ID: 1097251981

View in Genome Browser
Species Human (GRCh38)
Location 12:57639599-57639621
Sequence CTGGATGGATGGATGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097251973_1097251981 20 Left 1097251973 12:57639556-57639578 CCTTGTCCTCTCTGCTCTTCTCA No data
Right 1097251981 12:57639599-57639621 CTGGATGGATGGATGGAGCCCGG No data
1097251974_1097251981 14 Left 1097251974 12:57639562-57639584 CCTCTCTGCTCTTCTCAATCACT No data
Right 1097251981 12:57639599-57639621 CTGGATGGATGGATGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097251981 Original CRISPR CTGGATGGATGGATGGAGCC CGG Intergenic
No off target data available for this crispr