
1128048712 15:64643183-64643205 CAAGAGGATGCCTGTGAGGAAGG - Intronic
1128090070 15:64913175-64913197 ATAGAGGGTGCCAGACAGGAAGG + Intronic
1128156814 15:65396468-65396490 ATATGGGAGGGCAGGGAGGAAGG - Intronic
1128610418 15:69068493-69068515 ATAGAGGAAGACAGGGAGGAAGG - Intergenic
1129188506 15:73924659-73924681 ACAGAGGATGGCTGTGAGGAAGG - Intergenic
1129192562 15:73946184-73946206 ATGGTGGAGGCCAGAAAGGAGGG + Intronic
1129503689 15:76063421-76063443 AGCAAGGAGGCCAGTGTGGATGG - Intronic
1131176614 15:90213337-90213359 AGAGATGAGGCAAGTGTGGAAGG + Intronic
1131962884 15:97807891-97807913 ATAGAGGAGGAAACTGAGGCCGG - Intergenic
1133667121 16:7979476-7979498 AGGCAGGAGGCCAGTGAAGAAGG - Intergenic
1133774136 16:8884576-8884598 ATAGGGGAGGCCAGTTGGGTGGG + Intergenic
1133812817 16:9174313-9174335 ATGGAGGAAGGCAGAGAGGAGGG + Intergenic
1134089705 16:11384953-11384975 ATTGAGCTGGCCAGCGAGGACGG - Exonic
1134867119 16:17618332-17618354 GGGGAGGAGGACAGTGAGGATGG + Intergenic
1135059425 16:19258351-19258373 ATAGAGGAGGCCAGGCACGGTGG + Intronic
1135939161 16:26806004-26806026 ACAGAGGAGGCCAGAGTGGCTGG - Intergenic
1136481471 16:30544748-30544770 ATAGAGGGGGCAAGCTAGGAGGG + Intronic
1136530302 16:30863743-30863765 ATAGAATAGGCCTGTGAGGCTGG - Intronic
1137756952 16:50910044-50910066 ATAGGGCAGGCCAGTGTGGCTGG - Intergenic
1138329557 16:56202628-56202650 AGACAGGAGGACAGTAAGGATGG + Intronic
1138351572 16:56348786-56348808 CTCGGGGAGGGCAGTGAGGAGGG - Intronic
1138493050 16:57387891-57387913 AGAGAGGAGGCAAGGAAGGAAGG + Intergenic
1140128531 16:72137589-72137611 ATGGAGGAGGCAAGTGCGGCTGG + Intronic
1140894232 16:79311065-79311087 AGAGGGGAGGCCAGTGCTGAGGG - Intergenic
1141592367 16:85077384-85077406 CAAGACGAGGCCAGTGAGGCTGG - Intronic
1142406151 16:89891364-89891386 AGAGTGGAGGCCAGTGTGGTGGG - Intronic
1142406416 16:89892782-89892804 AGAGTGGAGGCCAGTGTGGAAGG - Intronic
1142977433 17:3654087-3654109 AAGGAGGAGCCCAGTGATGATGG + Intronic
1143129457 17:4667803-4667825 AGCAAGGAGGCCAGTGAGGTTGG - Intergenic
1143267312 17:5649338-5649360 ATAGAGGGGGGCTATGAGGAAGG - Intergenic
1143463120 17:7116621-7116643 AAAGGGGTGGCCAATGAGGATGG - Intergenic
1143565242 17:7717029-7717051 AGAGAGGAGGCGAGAGGGGAGGG - Intergenic
1144401933 17:14913012-14913034 AAAGAGAAGGCTAGTGAGGGAGG + Intergenic
1145288409 17:21523312-21523334 GAAGAGGGGGCCAGTGGGGAGGG + Intergenic
1146175749 17:30665264-30665286 AAAGAGGAAGCCAGTCATGATGG - Intergenic
1146349197 17:32081345-32081367 AAAGAGGAAGCCAGTCATGATGG - Intergenic
1146426347 17:32743096-32743118 TGAGAGCATGCCAGTGAGGAAGG - Intronic
1146669695 17:34728475-34728497 AGAGAGGAGGGGAGAGAGGAGGG + Intergenic
1146806769 17:35871178-35871200 AGAGGGTAGGCCAGGGAGGAAGG + Intergenic
1147036306 17:37684032-37684054 ATGGAGGAATCCAGTGAGCAAGG - Intergenic
1147429866 17:40364487-40364509 GCACAGGAGGCCAGGGAGGAGGG - Exonic
1148442018 17:47716368-47716390 TTAGAGGAGGCCAGGGCGAAAGG + Intergenic
1148616655 17:49005598-49005620 ATAGAGGAGGCAGGAGAAGAGGG + Intronic
1149998268 17:61416306-61416328 CTAGAGGTGGGCAGTGGGGATGG - Intergenic
1150315688 17:64166878-64166900 GTAGAGGAGGCCAGTCTGGTGGG + Intronic
1150347903 17:64418722-64418744 CTTTGGGAGGCCAGTGAGGAAGG - Intergenic
1150833929 17:68547902-68547924 ATTCAGGAGGCTAGTAAGGAAGG - Intronic
1151458232 17:74239328-74239350 ATGGAGGAGGCACGTGGGGAGGG + Intronic
1151647180 17:75441259-75441281 AGAGAGAAGGCCAGTGTGGCTGG + Intronic
1151716409 17:75833228-75833250 GTAGAGGAGGCCAGTGTGGCTGG - Intronic
1152020863 17:77779635-77779657 TTAGAGGAGGGCAGTTAGGGTGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152520429 17:80852889-80852911 GACGAGGAGGCCAGTGAGGGTGG - Intronic
1152691979 17:81722457-81722479 GGAGAGGAGGCCAGTGGGCAGGG + Intergenic
1153001863 18:463102-463124 AAGGAGGAGGCCAGTGGGAATGG - Intronic
1155034987 18:22018614-22018636 AGAGAGGAAGCCAGTGAGGCTGG + Intergenic
