ID: 1097250277

View in Genome Browser
Species Human (GRCh38)
Location 12:57628678-57628700
Sequence CAGGCTGAACGGCAGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097250277_1097250281 0 Left 1097250277 12:57628678-57628700 CCTCTGGCCTGCCGTTCAGCCTG 0: 1
1: 0
2: 1
3: 24
4: 246
Right 1097250281 12:57628701-57628723 CTAGCTGCACACCTTGCCGAAGG 0: 1
1: 0
2: 0
3: 3
4: 99
1097250277_1097250282 1 Left 1097250277 12:57628678-57628700 CCTCTGGCCTGCCGTTCAGCCTG 0: 1
1: 0
2: 1
3: 24
4: 246
Right 1097250282 12:57628702-57628724 TAGCTGCACACCTTGCCGAAGGG 0: 1
1: 0
2: 0
3: 0
4: 41
1097250277_1097250285 24 Left 1097250277 12:57628678-57628700 CCTCTGGCCTGCCGTTCAGCCTG 0: 1
1: 0
2: 1
3: 24
4: 246
Right 1097250285 12:57628725-57628747 CATGAGATAGTGTTCCACGTAGG 0: 1
1: 0
2: 1
3: 1
4: 47
1097250277_1097250286 25 Left 1097250277 12:57628678-57628700 CCTCTGGCCTGCCGTTCAGCCTG 0: 1
1: 0
2: 1
3: 24
4: 246
Right 1097250286 12:57628726-57628748 ATGAGATAGTGTTCCACGTAGGG 0: 1
1: 0
2: 0
3: 4
4: 52
1097250277_1097250287 26 Left 1097250277 12:57628678-57628700 CCTCTGGCCTGCCGTTCAGCCTG 0: 1
1: 0
2: 1
3: 24
4: 246
Right 1097250287 12:57628727-57628749 TGAGATAGTGTTCCACGTAGGGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097250277 Original CRISPR CAGGCTGAACGGCAGGCCAG AGG (reversed) Intronic
900214723 1:1475364-1475386 CAGGCAGAGGGGCAGGGCAGGGG - Intronic
900221933 1:1513714-1513736 CAGGCAGAGGGGCAGGGCAGGGG - Intronic
900269834 1:1781359-1781381 CAGGCTGAAAGCCAGGATAGGGG + Intergenic
900603736 1:3514789-3514811 CAGGCTGATGGGCTGGGCAGCGG + Intronic
900623518 1:3598056-3598078 CAGGCTGCAGGGCAGGCCCGGGG - Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
900796926 1:4713575-4713597 CAGGCTTCACAGCAGGCCTGCGG + Intronic
902277255 1:15348884-15348906 GAGACTGAAGGGCTGGCCAGGGG + Intronic
903225602 1:21892816-21892838 CAGGCTGGAAGGCAGTACAGTGG - Intronic
903945971 1:26962910-26962932 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
904032939 1:27544414-27544436 GAGGCTGAACTGGAGGACAGGGG + Intronic
904318268 1:29680052-29680074 CAGCCTGAGCTGCTGGCCAGGGG + Intergenic
904873360 1:33635504-33635526 CAGGCTACATGCCAGGCCAGGGG - Intronic
905140758 1:35842208-35842230 CAGGCTGCACAGCAGGTGAGTGG + Intronic
906700718 1:47856120-47856142 CAGGCTGAACAGCATTTCAGGGG - Intronic
910772319 1:90842568-90842590 CTGGCTGAAAGCCTGGCCAGGGG - Intergenic
911045797 1:93626449-93626471 CAGGCTGATCTGCAGGCTGGGGG + Intronic
912069875 1:105796046-105796068 CAGGCAGTCCGGCAGCCCAGAGG - Intergenic
