ID: 1097249832

View in Genome Browser
Species Human (GRCh38)
Location 12:57626471-57626493
Sequence ATTCTCATGGGGCAGGAAAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 220}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097249832_1097249849 14 Left 1097249832 12:57626471-57626493 CCCATTTCCTGCCCCATGAGAAT 0: 1
1: 1
2: 2
3: 18
4: 220
Right 1097249849 12:57626508-57626530 CTTGGCACTGGCTGTGGGAGAGG 0: 1
1: 0
2: 5
3: 52
4: 460
1097249832_1097249848 9 Left 1097249832 12:57626471-57626493 CCCATTTCCTGCCCCATGAGAAT 0: 1
1: 1
2: 2
3: 18
4: 220
Right 1097249848 12:57626503-57626525 GAGGACTTGGCACTGGCTGTGGG 0: 1
1: 0
2: 1
3: 28
4: 214
1097249832_1097249851 30 Left 1097249832 12:57626471-57626493 CCCATTTCCTGCCCCATGAGAAT 0: 1
1: 1
2: 2
3: 18
4: 220
Right 1097249851 12:57626524-57626546 GGAGAGGTTATGGCTCCACCAGG 0: 1
1: 0
2: 1
3: 8
4: 229
1097249832_1097249845 -4 Left 1097249832 12:57626471-57626493 CCCATTTCCTGCCCCATGAGAAT 0: 1
1: 1
2: 2
3: 18
4: 220
Right 1097249845 12:57626490-57626512 GAATGGGCAGGGGGAGGACTTGG 0: 1
1: 0
2: 5
3: 56
4: 688
1097249832_1097249847 8 Left 1097249832 12:57626471-57626493 CCCATTTCCTGCCCCATGAGAAT 0: 1
1: 1
2: 2
3: 18
4: 220
Right 1097249847 12:57626502-57626524 GGAGGACTTGGCACTGGCTGTGG 0: 1
1: 0
2: 1
3: 29
4: 283
1097249832_1097249844 -10 Left 1097249832 12:57626471-57626493 CCCATTTCCTGCCCCATGAGAAT 0: 1
1: 1
2: 2
3: 18
4: 220
Right 1097249844 12:57626484-57626506 CCATGAGAATGGGCAGGGGGAGG 0: 1
1: 0
2: 5
3: 44
4: 457
1097249832_1097249850 20 Left 1097249832 12:57626471-57626493 CCCATTTCCTGCCCCATGAGAAT 0: 1
1: 1
2: 2
3: 18
4: 220
Right 1097249850 12:57626514-57626536 ACTGGCTGTGGGAGAGGTTATGG 0: 1
1: 0
2: 0
3: 29
4: 275
1097249832_1097249846 2 Left 1097249832 12:57626471-57626493 CCCATTTCCTGCCCCATGAGAAT 0: 1
1: 1
2: 2
3: 18
4: 220
Right 1097249846 12:57626496-57626518 GCAGGGGGAGGACTTGGCACTGG 0: 1
1: 0
2: 0
3: 44
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097249832 Original CRISPR ATTCTCATGGGGCAGGAAAT GGG (reversed) Exonic
900577226 1:3389364-3389386 ATTCCCATGGGGCCTGAGATGGG - Intronic
903513925 1:23897233-23897255 AATCACATGGGGCAGAAAACAGG + Intronic
903602172 1:24550429-24550451 ATTCTAAAGGCCCAGGAAATGGG - Intergenic
908786960 1:67744621-67744643 CTACTCATGGGGCAGGAGCTAGG + Intronic
909941097 1:81612650-81612672 ATTCTCATCTGACAGAAAATAGG - Intronic
910587419 1:88894815-88894837 AGGGTCATGGGGCTGGAAATGGG - Intergenic
911493486 1:98599077-98599099 ATTCACATGGGCGAGTAAATGGG + Intergenic
911877819 1:103191351-103191373 ATTTTAATTGGGAAGGAAATTGG + Intergenic
911947145 1:104126164-104126186 AGGCCCATGTGGCAGGAAATTGG - Intergenic
912403431 1:109416034-109416056 ATCCTCATTTTGCAGGAAATGGG - Intronic