1155854147 18:30811132-30811154 TTAGGGCAGGTCAGTGAGGATGG + Intergenic
1155962993 18:32010455-32010477 AGAGGGGAGGCCAGTGAGCCAGG + Intergenic
1156476331 18:37408137-37408159 AGAGAGGAGGGCGGTGAGGTGGG - Intronic
1157750400 18:50173289-50173311 AAAGAGGAGGCCAGTGCGGATGG + Intronic
1160988416 19:1850847-1850869 AGCGAGGAGGCCAGTGTGGCTGG + Intergenic
1161138228 19:2633280-2633302 CGAGTGGAGGCCAGAGAGGATGG - Intronic
1161178409 19:2862667-2862689 TTAGAGGAGGACAGTGGGTATGG + Intergenic
1161289394 19:3484982-3485004 AGTGAGGAGGCCAGTGTGGCTGG + Intergenic
1162790242 19:13058998-13059020 TGAGAGGAGGCAAATGAGGATGG - Intronic
1162820717 19:13221816-13221838 GAAGAGGAGGCCAGGGAGGCGGG - Intronic
1163009508 19:14416182-14416204 ATAGAGGAGTCGGGTTAGGAGGG - Intronic
1163080531 19:14937809-14937831 CTAAAGGAGGCCAGGGAAGATGG + Intergenic
1163131164 19:15274085-15274107 AGATAGGAGGCCAGTGAGATAGG + Intronic
1163131908 19:15279433-15279455 ATGGAGGATACCAGTGAAGAGGG - Intronic
1163572377 19:18090072-18090094 ATGGAGGAGGCCAGGCAGGGTGG + Intronic
1164202147 19:23027806-23027828 ATAGAATAGGCCTGTGAGGCTGG + Intergenic
1164421758 19:28099689-28099711 GTAGAGGAGTTCAGTGAAGAGGG + Intergenic
1164423640 19:28119952-28119974 ACATGGGAGGCAAGTGAGGAGGG - Intergenic
1165745275 19:38226924-38226946 GTAGAGGAGGACTGTTAGGAAGG - Intronic
1165948471 19:39459157-39459179 AGGGAGGAGGGCAGTCAGGAAGG - Intronic
1166095127 19:40533643-40533665 ATAGAGGGAGCCAGAGAGGCAGG - Intronic
1166107733 19:40605654-40605676 TGAGAGGAGGCCCGTGGGGAGGG + Intronic
1166645824 19:44530903-44530925 ATAGAGGAAGTGAGAGAGGATGG + Intergenic
1166990598 19:46690376-46690398 GGAGATGAGGCCAGGGAGGAGGG - Intronic
1167413714 19:49359999-49360021 AGTGAGGAAGGCAGTGAGGAGGG - Exonic
1167624417 19:50578125-50578147 AAAGAGGAGGAAAGTGAGGGAGG - Intergenic
1167729000 19:51239472-51239494 TTAGAGCAGGGCAGTGAGGAGGG - Intronic
1168058020 19:53874260-53874282 ATAGAGGAGGACAGACAGCAAGG - Exonic
1202702608 1_KI270712v1_random:175887-175909 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
925216527 2:2100760-2100782 ATTAAGGAGACCAGTGAGTATGG - Intronic
925886758 2:8400395-8400417 AGAGAGGAGACCTGTGAGCAAGG - Intergenic
925929719 2:8697278-8697300 TTAGAGCAGGCCACAGAGGAAGG + Intergenic
926365942 2:12133290-12133312 ACAGAAGAGGCCAGAGAGGTAGG - Intergenic
926731571 2:16039452-16039474 AGAGAGGAAGACAGGGAGGAGGG - Intergenic
926869510 2:17397814-17397836 ATACAGGGGGCCAGTGAAGCAGG + Intergenic
927083590 2:19653617-19653639 ATGGAGGAGGGCAGAGAGGATGG + Intergenic
927442364 2:23128223-23128245 GTAGAGGAAGCCAAGGAGGATGG - Intergenic
927468968 2:23358050-23358072 GTGGAGGAGGACAGTGATGAAGG + Intergenic
927719299 2:25372751-25372773 AAAGAGGAGCCCACGGAGGAGGG + Intergenic
929585071 2:43108492-43108514 GGAGAGGAGGGGAGTGAGGAAGG + Intergenic
929795530 2:45055770-45055792 AGAGAGGTAGCCAGAGAGGAGGG - Intergenic
929948856 2:46390794-46390816 ATAGAGGAGGCCAGGCACGGTGG - Intergenic
930010429 2:46933917-46933939 AAAGAAGAGGCCAGAGTGGAAGG + Intronic
930621270 2:53646342-53646364 ATTGGGGAAGCCAGTGAGTAGGG - Intronic
931289912 2:60863376-60863398 ATAGAGAAGGCCAGTGTGTCCGG - Intergenic
933549120 2:83752498-83752520 AAAGAGGAAGCCAGAAAGGAAGG + Intergenic
934040556 2:88124598-88124620 AGAGAGGTGACCTGTGAGGAAGG + Intronic
934173518 2:89559340-89559362 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
934283832 2:91633693-91633715 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
934559177 2:95303497-95303519 CTAGATGTGGCCAGTGAGGGAGG - Intronic
935545419 2:104395483-104395505 GTAGATGAGGCCTGTCAGGAGGG - Intergenic
936011569 2:108928424-108928446 AGTGATGAGGCCAGTGGGGACGG - Intronic
936140451 2:109935587-109935609 ATAAAGGAAGCCATTGAGGCTGG + Intergenic
936177142 2:110233532-110233554 ATAAAGGAAGCCATTGAGGCTGG + Intergenic
936204243 2:110435899-110435921 ATAAAGGAAGCCATTGAGGCTGG - Intronic
937036497 2:118786659-118786681 AGAGAGAAGCCCAGTGGGGACGG - Intergenic