912492363 1:110069458-110069480 CAGGCTGATCGGCAGCTCTGCGG - Intronic
912687624 1:111779561-111779583 CAGACTGAAAGGAAGGGCAGTGG - Intronic
913158430 1:116123197-116123219 CAGGCAGACCGGCAGCCGAGAGG - Intronic
913163743 1:116167613-116167635 AAGGCTGCAAGGCAGGCCAGAGG - Intergenic
914333863 1:146697755-146697777 AAGGCTTAACGCCAGGGCAGTGG - Intergenic
914387254 1:147181844-147181866 CAGGTTGATGGGCAGCCCAGTGG + Intronic
915594420 1:156888072-156888094 CAGGCTGGTGGGCAGGCCAAAGG + Intergenic
915842231 1:159223612-159223634 CTGGCTGAATGGCCAGCCAGAGG - Intergenic
919441399 1:197638030-197638052 CAGACTGAAAGGCAGTCCAGAGG - Intronic
920105625 1:203551332-203551354 CAGGCTGAAGTGCAGTGCAGTGG + Intergenic
920200493 1:204257179-204257201 CAGACAGAACCACAGGCCAGGGG + Intronic
920240985 1:204550211-204550233 CAGGCTGAAGTGCAGTGCAGTGG + Exonic
922322287 1:224499299-224499321 AAGGGTGAAGGGCAGGCCATTGG + Intronic
922536076 1:226381939-226381961 CATGCTGAACTGCAAGTCAGGGG + Intronic
922912198 1:229227027-229227049 CAGGGTGAAAAGAAGGCCAGTGG - Intergenic
922977229 1:229795268-229795290 CAGGCTGGAGTGCAGGGCAGTGG - Intergenic
923026685 1:230209907-230209929 CAGCATGACCGGCAGGCCAGTGG + Intronic
923581690 1:235222720-235222742 CAGGCTGGAATGCAGTCCAGCGG + Intronic
924734509 1:246743541-246743563 CAGGCTGAAGTGCAGTGCAGTGG - Intronic
1062971009 10:1649407-1649429 GTGGCTGAAGGGCAGGACAGGGG - Intronic
1063353108 10:5374212-5374234 GAGGCTGGACGGGAGGGCAGCGG + Exonic
1067796216 10:49324032-49324054 GAGGTTGAACAGCAGGCTAGGGG - Exonic
1069840585 10:71337083-71337105 CAGGCTGAAGGGGAGGCCAGAGG - Intronic
1071524150 10:86348466-86348488 CAGACTGGATGCCAGGCCAGAGG + Intronic
1071538250 10:86454716-86454738 CAGGCTGGGCGGCCGGGCAGAGG - Intronic
1073037850 10:100576602-100576624 GAGGATGAAGGGCAGGGCAGGGG - Intergenic
1074437526 10:113446634-113446656 AAGACTCAAGGGCAGGCCAGGGG + Intergenic
1076062765 10:127426638-127426660 GAGTTTGAATGGCAGGCCAGGGG + Intronic
1077233432 11:1468800-1468822 CAGGCTGAGCCCGAGGCCAGGGG + Intergenic
1077868935 11:6245311-6245333 CAGGCTCCAGGGCTGGCCAGAGG - Intergenic
1078090673 11:8262804-8262826 CAGGGTGCCCGGCAGGCGAGGGG - Intronic
1082073761 11:47960781-47960803 CAGGCTGAAGTGCAGTGCAGTGG + Intergenic
1083322077 11:61854034-61854056 CAGGCAGAGACGCAGGCCAGGGG - Intronic
1084359054 11:68657701-68657723 CTGGCTGACCTGCTGGCCAGTGG - Intergenic
1084359644 11:68661158-68661180 CAGGATGAGAGCCAGGCCAGTGG + Intergenic
1084855412 11:71982021-71982043 CAGGCAGAAAGGCAGGCAGGTGG + Intronic