913659714 1:120995353-120995375 ATTCTACTGAGGCAGGAAAGTGG - Intergenic
914649695 1:149687132-149687154 ATTCTACTGAGGCAGGAAAGTGG - Intergenic
916262038 1:162851686-162851708 TTCCTCATGGGGGAGGAAATGGG + Intronic
916828864 1:168470620-168470642 ATTCTTATCGTGGAGGAAATGGG - Intergenic
917499957 1:175577082-175577104 ATTCTCATCTGGCAGGGAAAGGG + Intronic
920129988 1:203724651-203724673 ATTCTCATGAGGCAGCAACCTGG + Intronic
920645662 1:207802093-207802115 ATTGTCATGGGGCAGGGGAGAGG - Intergenic
921771838 1:219049646-219049668 ATTCTCATGCCGCAGGAAGTTGG + Intergenic
1062857238 10:785393-785415 ATGCTGATGGGGCAGGAGAGCGG - Intergenic
1064145650 10:12824148-12824170 ATTCTGATGTTGCAGGAATTGGG + Intronic
1064162201 10:12956333-12956355 ATTCCTATGGAGCAGGAAAATGG + Intronic
1064385773 10:14889748-14889770 ATTCTGTGGGGGCAGGAAAAAGG + Intronic
1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG + Intergenic
1067524191 10:47028412-47028434 ATTTTCATGTGGCAGAAAGTGGG - Intergenic
1067919553 10:50439577-50439599 ATTCTGTTGGGGGAGAAAATAGG + Intronic
1069819932 10:71221194-71221216 ATGCTTATGGAGCAGGAAAAAGG - Intronic
1070766254 10:79058124-79058146 ACGCTCCTGGGGCAGGAAATGGG - Intergenic
1071300786 10:84254402-84254424 AGTCTCATGGAGCAGAAACTGGG + Exonic
1071460200 10:85886457-85886479 ACTCTCATGGGACTTGAAATGGG + Intronic
1071678101 10:87675866-87675888 ATTTGCATGGGGAAGGAATTAGG - Intronic
1071770011 10:88717967-88717989 TCTCTCTTGGGGCAGGAAAGAGG + Intergenic
1074833647 10:117268163-117268185 ATTCCCATGGGCAAGGAGATGGG + Intronic
1076080408 10:127575447-127575469 ATTCTCATAGGTAAGGAAAGTGG - Intergenic
1076731079 10:132439199-132439221 AGACTCACTGGGCAGGAAATGGG - Intergenic
1077660108 11:4060283-4060305 ATTCCCAAAGGGCAGGAAGTGGG - Intronic
1079977008 11:27104383-27104405 ATTCCCATGAACCAGGAAATAGG - Intronic
1080876404 11:36278898-36278920 ATTCTCATGCAGAAGGAAAAGGG - Intronic
1081048118 11:38302022-38302044 TTTCTCAAGGGACAGAAAATTGG - Intergenic
1081243953 11:40740829-40740851 ATTCACATGTGGAAAGAAATTGG - Intronic
1081637797 11:44732255-44732277 ATTATCATGGGGCAGACACTTGG + Intronic
1085803195 11:79610906-79610928 ATTCGCATTGGGCAGCAAGTGGG + Intergenic
1085900613 11:80695693-80695715 ATTCTCCTGGTGCAGGACACAGG - Intergenic
1088971368 11:114777372-114777394 ATTCTCATGTTTAAGGAAATGGG + Intergenic
1089522283 11:119073123-119073145 GTTATCATGGGAAAGGAAATAGG + Intronic
1089884190 11:121803529-121803551 CTTCTTATGTGGCAGGAGATGGG - Intergenic
1090157960 11:124461354-124461376 ATTCTCTTGGGCCAGGGAACTGG - Intergenic
1090747739 11:129720802-129720824 ATGCTCATGGGGCAAGAAATTGG - Intergenic
1091741675 12:2963959-2963981 AGTCACCAGGGGCAGGAAATGGG + Intronic