937100697 2:119265790-119265812 CTAGAGCTGGCCAATGAGGAAGG + Intergenic
937207067 2:120243591-120243613 AGAGAGGAGGCCAGAGTGGCAGG - Intronic
937231491 2:120400633-120400655 ATAGAGGAAGCCAGAAAGGCTGG - Intergenic
937835893 2:126469971-126469993 ATAGAGTGGGGCAGGGAGGAGGG - Intergenic
939189681 2:138901926-138901948 ATGGATGAGGCCTGTCAGGAGGG - Intergenic
939460224 2:142489593-142489615 AGAGAGAAGGCCAGTGTTGAGGG + Intergenic
940078932 2:149778148-149778170 AGCGAGGAGGCCAGTGACAATGG + Intergenic
940934742 2:159478676-159478698 GTAGAGGAGGCTGCTGAGGATGG + Exonic
941203229 2:162540821-162540843 ATAGAGGAGGCCAGGATGGAAGG + Intronic
941388499 2:164882352-164882374 TCAGAGGAGGCCTGTGATGATGG + Intergenic
941565618 2:167102341-167102363 ATAAAGATGGCCAGTGAGAAAGG - Intronic
942261450 2:174168697-174168719 AGAAAGGAGGGCAGGGAGGAAGG + Intronic
942887199 2:180940040-180940062 AGAAAGGAGGCCAATGTGGAGGG - Intergenic
944407030 2:199396587-199396609 AGAGAGGAGCCAAGTGAGGATGG + Intronic
945187222 2:207151386-207151408 ATTGAGGAGGGCAGGGGGGAGGG + Intronic
945271530 2:207945291-207945313 ATAGAGGAGAAAAGTGAGCACGG - Intronic
945542467 2:211105611-211105633 ATAGAGCAGGCCACTGAGCAAGG - Intergenic
945930438 2:215849609-215849631 GTAGAGGTGGCGTGTGAGGAAGG - Intergenic
947077819 2:226364165-226364187 AGAGAGGAGGGGAGGGAGGAGGG + Intergenic
947178442 2:227391020-227391042 ATAGATGGGGCCAGTTAGGAAGG + Intergenic
947224515 2:227826887-227826909 AAAGATGAGGGCAGTGAGAACGG - Intergenic
947279088 2:228428224-228428246 ACTGAGGATGCCACTGAGGAGGG - Intergenic
948178529 2:235962254-235962276 ACAGAGGAGGCCGGTGTGCATGG + Intronic
948433314 2:237934513-237934535 GTAGAGGAGGCCAGCCAGCAGGG - Intergenic
948930417 2:241128321-241128343 AGAGAGGAGGCTGGTGAGGGCGG + Intronic
948947364 2:241227819-241227841 ACGGGGGAGGCCAGTGGGGAAGG - Exonic
949002972 2:241628013-241628035 GGAGAGGGGGCCAGTGATGAGGG - Intronic
1168788694 20:561565-561587 AGCAAGGAGGCCAGTGAGGCCGG + Intergenic
1169761726 20:9102310-9102332 ATAGAGGTAGCCAATGAAGATGG + Intronic
1170770829 20:19331055-19331077 TTAGAGGAGACCAGGGAGGTGGG + Intronic
1170833017 20:19859797-19859819 ATAGAGAACGCAGGTGAGGAAGG - Intergenic
1170907525 20:20529093-20529115 GGAGAGGAGGGCAGTGGGGAGGG + Intronic
1172197116 20:33099561-33099583 AGAGAGGAGGCCAGAGAGCAAGG - Intronic
1172357533 20:34290599-34290621 ATGGATGAGGCCTGTCAGGAGGG - Exonic
1172773914 20:37396512-37396534 AGAGAGGGGGACAGGGAGGAGGG - Intronic
1172831180 20:37836372-37836394 AGAGGGGAGGCCAGTGAGGTGGG - Intronic
1173609873 20:44359242-44359264 AGTGAGGAGGGCAGAGAGGAAGG - Intronic
1173953444 20:47011529-47011551 AGCAAGGAGGCCAGTGAGGCTGG - Intronic
1174101397 20:48128815-48128837 ATAGAGGAGGCATCTGAGGGAGG - Intergenic
1174115324 20:48222998-48223020 AAGCAGGAGGTCAGTGAGGAGGG + Intergenic
1174276736 20:49409540-49409562 AGAAAGGAGGCCAGTGTGGCCGG + Intronic
1174306023 20:49614906-49614928 AGTGAGGAGGCCAGAGAGGCTGG + Intergenic
1174411613 20:50340263-50340285 AAAGAGGAGCCCAGTGTGGCAGG - Intergenic
1174416968 20:50373863-50373885 AGGGAGGAGGCCAGTGTGGCTGG + Intergenic
1174774566 20:53331993-53332015 CCAGAGGAGGGCAGTGAAGATGG - Intronic
1175077529 20:56388903-56388925 GTAGAGGTGGCAAGTGTGGACGG - Intronic
1175116860 20:56688985-56689007 TCAGAGAAGGCCAGAGAGGATGG + Intergenic
1175187690 20:57190067-57190089 AGTGAAGAGGCCAGTGAGGCTGG + Intronic
1175366334 20:58458832-58458854 AGAGAGAAGGCCAGTGTGGCCGG + Intergenic
1175437110 20:58961276-58961298 GGAGAGGAGGCAAGTGAGGTGGG - Intergenic
1177720713 21:24903197-24903219 GTAGAGGAGCCAAGTCAGGATGG - Intergenic
1178822859 21:35991336-35991358 ACAGAGCAGGAGAGTGAGGAGGG + Intronic
1179366125 21:40759811-40759833 ATAGAAGGCGGCAGTGAGGAAGG - Intronic
1179612699 21:42562897-42562919 AAAGAGGAGGCCTTTGAGAATGG + Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1180142086 21:45898876-45898898 AAAGAGGAAGGCTGTGAGGACGG - Intronic