1088693327 11:112345997-112346019 CAGTCTCCACAGCAGGCCAGAGG + Intergenic
1088950767 11:114567466-114567488 AAGGCTGAACGGCAGCCTTGGGG + Intergenic
1089794034 11:120966190-120966212 CAGGGTGATGGACAGGCCAGTGG + Intronic
1090239493 11:125172062-125172084 CTGGCTGAGCGGCTGGCCAGTGG + Intronic
1090314223 11:125770740-125770762 CAGGCTTAAGAGCATGCCAGGGG + Intergenic
1091550503 12:1531745-1531767 CAGGCTGAACCTCTGCCCAGGGG - Intronic
1093356813 12:18176854-18176876 TTGGGTGCACGGCAGGCCAGAGG + Intronic
1093676202 12:21942551-21942573 CAAGCTGGACGCGAGGCCAGAGG + Intergenic
1097110149 12:56652094-56652116 CAGGCTGGGCGGCAGGGCAGAGG + Intergenic
1097250277 12:57628678-57628700 CAGGCTGAACGGCAGGCCAGAGG - Intronic
1102075763 12:110058623-110058645 CAGGCTGAAGTGCAGTGCAGTGG - Intronic
1103776957 12:123373116-123373138 CAGGCTGAACTGGAGCACAGTGG + Intergenic
1104224104 12:126814223-126814245 CAGGCTGAGCGGCTGGCAGGTGG - Intergenic
1104602333 12:130162274-130162296 CAGGCTGGGCTGCAGGCCGGGGG + Intergenic
1105779422 13:23694011-23694033 CAGGCAGCACCGCAGGTCAGTGG + Intergenic
1105840691 13:24251561-24251583 CAGGCTGCACCGAAGCCCAGTGG - Intronic
1113708753 13:112450584-112450606 CAGGCTGGACGCCCGGCTAGAGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1118832159 14:69444144-69444166 CAGGCTGAACTGGAGTGCAGTGG - Intronic
1121514448 14:94540153-94540175 CAGGCTGAATGACAGGCAGGGGG - Intergenic
1122143596 14:99676207-99676229 CAGGGTGAGCTGCAGGCCTGGGG + Exonic
1122409980 14:101520933-101520955 CAGGCATAATGGCAGCCCAGGGG - Intergenic
1122957364 14:105076923-105076945 GAGGATGAGGGGCAGGCCAGAGG + Intergenic
1123000466 14:105291260-105291282 CAGACAGAAAGGCGGGCCAGGGG + Intronic
1124662370 15:31560765-31560787 CAGGCTGAACTGGAGGACAGTGG - Intronic
1125301531 15:38259294-38259316 CAGGCTGGAGGGCAGTACAGTGG + Intronic
1129952054 15:79600644-79600666 CAGTCTGAAGGGCAGGCGTGGGG - Intergenic
1130957710 15:88639136-88639158 CAGGCTGCGGGGCAGGCCAGAGG + Intronic
1132293001 15:100716123-100716145 CAGCCTGAGCAGAAGGCCAGCGG - Intergenic
1132558087 16:581266-581288 GAGTCTGAACTGCAGGCCAGGGG + Intronic
1132748754 16:1447711-1447733 CAGGCTGCAAGACAGGCCCGCGG + Exonic
1133219525 16:4313904-4313926 CAGGCAGAACTGCAGCCCTGGGG - Intergenic
1133303839 16:4798152-4798174 CAGGTCGGACGGCAGGGCAGGGG + Exonic
1135351903 16:21736323-21736345 CAGACTGAAAGACAGCCCAGAGG - Exonic
1135450391 16:22552446-22552468 CAGACTGAAAGACAGCCCAGAGG - Intergenic
1135804934 16:25534270-25534292 CAGGCTGCACAGCAGGTGAGTGG - Intergenic
1135937171 16:26791355-26791377 AAGGCTGAGCAGGAGGCCAGAGG - Intergenic