1092867058 12:12771543-12771565 AAACAAATGGGGCAGGAAATTGG - Intronic
1095821124 12:46479560-46479582 ATTCTCAAGTTGCAGAAAATAGG - Intergenic
1097249832 12:57626471-57626493 ATTCTCATGGGGCAGGAAATGGG - Exonic
1097824753 12:64163517-64163539 CTTCTCTTGAGGCAGCAAATGGG - Intergenic
1099790979 12:87333016-87333038 CTTCTCAGAAGGCAGGAAATGGG + Intergenic
1100109642 12:91224020-91224042 ATTTTAATGGGACAGGAAAGAGG + Intergenic
1101789495 12:107914055-107914077 CTCCTCATGCAGCAGGAAATGGG - Intergenic
1101805905 12:108063549-108063571 ATTCCCATGTGGCTGCAAATAGG + Intergenic
1104477351 12:129081775-129081797 ATCCTGATGGGGCAGGAGCTTGG - Exonic
1105303211 13:19153054-19153076 ATGCTCATGGGGGAGGAAGGAGG + Intergenic
1106574157 13:30958618-30958640 GTTCTGTTGGGGCAGGAAAAGGG - Intronic
1107806312 13:44156999-44157021 ACTCTCAGGAGGCAGGAACTGGG + Intronic
1109618607 13:64871383-64871405 ATTTTCATGTCTCAGGAAATAGG + Intergenic
1110893077 13:80714114-80714136 ATTCTCATGTGTCAGGAGAGGGG - Intergenic
1112596033 13:100807845-100807867 ATTCTCATGGGTCCTGAAAATGG + Intergenic
1112963994 13:105164671-105164693 ATTCTAATGGGACAGTAAAGTGG + Intergenic
1116924529 14:50620493-50620515 ATTATCACTGGGGAGGAAATGGG + Intronic
1117049703 14:51847828-51847850 ATTCTAATAGGCCAGGACATAGG + Intronic
1119765067 14:77182656-77182678 ATTCTCAGGGATGAGGAAATGGG - Intronic
1119936464 14:78596593-78596615 ATTCTAATGGTTCAGCAAATTGG - Intronic
1121455837 14:94038470-94038492 AGTCCCATGAGGCAGGAAAGGGG + Intronic
1122062626 14:99146902-99146924 CTTGTAATGTGGCAGGAAATTGG - Intergenic
1125531227 15:40414892-40414914 ATTCTCATGGCCCAGGATGTTGG - Exonic
1127614271 15:60667974-60667996 AGTCTCTTGTGGCAGGAAAGTGG + Intronic
1128072029 15:64803629-64803651 ATTCTCATGTAGGATGAAATCGG + Intergenic
1131802909 15:96090152-96090174 ATTTTTATGGGGAGGGAAATAGG - Intergenic
1136085303 16:27880695-27880717 CTTCTCATGGGGCAGGAAGTGGG - Intronic
1137647222 16:50086394-50086416 ATTTTGAAGGGGCAGGAATTTGG + Intronic
1137687002 16:50393241-50393263 ATGCCCATGGGGCAGGGTATGGG - Intergenic
1138209897 16:55154804-55154826 ATTCTCATGTGGCAGAAAGAGGG + Intergenic
1139146432 16:64330761-64330783 CTTCTCCTGGGGCTGGAAACAGG + Intergenic
1142557842 17:791630-791652 AGTGTCAGGGGGCAGGTAATTGG - Exonic
1143813503 17:9491852-9491874 AAACAAATGGGGCAGGAAATTGG - Exonic
1144148403 17:12420235-12420257 ATTCTCTTGGGGCAGTAGCTGGG + Intergenic
1146402617 17:32511929-32511951 ATTCTCAGGTGGCAGGGACTGGG - Intronic
1147366735 17:39964029-39964051 CTTCCCAGAGGGCAGGAAATGGG - Intronic
1147533587 17:41302727-41302749 ATTCTGCTGTGGCAGGAACTAGG + Exonic
1148625277 17:49064594-49064616 ATTCACATGGGTCATGAAGTGGG - Intergenic