1180910534 22:19447165-19447187 AAGGAGGAGACCAGCGAGGAGGG - Intronic
1181108640 22:20589060-20589082 ACAGAGGAGGCAACTGAGGCAGG - Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181860963 22:25817940-25817962 CTCCAGGAGGGCAGTGAGGAAGG + Intronic
1182058843 22:27382328-27382350 CCAAAGGAGGCCAGTGGGGAAGG + Intergenic
1182415328 22:30217737-30217759 AAGGAGGAGGCCAGTGGGGAGGG - Intergenic
1182454351 22:30440284-30440306 GAAGAGCAGGCCAGTGAGCAGGG - Intergenic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1184015665 22:41784093-41784115 ATGGAGGAGGCCAGTGAGGATGG + Intronic
1184537959 22:45100254-45100276 GCAGAGGTGGCCGGTGAGGAGGG + Intergenic
1184719696 22:46303931-46303953 AGTGAGGAGGCCAGGGAGCAGGG + Intronic
1185062264 22:48613209-48613231 AGAGAGGACTCCAGGGAGGAAGG - Intronic
1185102634 22:48849885-48849907 AGAGAGGAAGACAGTGGGGAGGG + Intronic
1185279690 22:49964757-49964779 GTAGAGGAGGCCTGGGTGGAGGG + Intergenic
949862108 3:8515365-8515387 ATGGAGGAGGGCACTGAGGAAGG - Intronic
950155141 3:10716355-10716377 AGGGAGGAGGCCAGTGTGGCTGG - Intergenic
950183746 3:10932647-10932669 GGAGATGAGGCCAATGAGGAGGG + Intronic
950617946 3:14177534-14177556 AGAAAGGAGGCCAATAAGGAGGG + Intronic
951310784 3:21124371-21124393 ATAGATGATGCCAGTGATGCTGG - Intergenic
951824762 3:26856319-26856341 ATAGAAGGGGCCAGTGAGAAGGG - Intergenic
952322347 3:32289841-32289863 AAAAAGGAGGCCAGTCATGATGG + Intronic
952835338 3:37597271-37597293 ATCCAGGAGGCCAGGGAGAAAGG + Intronic
953270462 3:41437910-41437932 GAAGAGAAGGCCAGTGAGAAGGG + Intronic
953663223 3:44906044-44906066 ATAGATAAGGCCAGAGAGGGAGG + Intronic
953737636 3:45509966-45509988 AAAGTGGAGGCAAGAGAGGAGGG - Intronic
953903143 3:46854568-46854590 AGCAGGGAGGCCAGTGAGGAGGG - Intergenic
953974820 3:47374484-47374506 GTATTGCAGGCCAGTGAGGAAGG - Intergenic
954379672 3:50212939-50212961 AGAGTGGAGACCAGTGAGGGGGG - Intronic
954942813 3:54390574-54390596 ATAGAGGAGTTCACTGAGGTCGG - Intronic
955015382 3:55064523-55064545 AGAGAGGAGGGCTGTGAGGAGGG - Intronic
955120050 3:56049066-56049088 ACAGAGGAGGCCAGTAAGGCAGG + Intronic
955328777 3:58029892-58029914 ATAGATGAGAGCAGTGAGGACGG - Intronic
957361440 3:79164524-79164546 ATAAAGCAGGCAAATGAGGATGG - Intronic
958858013 3:99410206-99410228 GTTGGGGAGGCCAGTGAGGAAGG - Intergenic
959941996 3:112090049-112090071 AGAGATGAAGCCAGTGAAGAAGG + Intronic
959996746 3:112688733-112688755 ATAGAGGAAGCAAGGGATGAAGG - Intergenic
960436699 3:117635012-117635034 ATAGATGAGGCCAGGTGGGATGG - Intergenic
960589246 3:119349685-119349707 ATTGAAGAGGTCAGGGAGGAGGG - Intronic
960610495 3:119550923-119550945 ATGGAGGGGGGCAGGGAGGATGG - Intronic
960692506 3:120361544-120361566 AGAGATGAGGCCAGAGAGGGAGG + Intergenic
961441194 3:126954311-126954333 GTAGGAGAAGCCAGTGAGGAGGG + Intronic
961449037 3:126994241-126994263 AGAGAGGGGGTCACTGAGGAAGG - Intronic
961522727 3:127476628-127476650 AGAAAAGAGGCAAGTGAGGAAGG + Intergenic
962661571 3:137606276-137606298 GTAGAGGAAGGCAGGGAGGAAGG - Intergenic
962745711 3:138396157-138396179 AGAGAAGACCCCAGTGAGGATGG + Intronic
963107319 3:141658426-141658448 GCAGAGGAGGGCAGTGAGGGAGG - Intergenic
964528631 3:157643376-157643398 GTGGAGGTGGCAAGTGAGGATGG + Intronic
964891674 3:161543921-161543943 ATCCAGGAGGCCAGTGTGGCTGG + Intergenic
966655744 3:182356805-182356827 GCATAGGAGGCCAGAGAGGAAGG + Intergenic
967616910 3:191580987-191581009 AGAGAGGAGGTCAGTGACTATGG - Intergenic
968188831 3:196652855-196652877 CAAGAGGTGGCCAGGGAGGAAGG + Intronic
968445930 4:652036-652058 AGTGTGGAGGCCAGTGAGGAGGG + Intronic
968483085 4:845500-845522 ATGCAGGAGGCCAGTGTGGCTGG - Intergenic
968808173 4:2788310-2788332 AGAGGGGAGGCCAGTGTGCAGGG + Intergenic
968830781 4:2932143-2932165 ATAGAGGGCGCCTGTGGGGATGG + Exonic
969037570 4:4267077-4267099 GTAGATGGGGCCAGTGTGGATGG + Intergenic
969796335 4:9531157-9531179 ACCGGGGAGGCCAGGGAGGAAGG - Intergenic
969827379 4:9768153-9768175 TGAGATGAGGCCAGAGAGGAGGG - Intergenic