1138480994 16:57303420-57303442 GAGGATGGACGGCAGGCCAAGGG + Intergenic
1139378314 16:66514601-66514623 CAGACTGAGCGGCCGGGCAGAGG - Intronic
1141410559 16:83830060-83830082 CAGGCTCAACCGCAGGCAACGGG + Intergenic
1142123942 16:88400933-88400955 CCCGCTGAACAACAGGCCAGGGG + Intergenic
1142141779 16:88475861-88475883 CAGGCTGAGCAGCCGTCCAGGGG - Intronic
1143637731 17:8176064-8176086 CAGGCTGCAGGGCAGGCCTGGGG + Intronic
1144574979 17:16423680-16423702 CAAGCTGCACGGTAGGGCAGAGG - Exonic
1144769961 17:17754108-17754130 CAGGCTGCACAGCTGGCCAGTGG - Intronic
1144939958 17:18932024-18932046 CAGGCTGAGTGGGAGGACAGGGG - Intergenic
1145250912 17:21296592-21296614 CAGGCTGCACAGCAAGTCAGGGG - Intronic
1145995526 17:29102907-29102929 CAGGGTGGAAGGGAGGCCAGTGG - Intronic
1146171039 17:30633567-30633589 CAAGATGAACTGTAGGCCAGGGG + Intergenic
1146791675 17:35754166-35754188 CAGGCACAACTGCAGGCCTGAGG + Intronic
1147053999 17:37819931-37819953 AAGGCTGAAAGGCAGGGGAGTGG + Intergenic
1147552145 17:41450962-41450984 CATGCTGAAAGACAGGCCACTGG - Intergenic
1148090939 17:45022147-45022169 CCGGCCGAACGGCAGGCCGCCGG + Intergenic
1148365280 17:47050892-47050914 CAAGATGAACTGTAGGCCAGGGG + Intergenic
1150267068 17:63838542-63838564 CAGGCTGAGCAGCAGGAAAGTGG + Intronic
1150610756 17:66731302-66731324 CAGGCTGAAGCGCAGTGCAGTGG - Intronic
1150765398 17:67997953-67997975 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1151386678 17:73759342-73759364 CAGGCTGAAGGGCAGGAGAGTGG - Intergenic
1152762055 17:82113966-82113988 CAAGCTGCAGGGCAGGCAAGGGG - Intronic
1156970450 18:43147860-43147882 CAGGCTGGAGTGCAGGGCAGTGG - Intergenic
1157474414 18:48012159-48012181 CAGGCAGGAGGGGAGGCCAGGGG + Intergenic
1157581763 18:48777812-48777834 CAGGGTCAAGGGCAGGCCATGGG + Intronic
1158076330 18:53534385-53534407 CAGGCAGTCCTGCAGGCCAGAGG + Exonic
1158634058 18:59140437-59140459 GAGGCAGAAAGGCAGGCGAGAGG + Intronic
1158851487 18:61499353-61499375 CAGGCGGACGGGCAGGCCAATGG + Exonic
1159906269 18:74095495-74095517 ACGGCTGAACAGCTGGCCAGTGG + Intronic
1160135033 18:76264550-76264572 CAGGGTGGAGGGCAGGGCAGAGG + Intergenic
1160677597 19:399644-399666 CAGCCCCAACGGCAGCCCAGGGG + Intergenic
1161563899 19:4988891-4988913 CAGGCTGGACGGGAGGGGAGGGG - Intronic
1162163802 19:8739261-8739283 CAGACTGGACGGCCGGGCAGAGG - Intergenic
1162602167 19:11677273-11677295 CAGACTGGGCGGCAGGGCAGAGG + Intergenic
1162811071 19:13164550-13164572 CAGGCTGAAGGCCAGCCCATCGG - Intergenic
1163775492 19:19215003-19215025 CAGGCTGCACAGCAGGGTAGAGG - Intronic