1149007253 17:51818998-51819020 TTACTCATGGGGCAGGAAAGAGG + Intronic
1150363057 17:64554675-64554697 AATTCCATGGGTCAGGAAATTGG - Intronic
1153182335 18:2448692-2448714 ATTCTCAAGGAAGAGGAAATAGG + Intergenic
1154359680 18:13649141-13649163 AAACTTATGAGGCAGGAAATAGG + Exonic
1155529533 18:26752547-26752569 ATAAGCATGGGGCAGGAAAGGGG - Intergenic
1156359527 18:36372065-36372087 TTTCTCATGAGGAAGGAAAAGGG - Intronic
1156385444 18:36600485-36600507 ATTGTTTTGGGGCAGAAAATCGG - Intronic
1156504363 18:37579686-37579708 TTTCTCCTAGGGGAGGAAATGGG + Intergenic
1156712315 18:39961912-39961934 ATTCTAATTAGTCAGGAAATAGG + Intergenic
1157689839 18:49672469-49672491 AATCTGATGGGGCAGGCAAAAGG + Intergenic
1164534253 19:29073245-29073267 ATTCACAAGGGGGGGGAAATGGG - Intergenic
1164801846 19:31083512-31083534 TTTCTCCTGGGGAAGGGAATGGG + Intergenic
1165311893 19:35033494-35033516 ATTCTCATAGCGCAGGATCTAGG - Exonic
1165968421 19:39604515-39604537 ATTCTCATGGTGCAGGAGGTTGG - Intronic
1167606886 19:50485970-50485992 ATTTTCTGGTGGCAGGAAATGGG - Exonic
925877985 2:8328466-8328488 CTTGTCATGGGGCAGGAAGCAGG - Intergenic
927289770 2:21393972-21393994 ATTCTCATGTGGCAGAAAGAGGG + Intergenic
927553264 2:24016743-24016765 ATTCTCAAGGGGCAGAGAAGGGG + Intronic
927716479 2:25356319-25356341 ATGCTCAGGAGGCAGGAAGTGGG + Intergenic
929058156 2:37896591-37896613 AGTCTCTAGGGGCAGCAAATTGG - Intergenic
931270290 2:60695610-60695632 AATCTCAAGGAGCAAGAAATGGG + Intergenic
932439884 2:71727705-71727727 ATGGTCATGGGGGAGGAACTTGG + Intergenic
933092603 2:78139011-78139033 ATTCTCATGGGGCTGGTTTTAGG - Intergenic
933586179 2:84181709-84181731 ATACTCAGGGAGCAGGAATTTGG - Intergenic
934515145 2:94981621-94981643 GTGGTCATGGAGCAGGAAATGGG + Intergenic
936028838 2:109054880-109054902 ATGCACATGGGACAGGCAATAGG + Intergenic
937440880 2:121914746-121914768 AGACTCATGGGGATGGAAATCGG + Intergenic
940301173 2:152177673-152177695 ATTCTCCTGAGGCAGGAGAATGG - Intergenic
941107416 2:161372012-161372034 GCTGTCATGAGGCAGGAAATAGG - Intronic
943922824 2:193731289-193731311 ATTTTTATGTGGCAAGAAATGGG - Intergenic
945091898 2:206183415-206183437 ATTCTGTTGGGGCAGGGGATTGG + Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
946021447 2:216643093-216643115 ATTTTCCTGGTGCAGGAAATGGG - Intronic
947749698 2:232525855-232525877 CTTCTCAGGAGGCAGGAGATAGG - Intergenic
1168987231 20:2059951-2059973 ATTTTCATGGATAAGGAAATAGG + Intergenic
1169978310 20:11355418-11355440 TTTCTCATGGAGATGGAAATGGG - Intergenic
1173403522 20:42745341-42745363 CTTCCCATGGGGCAGGATCTGGG + Intronic
1175486632 20:59351586-59351608 AGTCTCATGGGGAAGGAGATGGG - Intergenic
1175947986 20:62567566-62567588 ATTTTCATGGGTCACAAAATGGG + Intronic
1177389270 21:20445623-20445645 AGTCTTGTGGGGCAGTAAATGGG - Intergenic