970167792 4:13258054-13258076 ATAGAGGATGCATGTAAGGAAGG + Intergenic
972345708 4:38190779-38190801 AGAGAGGAGGACATTGAAGAAGG + Intergenic
972580222 4:40388553-40388575 AGAGAGGAGGCCAGTGTGGCTGG + Intergenic
972834519 4:42853540-42853562 ATACAGGAGGGAAGAGAGGAAGG + Intergenic
974596820 4:64024319-64024341 GAGGAGGAGGCTAGTGAGGAGGG + Intergenic
975760921 4:77618867-77618889 ATTGAAGAGGGCAGTGAGGGCGG + Intergenic
975898323 4:79121430-79121452 ACAGTGGAGGCCAGAGAGAATGG + Intergenic
976243748 4:82986901-82986923 ATAGATGAGGCCATTTAGAAAGG + Intronic
976652511 4:87451236-87451258 ATTGAGGAGGTCAGTGTGGCTGG + Intronic
976674129 4:87685643-87685665 ATGGAGGAGGCCAGTGAGGCTGG - Intergenic
977700550 4:100017255-100017277 AGAGAGGAGGGCAGAGATGAGGG + Intergenic
978477595 4:109148556-109148578 ATAGAGCAGGGCAGTGTGAAGGG - Intronic
979673871 4:123389645-123389667 AAAGAGGAGGTCAGAAAGGAAGG - Intergenic
980094966 4:128480043-128480065 AGAAAGGACGCCAGTGAGGCTGG - Intergenic
980896928 4:138868973-138868995 AGAGAGGAGGGGAGTGGGGAAGG + Intergenic
981551863 4:145949850-145949872 GTTGAGCAGGACAGTGAGGAGGG + Intergenic
984153183 4:176160247-176160269 AGAAAGAAGGCCAGGGAGGAGGG - Intronic
984881094 4:184410511-184410533 ATTGAGGACGCCATTGAGAAAGG - Intronic
984947722 4:184983064-184983086 ATGGAGGAAGACAGGGAGGAGGG - Intergenic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
985149040 4:186927684-186927706 ATTCAGGAGGTCAGAGAGGAGGG + Intergenic
985544067 5:500506-500528 GTAGATGGGGCCAGTGTGGACGG + Intronic
985835958 5:2272114-2272136 AGCGAGGAGGCCAGTCTGGAGGG - Intergenic
986022973 5:3821998-3822020 ATGGAGGAGGGCATTGTGGAGGG + Intergenic
987969739 5:24927224-24927246 AAGGAGGAGGCAAGAGAGGAAGG - Intergenic
988127175 5:27055323-27055345 AGAGAGGAAGCAAGAGAGGATGG - Intronic
989554598 5:42778599-42778621 ATAGAGGAGGCAAAAGAGAAAGG - Intronic
991285225 5:64966643-64966665 ATAGGAGATGCCAGTGAGCATGG - Intronic
991977361 5:72196365-72196387 ATGGATGAGGCCATTGAGAAAGG + Exonic
992000371 5:72430366-72430388 AGAGAGGAGGCAAGAGAGAAAGG - Intergenic
993900984 5:93584339-93584361 ATAGAGGAAGCCGGCGAGGGCGG - Exonic
993934472 5:93984958-93984980 ATGGAGGAGGACAGGGATGAAGG - Intronic
996366232 5:122703949-122703971 TCAGAGGATGCTAGTGAGGATGG + Intergenic
997083357 5:130766649-130766671 ATAGAGGAGTCCACAGAGCAGGG - Intergenic
997206010 5:132050592-132050614 AAAGAGCAGGCCTGGGAGGAGGG + Intergenic
997431536 5:133844344-133844366 GTAGAGAAGGCCAGTGAGACAGG - Intergenic
997631142 5:135369708-135369730 ATGGAGGATGCCATGGAGGAAGG - Intronic
998038647 5:138937114-138937136 ATGGAGGAGCCCAGGGAGCAAGG - Intergenic
998443528 5:142181234-142181256 AGAGAGGCGGCCAGTGAGTGTGG + Intergenic
999266166 5:150268303-150268325 AGAGAGGAGGCCAGTGTGGCTGG - Intronic
999477077 5:151910265-151910287 AAAGAGGATGCCAGAGAGTATGG - Intronic
999622160 5:153484722-153484744 GCAGAGGATGCCAATGAGGAAGG + Intergenic
1000457413 5:161468355-161468377 ACAGAACAGGCCAGTGTGGATGG - Intronic
1001104759 5:168843707-168843729 TTAGAGAAGCCCAGAGAGGAAGG - Intronic
1001224462 5:169931858-169931880 ATAGAGAAGGGCAGGCAGGAGGG - Intronic
1001305092 5:170566658-170566680 AGAGAGTGGGCCAGTGAGGAAGG + Intronic
1001373027 5:171225661-171225683 AGAGAAGAACCCAGTGAGGATGG - Intronic
1001434082 5:171685924-171685946 AGAAAGGAGGCCAGTGTGGCTGG - Intergenic
1001579104 5:172786550-172786572 AGAGAGGAGGCCAGTGTAGGGGG + Intergenic
1001768344 5:174272857-174272879 AGACAGGAAGCAAGTGAGGAGGG - Intergenic
1001808153 5:174606734-174606756 AGAGAGGAGGTCAGTGAGACAGG - Intergenic
1001923242 5:175617171-175617193 AGAGAAGAGGCCAGTGTGGCTGG + Intergenic
1002575742 5:180172740-180172762 ACAGAGGAGCCCAGGGAGGTGGG - Intronic
1003333901 6:5152756-5152778 ACAGAGGAGGCCCAAGAGGAAGG - Intronic
1004446991 6:15709670-15709692 ATAGAAGAGGTCAGAGAGGCAGG - Intergenic
1004484900 6:16057279-16057301 AGTGAGGAGGCCACTGTGGAAGG - Intergenic