1166956981 19:46471298-46471320 CAGGCGGAGCGTCAGGCCCGGGG - Intronic
1167348733 19:48962456-48962478 GAGGCTGGAGGGCAGGGCAGAGG + Intergenic
1168029002 19:53664955-53664977 GAGGATGAAAGGCAGGGCAGGGG - Intergenic
926287279 2:11499366-11499388 CATCCTGAACGGCTGACCAGCGG - Intergenic
926689543 2:15724013-15724035 AAGGCTGCACAGCAAGCCAGTGG + Intronic
927545129 2:23945868-23945890 CAGGCTGAACTGGAGTACAGTGG + Intronic
927940505 2:27100309-27100331 CAGGCTGGTGGGCAGGGCAGAGG - Exonic
928681485 2:33707441-33707463 CAGGTTCAAAGGCAGGCAAGAGG + Intergenic
930267677 2:49219057-49219079 CAGGGAGAAGGGAAGGCCAGAGG + Intergenic
932274628 2:70442834-70442856 CTGGCTGAACTGGAAGCCAGAGG + Intergenic
933719354 2:85387620-85387642 CAGGCTGGAGTGCAGGGCAGTGG - Intronic
935675977 2:105595311-105595333 GAGGATGGAGGGCAGGCCAGTGG - Intergenic
937183163 2:120013539-120013561 CCCGCTGGACGGCAGCCCAGCGG - Intronic
937237288 2:120438477-120438499 CAGGGTGAAAGGCAGGGCACTGG + Intergenic
937508854 2:122570419-122570441 CAGGCAGACGGGCAGGCCATGGG + Intergenic
938716503 2:134027043-134027065 CAGGCAGAAAGGCAGGCAACAGG - Intergenic
941017984 2:160378570-160378592 CAGGCTGAAGAGCAGAGCAGTGG - Intronic
943293127 2:186101392-186101414 CAGGCTGGAGGGCAGTGCAGTGG - Intergenic
944506477 2:200417670-200417692 CAGGTTGAAGGCAAGGCCAGTGG - Intronic
947727862 2:232410893-232410915 CAGGCTGTCTGGGAGGCCAGGGG + Intergenic
948755133 2:240155095-240155117 GAGGCTTACAGGCAGGCCAGGGG + Intergenic
1168799594 20:635591-635613 CAGGCAGGAGGGCAGGCCTGGGG - Intergenic
1169288051 20:4326003-4326025 CAGGCTGGACCTCAGGGCAGAGG - Intergenic
1170418774 20:16171655-16171677 CAGGCTGAAGAGCTGGCTAGTGG + Intergenic
1172623559 20:36334845-36334867 CAGGCTGAGAGGCAGGACTGGGG - Intronic
1172910712 20:38407321-38407343 CAGACTGGGCGGCAGGGCAGAGG - Intergenic
1173152798 20:40582205-40582227 CAGGCTGAACAGATGGGCAGTGG - Intergenic
1173907620 20:46640344-46640366 CAGGTTGACCGGCAGGGCAGGGG + Intronic
1174349254 20:49955354-49955376 CAGTCTGGAAGGCAGACCAGAGG + Intergenic
1175263695 20:57690129-57690151 CAGGCTGAAAGCCAGGCAGGTGG - Intronic
1175550515 20:59814308-59814330 GAGGATGAACGGCAGGCCTGTGG + Intronic
1175772234 20:61631085-61631107 CAGGCAGAACTGCAGACCACTGG - Intronic
1175863685 20:62163439-62163461 GAGACTGAACGACAGGACAGAGG - Exonic
1179797557 21:43794232-43794254 GAGGCTCCAGGGCAGGCCAGGGG + Intronic
1181324354 22:22033204-22033226 CAGGCAGTACTTCAGGCCAGTGG + Intergenic
1184128139 22:42501785-42501807 GGGGCTGAAGGGAAGGCCAGGGG + Intergenic