1177653801 21:23989982-23990004 ATTAGCATGTGGCAGGCAATGGG - Intergenic
1178117910 21:29436348-29436370 ATTCTTATGGGGCAGAGCATGGG + Intronic
1180176882 21:46095123-46095145 ATACTCAGGGGGCAGGGAAGCGG + Intergenic
1180615348 22:17122439-17122461 GTTTTCATGGGGCTGGGAATGGG - Intronic
1181222940 22:21373644-21373666 CCTCTGCTGGGGCAGGAAATGGG + Intergenic
1181255801 22:21561976-21561998 CCTCTGCTGGGGCAGGAAATGGG - Intronic
1183180719 22:36257982-36258004 ATTCTCATGGTACAGGAGAAGGG - Intronic
1184558757 22:45248815-45248837 AGCCTCAGGGGGCAGGAAAAGGG - Intergenic
950855125 3:16097536-16097558 ATAATCATGGGCTAGGAAATTGG - Intergenic
951589557 3:24248647-24248669 ATGCTCCTGGGGCATGAAAAAGG - Intronic
953986725 3:47449600-47449622 ATCCTCATGGGTCAGGAATGGGG - Intronic
955235167 3:57132493-57132515 ATTCTAATGGGGGAGGGAAGTGG + Intronic
955514986 3:59717534-59717556 ATTCTTATGGGGCAGAAACAAGG - Intergenic
956159089 3:66329509-66329531 ATTCTTAGGGGTAAGGAAATAGG - Intronic
956493291 3:69797145-69797167 ATTCACATGTGGCATTAAATTGG - Intronic
958866595 3:99508201-99508223 ATTATTATGGGGCATGAGATTGG + Intergenic
959822151 3:110748753-110748775 AATTTCATGTGGCAGTAAATAGG - Intergenic
965145618 3:164898624-164898646 ATTATAATGGCCCAGGAAATTGG + Intergenic
966428542 3:179807414-179807436 AATCTCAGGGGCCAGGAATTGGG + Intronic
967732001 3:192915817-192915839 GTAGTCATGGGTCAGGAAATGGG - Intronic
967881355 3:194304043-194304065 ATTCTCCTGGGGGAGGAAGTGGG + Intergenic
972874328 4:43339664-43339686 ATTCCTATGGGTCAGGAAGTGGG - Intergenic
973771838 4:54213814-54213836 ATTCTGATGGGGAGGGGAATGGG + Intronic
975955592 4:79834168-79834190 ATTCTTTTGGAGCAGGAAAAAGG + Intergenic
980147546 4:129007866-129007888 AAGCTCATGGAGCAGGAAAGTGG - Intronic
981463246 4:145035478-145035500 ATTGTCATGGGGCAGGAGCCAGG + Intronic
982113562 4:152077922-152077944 ATTTTTATGGGCCAGGAACTAGG - Intergenic
983139833 4:164136481-164136503 ATTCTGGTGGGGCAAGAAAGAGG - Intronic
983745278 4:171190532-171190554 ATTCACAGGTTGCAGGAAATAGG + Intergenic
985727881 5:1525181-1525203 ACTCTTATGGGGCAGGAATAAGG - Intergenic
985727889 5:1525210-1525232 ACTCTTATGGGGCAGGAATATGG - Intergenic
987513036 5:18866839-18866861 TCACTCAAGGGGCAGGAAATGGG - Intergenic
988165110 5:27578788-27578810 ATTCTAGTGGGGAAGGAAACAGG - Intergenic
989103666 5:37841217-37841239 ATTCACATGGGGCATGGAATTGG + Intergenic
989667893 5:43877661-43877683 TTTTACAGGGGGCAGGAAATTGG + Intergenic
991293063 5:65051325-65051347 ATTCTCATGGGGCCCCACATGGG - Intergenic
991728244 5:69558725-69558747 ATGCTGATGGGGAAGGAAAGAGG + Intergenic
991804673 5:70413872-70413894 ATGCTGATGGGGAAGGAAAGAGG + Intergenic
