ID: 1097248425

View in Genome Browser
Species Human (GRCh38)
Location 12:57619471-57619493
Sequence ACTCAGGGCTTAGCGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097248418_1097248425 -2 Left 1097248418 12:57619450-57619472 CCCTGCTTCGTGGGAGGCGGGAC 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1097248425 12:57619471-57619493 ACTCAGGGCTTAGCGGGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1097248411_1097248425 16 Left 1097248411 12:57619432-57619454 CCTCAGGGCCGGATTGGACCCTG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1097248425 12:57619471-57619493 ACTCAGGGCTTAGCGGGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1097248412_1097248425 8 Left 1097248412 12:57619440-57619462 CCGGATTGGACCCTGCTTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 60
Right 1097248425 12:57619471-57619493 ACTCAGGGCTTAGCGGGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1097248419_1097248425 -3 Left 1097248419 12:57619451-57619473 CCTGCTTCGTGGGAGGCGGGACT 0: 1
1: 0
2: 0
3: 16
4: 266
Right 1097248425 12:57619471-57619493 ACTCAGGGCTTAGCGGGCGGAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097248425 Original CRISPR ACTCAGGGCTTAGCGGGCGG AGG Intergenic
900142248 1:1143573-1143595 ACGCAGGGCTGAGCGTGGGGCGG - Intergenic
900482055 1:2904200-2904222 ACTCAGGGCTGGGAGGGTGGTGG + Intergenic
901354088 1:8627491-8627513 ACTCAGGACTTAGAGGCAGGAGG + Intronic
903263019 1:22141648-22141670 ACCCAGGGCTTGGGGGACGGAGG - Intronic
903408304 1:23117687-23117709 ACTTAGGGCTTAGGGGTGGGAGG - Intronic
903742708 1:25567510-25567532 CCTCAGGGCCCAGCAGGCGGGGG + Exonic
903893046 1:26582945-26582967 ACTCAGCCCACAGCGGGCGGGGG - Intergenic
903931601 1:26865306-26865328 CCTCGGCGCTCAGCGGGCGGCGG - Intergenic
904453479 1:30632114-30632136 ACTCAGGGCTTTTGGGGCTGGGG - Intergenic
905734484 1:40316287-40316309 AGTCAGGGCTTAGCAGAGGGAGG - Intronic
912996203 1:114534782-114534804 ATTCAGGGCTTATGGGGCCGGGG - Intergenic
914429794 1:147611061-147611083 TCTCAGGGCCTTGGGGGCGGGGG - Intronic
921075745 1:211698986-211699008 AGTCAAGTCATAGCGGGCGGGGG - Intergenic
924719735 1:246610943-246610965 ACCCACGGCCAAGCGGGCGGAGG - Intronic
1063418229 10:5890276-5890298 ACGCTGGGCTGAGCGGCCGGCGG + Intronic
1064704329 10:18056291-18056313 TCTCAGGGTCTAGCGGGCTGTGG + Intergenic
1074279715 10:112039403-112039425 ACTCAGTGCTTTGCTGGCTGAGG - Intergenic
1076911776 10:133394044-133394066 ACTCCGGGCTTCGCCGGAGGCGG + Intronic
1077231718 11:1460775-1460797 ACTCGGGGCAGGGCGGGCGGCGG - Exonic
1077595810 11:3530437-3530459 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1078057410 11:8019264-8019286 GCTCGGGGCTCCGCGGGCGGCGG - Intronic
1080759915 11:35238435-35238457 ACTCAAGGCTTAGTGGGGAGTGG + Intergenic