1184136929 22:42555098-42555120 GGGGCTGAAGGGAAGGCCAGGGG + Intronic
1184145427 22:42607591-42607613 CAGACTGGACGGCCGGGCAGAGG - Intronic
1184165516 22:42725069-42725091 CAGGCTGAAGTGCAGTGCAGTGG + Intergenic
1184193161 22:42908567-42908589 CAGGCTTCACGGCAGGGCATGGG - Intronic
1184279118 22:43427062-43427084 CAGGCTGAACTCCTGCCCAGTGG + Intronic
949581584 3:5393815-5393837 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
953888269 3:46732177-46732199 CAGGCTAAATGGAAGCCCAGGGG + Intronic
954425519 3:50440925-50440947 CAGTCTGAAAGGCTGGGCAGGGG + Intronic
961529500 3:127531934-127531956 CAGGCAGTGTGGCAGGCCAGGGG + Intergenic
962859025 3:139380049-139380071 CAGGCTGAAGTGCAGTACAGTGG + Intronic
963052400 3:141153232-141153254 CAGGATGGGCAGCAGGCCAGTGG + Intergenic
964627916 3:158776766-158776788 AAGGCTGCAGGGCAGGCCTGGGG + Intronic
966563737 3:181352434-181352456 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
966617282 3:181926221-181926243 CAGACTGGGCGGCAGGGCAGAGG + Intergenic
966949250 3:184801308-184801330 CTGGCTGCAGGGCAGGCAAGGGG - Intergenic
967525962 3:190493035-190493057 CAGGCAGAAAGGCAGAGCAGGGG - Intergenic
967844902 3:194035596-194035618 CAGCCTGCAAGGCAGGCCTGTGG - Intergenic
969384827 4:6837426-6837448 CAGGCTGGGCGGCCGGGCAGAGG + Intronic
969508415 4:7602671-7602693 CAGGCTGGGCGGCCGGGCAGAGG + Intronic
974055289 4:56977556-56977578 CAGCCTGAACGGTAGGCGAGCGG + Exonic
977098345 4:92774625-92774647 CAGGCTGAAGTGCAGTGCAGTGG + Intronic
978014215 4:103723186-103723208 CAGACTGGGCGGCAGGGCAGAGG - Intergenic
980440765 4:132841864-132841886 CAGGCTGAAGTGCAGTGCAGTGG + Intergenic
982288851 4:153760130-153760152 CTGGCTGAATGGGAGGCCTGAGG - Exonic
983246605 4:165294987-165295009 CAGGCTGAACGGACTGGCAGGGG - Intronic
984557217 4:181228798-181228820 CAAGCTGCATGGCAGGCTAGCGG + Intergenic
990415170 5:55579452-55579474 GAGTCTGATCAGCAGGCCAGGGG - Intergenic
990678292 5:58213258-58213280 CAGTATGCATGGCAGGCCAGAGG + Intergenic
990954575 5:61330527-61330549 CAGGCTGCAAGGCAGGCGGGTGG + Intergenic
991313349 5:65270874-65270896 CAGGGTAAAGGGCAGGCAAGAGG + Intronic
992004315 5:72462588-72462610 CAGGCTGAAGTGCAGTCCAGTGG + Intronic
992865297 5:80951784-80951806 CAGTCTGAAGGGCAGGACTGTGG + Intergenic
994905951 5:105841013-105841035 CATTCTGACCAGCAGGCCAGTGG + Intergenic
995183764 5:109251498-109251520 GAGGCTGAACAGCTGGCCAGCGG - Intergenic
999209577 5:149876393-149876415 CAGGCTGGAGGGCAGTGCAGTGG + Intronic
999656119 5:153812093-153812115 CAGGCTCAACGGCAGTCTGGTGG + Exonic