991866711 5:71069150-71069172 ATGCTGATGGGGAAGGAAAGAGG - Intergenic
991999942 5:72426317-72426339 AATCTCATGGGTCAGGAATTGGG - Intergenic
993651507 5:90528708-90528730 ATTCTCTTAGAGCAGGAAAAAGG + Intronic
995259102 5:110081316-110081338 AGTCTCATGCCTCAGGAAATGGG + Intergenic
996805840 5:127452955-127452977 ATCATCGTGGGACAGGAAATGGG - Intronic
997222280 5:132179306-132179328 ATTCTGATGGGACAGAGAATTGG - Intergenic
997870405 5:137500998-137501020 GTTCTCAAGGGGCAGGACAGTGG - Intronic
1001255231 5:170178165-170178187 ATCCTCACGGGGCAGGAAACAGG - Intergenic
1001927289 5:175647635-175647657 ACTCTCAAGGGGCAGCAAATTGG + Intergenic
1002802428 6:537694-537716 ATTCTCATGGTGATGGACATGGG - Intronic
1002833486 6:845663-845685 AGTTTCATGGGTCAGGAAGTTGG + Intergenic
1003798602 6:9635071-9635093 ATTTTCATGGGGTACTAAATTGG - Intronic
1003953864 6:11144344-11144366 ATTCTCATTAGGCAGGAATAAGG - Intergenic
1006370680 6:33641965-33641987 ATTCTAGTGGGGCAGAAAAATGG - Intronic
1007989003 6:46235452-46235474 CTCCTCATAGGGCAGGAACTGGG - Intronic
1008152438 6:47970726-47970748 ATTCCCACTAGGCAGGAAATTGG + Intronic
1010116428 6:72317014-72317036 ATTCTTATGGGGCTGGGAAGAGG + Intronic
1010954133 6:82071085-82071107 ATACTCATGAAGCAGGAATTGGG + Intergenic
1014927021 6:127284598-127284620 ATTCTTTTAGGGGAGGAAATAGG + Intronic
1016247721 6:142005439-142005461 GATCTCAGGGGGAAGGAAATGGG - Intergenic
1016676301 6:146773096-146773118 TTTCTGATGTGGAAGGAAATGGG - Intronic
1017939742 6:159041278-159041300 ATTCTCAGGATGCAAGAAATAGG - Intronic
1018583573 6:165331549-165331571 CTTTTCATGTGGCAGGAAACTGG - Exonic
1022465952 7:30653363-30653385 GCTCTCGTGGGGCAGGAGATGGG - Exonic
1022540659 7:31132649-31132671 ATTTTTGTGTGGCAGGAAATAGG + Intergenic
1022768838 7:33447116-33447138 ATTATCATGGAGGAAGAAATAGG + Intronic
1024423673 7:49200541-49200563 ATTTTCACAGAGCAGGAAATGGG - Intergenic
1024522605 7:50319178-50319200 ATGCTCATGGGGGAGGAATAGGG + Intronic
1027442537 7:78235323-78235345 ATTAGAAGGGGGCAGGAAATAGG + Intronic
1028547590 7:92020825-92020847 TTACTCATGGGGTAGGAATTGGG + Intronic
1028872535 7:95784987-95785009 AGTCCCATGGGAAAGGAAATAGG - Intronic
1029288539 7:99484007-99484029 CTACTCATGGGGAAGTAAATGGG - Intronic
1029306634 7:99624564-99624586 TTTCTCTTGCGGCAGGAAGTGGG + Intronic
1030356412 7:108548172-108548194 ATACTCATGGAGCTGCAAATTGG + Intronic
1030628514 7:111870132-111870154 CTTCTCATGGGTCAGAAAATTGG - Intronic
1031154558 7:118094677-118094699 ATTGTCATGGGACAGTAACTTGG + Intergenic
1031762529 7:125732565-125732587 TTTTTCATGGGTGAGGAAATAGG + Intergenic
1032583594 7:133126559-133126581 ATTCTACTGGGGCAGGAAACAGG - Intergenic
1035476928 7:159150235-159150257 AATCTCATTGGGGAGTAAATTGG + Intergenic