1004910678 6:20279913-20279935 ATAGAGGAAGCCAGTGCCAAGGG + Intergenic
1005636134 6:27755061-27755083 ATAGAGGAAGACAGTGAAAAGGG - Intergenic
1006027103 6:31154169-31154191 ATTGTGGAGGGCAGTGAGGAAGG - Intronic
1006135759 6:31895844-31895866 ATAGAGGAGGGAAGTGACAAGGG - Intronic
1006258499 6:32849927-32849949 ATAGTGGAAGCCAGGGATGAGGG - Intronic
1006561593 6:34917703-34917725 GGAGAAGAGGCCAGTGAGCATGG - Intronic
1006720851 6:36149646-36149668 ATAGAGCAGGCCAGGCAGGCTGG + Intergenic
1006806593 6:36793222-36793244 ACAGAGGAGGCAGGGGAGGAAGG + Intronic
1007924922 6:45643031-45643053 AGAGAGGAGGGCAGAGAGAAGGG - Intronic
1008439435 6:51515839-51515861 GGAGATGAGGCCAGTGTGGAGGG - Intergenic
1008523261 6:52382733-52382755 ATAGAGACTGCCAGTGGGGAGGG + Intronic
1008678160 6:53843790-53843812 ACAGAGCAGTTCAGTGAGGAGGG - Intronic
1008680121 6:53863240-53863262 AGGGAGGAGGGCAGGGAGGAAGG - Intronic
1008928378 6:56911176-56911198 ATAGAGGCTGCAAGGGAGGAAGG + Intronic
1009464712 6:63954791-63954813 ATAGAATAGGCCTGTGAGGTGGG - Intronic
1009630768 6:66197553-66197575 ATAGAGTAGACCTATGAGGATGG - Intergenic
1009685037 6:66945560-66945582 ATAGAGGGGACCAGTGTGCAAGG - Intergenic
1010024429 6:71199227-71199249 AAAGAGGAGGTCAGTGGGGAAGG + Intergenic
1010128329 6:72461560-72461582 ATAAAGGAGGCCTGGAAGGAAGG - Intergenic
1010414532 6:75599000-75599022 CAAGAGGAGGCTAGTGAGGTAGG + Intergenic
1010502365 6:76616217-76616239 AAGGAGGAGGCCAGTGTGGCTGG - Intergenic
1011621656 6:89249302-89249324 AGAGGGGAGGAAAGTGAGGAAGG - Intergenic
1011670086 6:89674963-89674985 AGAGATGAGGACAGTTAGGAAGG - Intronic
1011745398 6:90403191-90403213 AGAGATGAGGCCAGTGATGTTGG + Intergenic
1012345484 6:98180276-98180298 AGAGAGGAAGACAGTGAGGGAGG - Intergenic
1012445180 6:99300087-99300109 GTATTGGTGGCCAGTGAGGAAGG - Intronic
1013969592 6:116000994-116001016 CTTTAGGAGGCCAGGGAGGATGG + Intronic
1014828237 6:126070976-126070998 AAAGAAAAGGTCAGTGAGGAAGG + Intergenic
1015855309 6:137618101-137618123 CAAGTGGAGGCCAGTGAAGAAGG - Intergenic
1017220611 6:151961592-151961614 ACAGAGGAGGACAGGCAGGAAGG + Intronic
1017335279 6:153251039-153251061 ATTGAATAGGCCAGAGAGGATGG - Intergenic
1017913085 6:158811905-158811927 ACAAAAGAGGCCAGTGTGGAAGG + Intronic
1018101531 6:160445207-160445229 AGGGAGCAGGCCAGGGAGGAAGG + Intronic
1018222290 6:161593327-161593349 ATGGATGAGGACAGTGAGGCAGG + Intronic
1018474424 6:164125659-164125681 AGAGAGGAGCCAAGGGAGGAAGG - Intergenic
1018798912 6:167207688-167207710 CTGAAGGGGGCCAGTGAGGAGGG + Intergenic
1018948246 6:168361902-168361924 ATTGAGGGGCCCAGGGAGGATGG + Intergenic
1019444270 7:1063065-1063087 ATGGAGGAGCCCAGAGAGAACGG - Intronic
1019611704 7:1940055-1940077 ATGGAAGAGGCCAGTGGAGATGG + Intronic
1019628051 7:2031310-2031332 GTGGTGGAGGCCAGTGGGGAGGG - Intronic
1019892043 7:3954619-3954641 AGAGGGGAGGCCAGAGGGGAAGG - Intronic
1020040527 7:4997597-4997619 TTAGAGGTGGCCAGGGAGGGAGG - Intronic
1020451169 7:8322042-8322064 ATAGAGTAAGCCAGAGATGATGG + Intergenic
1020502122 7:8936576-8936598 AGAGAGGAGGCAAGTGAATAGGG + Intergenic
1021173049 7:17418624-17418646 ATAGAATGGGCCTGTGAGGATGG - Intergenic
1021276479 7:18657935-18657957 AGAGAGGGGGCCAGTGTGGCTGG - Intronic
1021320330 7:19202108-19202130 ATAGAGGAGACAAGTGAGTCTGG - Intergenic
1021545179 7:21804971-21804993 AGACAGAAGGCCAGTGAAGATGG - Intronic
1021568193 7:22035506-22035528 ATAGAGTAAGCCAGTGGGTAAGG - Intergenic
1022244030 7:28540391-28540413 ATTGAGGAGGGCAGGGTGGAAGG + Intronic
1022685389 7:32591505-32591527 ACTGTGAAGGCCAGTGAGGAAGG - Intergenic
1023047892 7:36227538-36227560 ATAGAGGAGGAAAGTAAGCATGG + Intronic
1023522281 7:41060495-41060517 ATTGAGGAGGGAGGTGAGGAAGG - Intergenic
1023673831 7:42608935-42608957 CTAGAGGAAGCCAGAGAGAAGGG + Intergenic
1024490702 7:49980608-49980630 AGAGAGGAAGCCAGAGAGGGGGG + Intronic
1026450016 7:70520376-70520398 AAAAATGAGGCCAGTGAGGCTGG - Intronic