1083660683 11:64250636-64250658 CCGCAGGGCTTAGCTGGTGGGGG - Intergenic
1084251709 11:67904416-67904438 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1084332701 11:68439278-68439300 ACTCAGGGCTGGGCAGGCAGAGG - Intronic
1084821131 11:71691611-71691633 TGTCAGGGCTTAGTGGGAGGAGG + Intergenic
1089046268 11:115504111-115504133 ACTCAGGGCTGAGAGGGAAGGGG - Intronic
1092421978 12:8339208-8339230 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1094445597 12:30526525-30526547 ACTCAGGGCTGAGTGGGCTAAGG - Intergenic
1096719066 12:53507653-53507675 ACTCCAGGCTTAGGGGCCGGGGG - Intronic
1097248425 12:57619471-57619493 ACTCAGGGCTTAGCGGGCGGAGG + Intergenic
1101762611 12:107671222-107671244 ACTCAGGGCTGAGCGGCAGGGGG + Intergenic
1108542044 13:51453569-51453591 ACTCGGGGCCTCGCGGGCGCCGG + Intronic
1109939917 13:69348205-69348227 ACACAGGGGTTAGGGGGTGGGGG + Intergenic
1113350579 13:109525300-109525322 ACTCAGGGCTCAGCGGAGGATGG - Intergenic
1118032509 14:61832391-61832413 ACACCGGGCATAGAGGGCGGCGG - Intergenic
1202947347 14_KI270726v1_random:41190-41212 ACTCTGGGCTTGGCGAGGGGAGG + Intergenic
1124867510 15:33507635-33507657 ATTGAGGGCTTAGAGGGAGGTGG - Intronic
1125182009 15:36888427-36888449 ACTCAGGGCGTCGCGCGCCGGGG - Intergenic
1131232816 15:90671898-90671920 ACCCAGGCCTTAGCGGGGGTAGG - Intergenic
1132669497 16:1096802-1096824 TCCCAGGCCTCAGCGGGCGGGGG + Intergenic
1133119295 16:3596328-3596350 ACTCAGAGCTGAGCGAGCGAAGG - Exonic
1133344879 16:5063179-5063201 ACGCAGGGCTGAGAGGGCGAGGG + Intronic
1133376313 16:5290369-5290391 TGTCAGGGCTTAGTGGGAGGAGG + Intergenic
1138595064 16:58025534-58025556 ACCCAGCGCCTAGGGGGCGGGGG - Intergenic
1141525938 16:84611939-84611961 AATCAGGGCTCAGCTGGCAGAGG - Intronic
1141662488 16:85448971-85448993 AGTGAGGGCTGAGCGGGTGGAGG - Intergenic
1144860698 17:18299732-18299754 ACTGCGGGCTTAGCTGGCGGTGG - Intronic
1145374311 17:22333439-22333461 TCTCAGTGCTCACCGGGCGGCGG - Intergenic
1147871683 17:43592020-43592042 AATCAGGGCTTGGCGGGGAGCGG + Intergenic
1149002949 17:51775786-51775808 ACTCAGGGATTAGCAGGAAGAGG + Intronic
1151878471 17:76880678-76880700 ACACAGGGGTCAGCGGGCAGAGG + Intronic
1153014648 18:572592-572614 ACTTAGAGCTTAGCAGGAGGGGG + Intergenic
1161767528 19:6215768-6215790 ACACAGGCTTCAGCGGGCGGGGG - Intronic
1162125713 19:8498580-8498602 ACCCAGGGCTGAGCGGGTGCCGG + Exonic
1162312451 19:9914905-9914927 ACTCAGGCCTTTCCAGGCGGCGG + Intronic
1162381313 19:10333459-10333481 ACTTAGGGCTCAGCGGGGGCCGG + Exonic
1162711388 19:12597361-12597383 ACTCAGGGGTCAGGGGGCGGGGG - Intronic
1165213760 19:34254801-34254823 ACGCCGGGCTTTGCGGGCGCTGG + Intronic
926134999 2:10330374-10330396 ACTCAGGGCTTGGTGGGGAGGGG - Intronic
928966097 2:36977018-36977040 ACTCAGGCCTGGGCGCGCGGTGG + Intronic