999725177 5:154430990-154431012 CAGGCTGACTGACAGGCCAGTGG - Intergenic
999978992 5:156940439-156940461 CAGGCTGGGCGGCCGGGCAGAGG - Intronic
1001769463 5:174282316-174282338 CAGAATGAACGGCAGACTAGAGG - Intergenic
1002398911 5:178980373-178980395 CAAGCTGAGCGCCAGGCCTGGGG - Exonic
1002401396 5:178993387-178993409 CAGGCTGTGCGGCCGCCCAGGGG - Intronic
1003184792 6:3821345-3821367 CCGGCTTCACGGCAGGGCAGCGG - Intergenic
1003348333 6:5292321-5292343 CAGCCTGGAGAGCAGGCCAGAGG + Intronic
1005821777 6:29604763-29604785 GAGGGTGAACGGAAGGGCAGAGG + Intronic
1005922455 6:30414819-30414841 CAGACAGAAAGGCAGGGCAGGGG + Intergenic
1006154551 6:32007227-32007249 CGGGCTGAGCGGCTGGCCTGGGG - Intergenic
1006160862 6:32039963-32039985 CGGGCTGAGCGGCTGGCCTGGGG - Intronic
1007253229 6:40510682-40510704 CAGGCTGGACAACATGCCAGAGG + Intronic
1007629080 6:43262871-43262893 CACGCTGACCGACAGGCCAGTGG + Exonic
1007816787 6:44530608-44530630 CAAGCTGCAGGGCAGGCCAGTGG + Intergenic
1007826647 6:44605842-44605864 CAGGGCCAAGGGCAGGCCAGAGG + Intergenic
1012383621 6:98651091-98651113 CAGCCTGACCTGCAGGTCAGGGG + Intergenic
1014508079 6:122283777-122283799 CAGGCTGGAGGGCAGTGCAGTGG + Intergenic
1016155949 6:140808778-140808800 TAGGGGGAATGGCAGGCCAGAGG + Intergenic
1023954186 7:44871661-44871683 CAGGCTGGGCGGCCGGGCAGAGG + Intergenic
1024127451 7:46314835-46314857 CAGGCTGGTCTTCAGGCCAGGGG + Intergenic
1024456409 7:49613451-49613473 CAGGCTGGAGTGCAGGGCAGTGG + Intergenic
1025730132 7:64101126-64101148 CAGGCTGGAGTGCAGTCCAGTGG - Intronic
1026186177 7:68083442-68083464 CAGACGGAACGGCCGGGCAGAGG - Intergenic
1027267086 7:76500379-76500401 CAGGCTGGAGAGGAGGCCAGAGG - Intronic
1027318899 7:77000247-77000269 CAGGCTGGAGAGGAGGCCAGAGG - Intergenic
1030154037 7:106434685-106434707 CAGGCTGGAGTGCAGTCCAGTGG + Intergenic
1031604046 7:123748364-123748386 CAGGCTGGAGGACAGGCCTGCGG + Intronic
1032476930 7:132217933-132217955 CAGGGTGAAAGGCATGGCAGGGG + Intronic
1034270551 7:149801654-149801676 CAGGAGGAAGGGGAGGCCAGGGG + Intergenic
1035780041 8:2221208-2221230 CAGGGTGTAAGGCAGGGCAGGGG - Intergenic
1036191009 8:6670770-6670792 CTGGCTGCCCTGCAGGCCAGTGG - Intergenic
1038018919 8:23536689-23536711 GAGGCAGAAGGGCAGGCCCGAGG - Intronic
1038249859 8:25893324-25893346 CAGGCTGAAGTGCAGTGCAGTGG + Intronic
1038368331 8:26960929-26960951 CAGGCTGCACAGCAGGTGAGTGG + Intergenic
1039753228 8:40496739-40496761 CAGACTGAGCGGCCGGGCAGAGG + Intergenic
1039880531 8:41622594-41622616 CTCCCTGAACTGCAGGCCAGAGG - Exonic