1027048396 7:75006460-75006482 GGAGAGGAGGCCAGGGAGAAGGG + Intronic
1028525678 7:91783218-91783240 AGAAAGGAGGGCAGTGTGGATGG - Intronic
1028746312 7:94330783-94330805 ATAAAGCAGGCAAGTGAGGTAGG + Intergenic
1028752066 7:94393640-94393662 ATGGAGGCGGCCAGAGAAGAGGG + Intergenic
1029384612 7:100235188-100235210 GGAGAGGAGGCCAGGGAGGAGGG - Intronic
1029657500 7:101936721-101936743 AGCGAGGAGGCCGGTGGGGATGG - Intronic
1029888924 7:103905907-103905929 ATAGAGGAGGTAAGTATGGAAGG + Intronic
1030227823 7:107171407-107171429 ATCGAAGTGGCCAGTGAAGAAGG + Intronic
1030266583 7:107628402-107628424 GTAGAGGAGGAGAGGGAGGAGGG + Intronic
1030528822 7:110686720-110686742 CTTGATGAGGGCAGTGAGGATGG - Intronic
1030977776 7:116148180-116148202 AAACAGGAGGCCAATGTGGATGG + Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1032282504 7:130515786-130515808 AGTAAGCAGGCCAGTGAGGAAGG + Intronic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1033139211 7:138809859-138809881 ATCAAGGAGCCTAGTGAGGATGG + Intronic
1033150996 7:138915019-138915041 TTAGAGCAGTCCAGGGAGGAGGG - Intronic
1033435370 7:141328980-141329002 ATAAAGAAGGCCAATCAGGAAGG - Intronic
1033472919 7:141665327-141665349 ATAGAGGAGGTGAGCGGGGAGGG + Intronic
1033531052 7:142264466-142264488 GCAGAGGAGGCCAGTGAAGATGG - Intergenic
1033786467 7:144737245-144737267 AGAGAGGAGGCAAGTGAATAAGG + Intronic
1033949294 7:146763173-146763195 TCCTAGGAGGCCAGTGAGGATGG - Intronic
1034085788 7:148321218-148321240 ACAGTGGAGTACAGTGAGGAAGG + Intronic
1034256032 7:149725093-149725115 AGACAGGAGGGGAGTGAGGAGGG - Intronic
1034534921 7:151720707-151720729 ATAAAGGAGGACAGAGAGAATGG + Intronic
1034609689 7:152354741-152354763 AGCCAGGAGGCCAGTAAGGATGG + Intronic
1034903074 7:154919915-154919937 AGAGAGGAGGCAAGAGAGGGAGG + Intergenic
1035243451 7:157547240-157547262 ACAGAGGAGGCCATGGAGGCTGG - Intronic
1036120203 8:6008508-6008530 CTACAAGAGGCCAGTCAGGAAGG - Intergenic
1036242216 8:7090778-7090800 GCAGAGGAGGCCAGGGAGTAAGG - Intergenic
1036242231 8:7090832-7090854 ACTGGGGAGGCCAGGGAGGAAGG - Intergenic
1036259631 8:7229377-7229399 ACAGAGGAGGTCAGGGAGGCAGG + Intergenic
1036306986 8:7610147-7610169 ACAGAGGAGGTCAGGGAGGCAGG - Intergenic
1036311674 8:7687947-7687969 AGAGAGGAGGTCAGGGAGGCAGG + Intergenic
1036357834 8:8058134-8058156 ACAGAGGAGGTCAGGGAGGCAGG - Intergenic
1036390100 8:8317943-8317965 AGAGAGGAGACGAGTGTGGACGG + Exonic
1036443924 8:8805521-8805543 ATTGAGGAGGCTGGGGAGGAGGG + Intronic
1036830526 8:12016352-12016374 GCAGAGGAGGCCAGGGAGGCAGG + Intergenic
1036893114 8:12608812-12608834 ACAGAGGAGGTCAGGGAGGCAGG + Intergenic
1036900675 8:12666799-12666821 GCAGAGGAGGCCAGGGAGGCAGG + Intergenic
1036970424 8:13348868-13348890 CTTGAGGAGGGCAGTGGGGATGG + Intronic
1037122902 8:15310578-15310600 ATAGAGAAGGTCAGGGAGCACGG - Intergenic
1037509144 8:19563897-19563919 AGGGAGGAGGCCAGTGTGGTGGG - Intronic
1037540732 8:19867994-19868016 AAAGATGAGGCCAGAGAGGTAGG + Intergenic
1037999747 8:23381590-23381612 ATACAGGTGGCCAGTAAGCACGG - Intronic
1038495497 8:27999327-27999349 ATGGAGGAGGCTAGTGGGCAGGG - Intergenic
1039428135 8:37503824-37503846 ATAGGGGAGGCCAGCATGGAGGG - Intergenic
1039845966 8:41325607-41325629 TTGGAGGAGGACAGTGAGAAGGG - Intergenic
1043636523 8:82391018-82391040 GAAGAGGAGGAGAGTGAGGAGGG - Intergenic
1043693017 8:83180826-83180848 ACTGAGGAGGGCAGAGAGGAAGG - Intergenic
1044936009 8:97293891-97293913 AAAGAGGAGGCCTGGGAAGAGGG + Intergenic
1046196342 8:110867481-110867503 AGAAAGGAGGCCAGTGTGGCTGG - Intergenic
1046453703 8:114429994-114430016 ATGGGTGAGGCCAGTAAGGAAGG + Intergenic
1047591467 8:126331570-126331592 TCAGAGGAAGCCAGTGTGGAGGG - Intergenic
1047879099 8:129172858-129172880 ATACAGAAAGCCAGTGAGTAGGG + Intergenic
1048888519 8:138928222-138928244 GGCCAGGAGGCCAGTGAGGACGG + Intergenic
1049237137 8:141518104-141518126 AGAGAGGTGGCCAGTCTGGAAGG - Intronic
1049311757 8:141937310-141937332 AAAGAGGAGGAGAGGGAGGAGGG - Intergenic