931521897 2:63106679-63106701 ACTCAAGGCTTAGGGGCCTGTGG + Intergenic
932881335 2:75504781-75504803 ACACAGGGCTTGTCGGGGGGTGG + Intronic
1176304930 21:5118346-5118368 ACTCCGGGCCCAGCGGGGGGAGG - Intronic
1179852124 21:44143684-44143706 ACTCCGGGCCCAGCGGGGGGAGG + Intronic
1180033504 21:45229014-45229036 CCTGAGGGCATAGCGGGAGGTGG - Intergenic
1185366482 22:50439207-50439229 ACTCAGGACTTTGGTGGCGGGGG + Intronic
954870329 3:53763061-53763083 GCTCAGGGCATAGCTGGCTGTGG - Intronic
961287366 3:125817237-125817259 TGTCAGGGCTTAGTGGGAGGAGG + Intergenic
961384671 3:126516729-126516751 ACTCAGGGCAGAGCTGGCGCTGG - Intronic
961899719 3:130198731-130198753 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
969010381 4:4056886-4056908 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
969208589 4:5668507-5668529 ACTCAGGGCTCAGGGAGCAGAGG - Intronic
969743672 4:9053009-9053031 TTTCAGGGCTTAGTGGGAGGAGG + Intergenic
969803075 4:9585101-9585123 TGTCAGGGCTTAGTGGGAGGAGG + Intergenic
985774658 5:1834474-1834496 ACCCAGTGCAGAGCGGGCGGCGG - Intergenic
997691733 5:135831966-135831988 ACTCAGGACTTTGCGGCTGGTGG + Intergenic
1000045813 5:157521276-157521298 AATCAAGGCTTAGTGGGAGGAGG + Intronic
1006884601 6:37370621-37370643 CCTCAGGGCTTGGTGGGCAGAGG - Intronic
1022926202 7:35058218-35058240 ACTAAGGGCTGGGCTGGCGGTGG - Intergenic
1026882567 7:73916797-73916819 GCTCAGGGCTGAGCGGGCTGGGG + Intergenic
1029069666 7:97884887-97884909 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1033656869 7:143380959-143380981 CCTCCGGGCTTAGCCGGCGGAGG - Intergenic
1034967706 7:155401615-155401637 GCTCTGGGCTTGGTGGGCGGTGG - Intergenic
1036251912 8:7169555-7169577 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1036365579 8:8117906-8117928 TGTCAGGGCTTAGTGGGAGGAGG + Intergenic
1036765962 8:11549465-11549487 ACTCAGGGCTCAGCCCTCGGGGG + Intronic
1036885368 8:12548200-12548222 TGTCAGGGCTTAGTGGGAGGAGG - Intergenic
1038522723 8:28247218-28247240 AGCCAGGGCTTTGTGGGCGGAGG + Intergenic
1039566114 8:38553776-38553798 GCTCAGGGCTGAGGGGGTGGTGG + Intergenic
1042141170 8:65680161-65680183 TCTCAGGGGTTGGGGGGCGGGGG + Intronic
1049601554 8:143510033-143510055 AGGCAGGGCCTGGCGGGCGGCGG + Intronic
1053135282 9:35646947-35646969 ACTCAGTCCTAAGCGGGCGAAGG + Intergenic
1062371651 9:136242368-136242390 ACGCAGGGCGTGGCGGGCGCTGG + Intronic
1203631317 Un_KI270750v1:74583-74605 ACGCAGGGCTCAGCGAGGGGTGG - Intergenic
1187031539 X:15493301-15493323 ACTCAGCGCTTCGCGGCCGGCGG + Exonic
1190061846 X:47216693-47216715 GATCAGGGCTTAGCAGGCGGGGG + Intergenic
1192580946 X:72280720-72280742 ACACAGGGCTGAGGGTGCGGGGG + Intronic
1200092049 X:153640572-153640594 ACTCAGGGCTGAGAGGCTGGCGG - Intergenic