1036058333 8:5286173-5286195 GTTCTCAAGGGGCTGGTAATGGG - Intergenic
1038239093 8:25791565-25791587 ACTATGATAGGGCAGGAAATGGG - Intergenic
1038345311 8:26726862-26726884 ACTCTGATAGGGCAGGAGATAGG - Intergenic
1039607609 8:38895403-38895425 ATTTTCATGGGGAATGAAACAGG - Intergenic
1040740143 8:50563818-50563840 TTTCTAATTGGGCAGGAAATGGG - Intronic
1041712789 8:60909195-60909217 TTTCTCATGGGGCAGAGAAAAGG - Intergenic
1041766260 8:61421287-61421309 ATTGTCATGGTGCAGCAAAGTGG + Intronic
1043149489 8:76695758-76695780 ATACTCAAAGGGCAGGAAACAGG - Intronic
1043286512 8:78538461-78538483 ATTCTCAAGGAGAAGGAAAGAGG + Intronic
1045695385 8:104803233-104803255 AATGTCATGGGACATGAAATTGG + Intronic
1046279818 8:112011955-112011977 ATTCCAATGGTGCAGGAAAAGGG + Intergenic
1047405455 8:124581941-124581963 ATTATCATGGAGCAGGAAGAGGG + Intronic
1047820223 8:128511166-128511188 ATTCACATGGTGCTGAAAATGGG - Intergenic
1048560582 8:135532362-135532384 TTTGTCCTTGGGCAGGAAATAGG + Intronic
1050993605 9:12184474-12184496 ATTCTTTTGAGGAAGGAAATTGG - Intergenic
1051312866 9:15795194-15795216 ATTCTCTGGGGGAAGGAAGTAGG + Intronic
1051462648 9:17339698-17339720 ATTCTCATGAGGGAAGAAACTGG + Intronic
1051512100 9:17889461-17889483 TTTCTCATGGTGCTGGAAATCGG + Intergenic
1052596410 9:30565173-30565195 ATTCTAATGGGGAGGTAAATTGG + Intergenic
1052948576 9:34189125-34189147 AGTTTCATGGGGAAGGATATGGG + Intronic
1056067097 9:82947778-82947800 TTTCTGCTGGGGCAGGAAATGGG - Intergenic
1056834080 9:89940367-89940389 ATTGTCCTGGGGCAGGAGATTGG + Intergenic
1057966856 9:99512619-99512641 ACTCTCTTGGTTCAGGAAATTGG + Intergenic
1058565248 9:106277134-106277156 AGTCTCATGGTCAAGGAAATGGG + Intergenic
1059362212 9:113753717-113753739 ATTCTCAGGGCTCAGGAAAGAGG + Intergenic
1059792891 9:117659868-117659890 AATTTCATGGGGCATTAAATTGG - Intergenic
1060118605 9:120966809-120966831 ATGCTGATGAGGAAGGAAATAGG + Intronic
1061346193 9:130027591-130027613 TTTATCATGGGTCAGGAATTTGG + Intronic
1061876678 9:133547606-133547628 CTTCCCAAAGGGCAGGAAATGGG - Intronic
1185809976 X:3098778-3098800 ATGGCAATGGGGCAGGAAATTGG + Intronic
1187871407 X:23767761-23767783 ATTCTCCTAGGGCTGGAACTTGG - Intergenic
1190459342 X:50656450-50656472 ATTCACATGCGGAATGAAATTGG - Intronic
1190913415 X:54792034-54792056 GTCCTAATGGGGCAGGAAAGAGG + Exonic
1192088020 X:68120936-68120958 ATCCTCATACGGAAGGAAATTGG + Intronic
1194819963 X:98492915-98492937 ATACTCAGAGGGCAGGAACTAGG - Intergenic
1196613364 X:117739246-117739268 ATTCTCATGGGGTCATAAATGGG + Intergenic
1196816218 X:119667219-119667241 ATTCTCAGAGAGCAGGAGATGGG + Intronic
1198027753 X:132724972-132724994 ATTTTCATATGGCAAGAAATAGG - Intronic
1201627850 Y:16034851-16034873 ATTCCCTTGAGTCAGGAAATTGG - Intergenic