1040902047 8:52427531-52427553 CAGACTGGAAGGCAGGCCATTGG + Intronic
1041594545 8:59633184-59633206 CAAGCTGAAAGGAAAGCCAGAGG - Intergenic
1044190447 8:89310291-89310313 CAGACGGAGCGGCAGGGCAGAGG + Intergenic
1044261871 8:90134495-90134517 CAGGCTGCACAGCAGGTGAGCGG - Intergenic
1048462610 8:134635089-134635111 CAGGCTGCACAGCAGGTGAGTGG - Intronic
1049113013 8:140661264-140661286 GAGGCTGAATGGAAGGGCAGGGG + Intronic
1049277626 8:141727863-141727885 CAGGCTGAGGGCCAGGCCACTGG - Intergenic
1049288780 8:141790812-141790834 CAGGCCGAGGGGCAGGCAAGGGG + Intergenic
1049671150 8:143870416-143870438 GAGGCTGAGCCGCTGGCCAGAGG + Exonic
1052840780 9:33289594-33289616 GAGGGTGAACGGCAGGGCAAGGG - Intergenic
1053345725 9:37376926-37376948 AAGGCTCATAGGCAGGCCAGTGG + Intergenic
1055400299 9:75916651-75916673 GAGGCTGGAAGGAAGGCCAGTGG + Intronic
1056129015 9:83565803-83565825 TAGGCAATACGGCAGGCCAGTGG + Intergenic
1056282737 9:85057823-85057845 CATGCTGAAGGACAGGCGAGAGG + Intergenic
1056799069 9:89678837-89678859 CACGGTGAAGTGCAGGCCAGGGG - Intergenic
1059197326 9:112382218-112382240 CAGGGTGGAGGGCAGGGCAGTGG - Intronic
1060423495 9:123486211-123486233 GAGGCTGAATGTCAGGCAAGTGG + Intronic
1061001332 9:127904627-127904649 CAGGCTGCAAGCCAGGCCTGGGG + Intronic
1061374222 9:130214634-130214656 CAGGCTGAAGAGCAGGGGAGGGG + Intronic
1061491333 9:130946268-130946290 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1061675798 9:132214914-132214936 CAGGCTGAAGGGCAGTGCAGTGG + Intronic
1061818389 9:133209140-133209162 CAGGGTGAAGGACAGGGCAGCGG + Exonic
1061917468 9:133762822-133762844 CAGGCTGTGCAGCTGGCCAGAGG + Exonic
1061976568 9:134070982-134071004 GAGGCTGGAGGGCAGGACAGAGG - Intergenic
1062242062 9:135546218-135546240 CAGGGTGAAGGACAGGGCAGCGG - Exonic
1062726333 9:138076119-138076141 CAGGCTGAAGGGAAGCCCTGAGG + Intronic
1190414271 X:50166102-50166124 CAGGCAGAAAGGTAGGGCAGCGG - Intergenic
1190535130 X:51418339-51418361 CAGGCCGAGTGGCAGGCAAGGGG - Intergenic
1190568272 X:51753648-51753670 CAGGCTTAACTGCATGCCACTGG + Intergenic
1194971697 X:100351267-100351289 CAGGGTGAAGGGCAGTCCACAGG + Intronic
1198415117 X:136412039-136412061 TAGGATGAACAGCAGTCCAGGGG + Intronic
1198439459 X:136648289-136648311 CATGCTGATGGGCAGTCCAGTGG - Exonic
1200072153 X:153534523-153534545 CAGGGAGAACAGCAGGCCCGAGG - Intronic
1200213730 X:154358262-154358284 CAGGCTGGCAGGCACGCCAGTGG + Exonic
1200769312 Y:7108875-7108897 TTGGGTGAATGGCAGGCCAGAGG + Intergenic
1201278652 Y:12321751-12321773 CAGGCTGAACCCCAGGCCCTGGG + Intergenic