1051184048 9:14440014-14440036 ACAGAGGAGGGCTTTGAGGAAGG - Intergenic
1051372284 9:16368834-16368856 AAAGAGGAGCCCAGTTTGGAGGG + Intergenic
1051925662 9:22321912-22321934 ATAGAGAAGGCCCATCAGGAAGG - Intergenic
1052027360 9:23588381-23588403 AGAGAGGAGGACTGTGAGAAAGG - Intergenic
1052653675 9:31330933-31330955 ATAGAAGGGGCCTGTGAGGCTGG - Intergenic
1052763487 9:32616972-32616994 ATAGAAGAGGCCAGGCATGATGG + Intergenic
1054761960 9:69012321-69012343 ATAGAGGATGCCCCTGGGGAGGG + Intergenic
1056768041 9:89456994-89457016 CTCCAGGAGGCCAGTGAGGAAGG - Intronic
1056839324 9:89985939-89985961 ATAAAGCAGGCCATTTAGGAGGG - Intergenic
1056846255 9:90040482-90040504 CTAAAGGAGGACTGTGAGGAGGG + Intergenic
1056900435 9:90594379-90594401 AGGGAGGAAGCCAGTGAAGAAGG - Intergenic
1057435934 9:95040605-95040627 ATAGAGGAGGGGAGGGAGAAAGG - Intronic
1057749086 9:97776278-97776300 AGAGAGGAGGGCATTAAGGATGG + Intergenic
1057902727 9:98961989-98962011 GTGGTGGAGGCAAGTGAGGAAGG + Intronic
1058599837 9:106657409-106657431 ATAGTGGGGAGCAGTGAGGACGG - Intergenic
1058837410 9:108870595-108870617 AAAGAGGAGGCAAGAGAGGTGGG + Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059354264 9:113687191-113687213 AAAGAGGAAGGCAGAGAGGAGGG + Intergenic
1060072066 9:120558615-120558637 GGAAAGGAGGCCAGTGAGGCTGG - Intronic
1060088371 9:120721459-120721481 ATGGACGAGGCCTGTCAGGAGGG + Intergenic
1060428721 9:123528625-123528647 ATGGCAGAGGCCAGTGAGAAGGG - Intronic
1060756660 9:126219024-126219046 GCAAAGGAGGCCAGGGAGGATGG - Intergenic
1061188600 9:129069335-129069357 ACAGAGCAGGCCACTGGGGAGGG + Intronic
1061841396 9:133360363-133360385 AGAGAGAAGGCCACTGATGAGGG + Exonic
1061971474 9:134047664-134047686 AGTGAGGCGGCCAGTGGGGATGG - Intronic
1062545206 9:137059490-137059512 ATAGAGGAGGCCAGCCACGGTGG - Intergenic
1187106302 X:16245938-16245960 AGAGAGAAGGCCAGTGTGGCTGG + Intergenic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187442404 X:19332160-19332182 CAACAGAAGGCCAGTGAGGAGGG + Intergenic
1187839460 X:23471855-23471877 ATAGAGGAAGGGAGGGAGGAAGG - Intergenic
1188681968 X:33020428-33020450 GTTTGGGAGGCCAGTGAGGACGG + Intronic
1189148967 X:38685049-38685071 CTGGAGGAGGCCAGACAGGAGGG - Intronic
1190411763 X:50143579-50143601 AGTGAGGAGGCCAGTGTGGCTGG - Intergenic
1190980132 X:55450040-55450062 ATAGAGGAGCACAGTGGGGAAGG + Intergenic
1190988749 X:55523836-55523858 ATAGTGGAGCACAGTGGGGAAGG - Intergenic
1190988871 X:55525073-55525095 ATAGTGGAGCACAGTGGGGAAGG - Intergenic
1191225709 X:58040668-58040690 ATAGAGGAGGCCATGCAGGATGG - Intergenic
1191833230 X:65437281-65437303 ATAGAGCAGGGGAGTGGGGATGG - Intronic
1191846600 X:65551675-65551697 ACAGAGGTGGGCAGGGAGGAAGG + Intergenic
1192543658 X:71995499-71995521 AGTGAGGAGGCCAGTGTGGCTGG - Intergenic
1192579333 X:72267905-72267927 ATCAAGGAGGCCAGTGTGGCTGG + Intronic
1192731172 X:73803921-73803943 ATAGAATAGGCCTGTGAGGCTGG + Intergenic
1194947011 X:100081118-100081140 AGAGAGGAGGCAAGAGAGAAGGG - Intergenic
1195682924 X:107562263-107562285 AGAGAAGAGGCCAGAGAGGTTGG + Intronic
1196130485 X:112150076-112150098 AGTGAGGAGGCCAGTGTGGTGGG + Intergenic
1196666638 X:118324192-118324214 AGAAAGGAGGCCAGTGAGGCTGG - Intergenic
1197805905 X:130398379-130398401 AGAAAGGAGGCCAGTGTGGCTGG - Intergenic
1198393096 X:136196169-136196191 AGTGAGGAGGCCAGTGAGGTGGG + Intronic
1198835522 X:140800785-140800807 GAAGAGGAGAGCAGTGAGGAAGG - Intergenic
1199750816 X:150815971-150815993 CTTAAGGAGGGCAGTGAGGAAGG - Intronic
1199941306 X:152630526-152630548 AATAAGGAGGCCAGTGAGGCTGG - Intergenic
1200924135 Y:8639340-8639362 AAAGAAGAGGCAAGTGTGGAGGG - Intergenic
1201233922 Y:11892087-11892109 ATAGAGTGGGCCTGTGAGGCTGG + Intergenic
1201798666 Y:17928726-17928748 ATAGAGGAAGCAAGGGAGGAAGG + Intergenic
1201802887 Y:17977231-17977253 ATAGAGGAAGCAAGGGAGGAAGG - Intergenic
1202076156 Y:21039820-21039842 ATAGAAGGGGCCTGTGAGGCTGG + Intergenic