ID: 1097260921

View in Genome Browser
Species Human (GRCh38)
Location 12:57719874-57719896
Sequence TATTGGGTAGGGCGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097260914_1097260921 -2 Left 1097260914 12:57719853-57719875 CCTATAGGTGACGGGCAGAATTA 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG 0: 1
1: 0
2: 0
3: 19
4: 167
1097260910_1097260921 29 Left 1097260910 12:57719822-57719844 CCTGATTTTGGCTTTAGAAAACA 0: 1
1: 0
2: 6
3: 45
4: 442
Right 1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG 0: 1
1: 0
2: 0
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097260921 Original CRISPR TATTGGGTAGGGCGGGAAGA TGG Intronic
901076350 1:6557241-6557263 GATTGGGTAGAGCAGGAGGAGGG + Intronic
904292593 1:29497593-29497615 GATTGGGGCTGGCGGGAAGATGG - Intergenic
904493894 1:30876379-30876401 GATCGGATAGGGAGGGAAGAGGG - Intronic
907196860 1:52694106-52694128 GATTGGGAAGGGTGGGAGGATGG + Intronic
909950544 1:81714464-81714486 TATGGGGCAGGGCAGGGAGAAGG + Intronic
910694172 1:89994809-89994831 TATTAGTTTGGGCAGGAAGAAGG + Intergenic
912102537 1:106228978-106229000 TGTTGAGTAGGGCGGGAATGGGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
916503961 1:165410892-165410914 TCTTGGGTAGGGCTGGAAATGGG - Intronic
916591587 1:166196036-166196058 TCTTGGGCAGGGCAGGAATAAGG - Intergenic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
916644032 1:166764360-166764382 TGTTTGGTAGGGCGAGAGGAAGG + Intergenic
916658861 1:166902315-166902337 TGTTGGGAAGGACAGGAAGAAGG - Intergenic
917416931 1:174820285-174820307 TATTGGGTTGGGGAGTAAGAGGG + Intronic
917420382 1:174857026-174857048 TGTTTGGTTGGGTGGGAAGAAGG - Intronic
921326481 1:213989581-213989603 TAGTGAGGAGGGCGGGAAGAGGG + Intronic
923402661 1:233629832-233629854 TCTGGGGCACGGCGGGAAGAGGG + Intronic
924280483 1:242432244-242432266 TACTGGGTAGGATAGGAAGAAGG + Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1065627672 10:27648565-27648587 TACTAGGAAGGGTGGGAAGATGG + Intergenic
1066124662 10:32328843-32328865 TATTGGGTGTGGCAGGAAGGTGG + Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1070559681 10:77556758-77556780 TATTGTGTGCGGAGGGAAGATGG - Intronic
1071240577 10:83700638-83700660 TATTAGGTAGGGCTGGGGGAGGG - Intergenic
1074294537 10:112171578-112171600 AATTGGGTAAGGTGGGAATATGG - Intronic
1076113696 10:127880758-127880780 TGTTGGGTAGGGAAGGAAGTGGG - Intronic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078543574 11:12230146-12230168 TATCTGGTAGGATGGGAAGAAGG - Intronic
1081717312 11:45259605-45259627 TGTTGTGTAGGGCGGGTAGATGG - Intronic
1084492329 11:69485689-69485711 TATTGGCTAGGGCAGGCAGAGGG - Intergenic
1085652692 11:78282687-78282709 TATGGGGTAGGTAGGGAAAATGG - Intronic
1085824300 11:79827269-79827291 TATTGGGTAGGCTGGATAGAGGG + Intergenic
1085907790 11:80785503-80785525 TGTTGGGGAGGGAGGGAACAAGG - Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096340694 12:50796287-50796309 TAGAGGCTAAGGCGGGAAGATGG + Intronic
1096583311 12:52602164-52602186 TATCTGGGAGGGAGGGAAGAAGG + Intergenic
1097260921 12:57719874-57719896 TATTGGGTAGGGCGGGAAGATGG + Intronic
1100853154 12:98734551-98734573 TGTGGGGTAGGTCGGGGAGAGGG + Intronic
1103737757 12:123071151-123071173 TCTTGAGTAGGGTGGGCAGAGGG + Intronic
1106842404 13:33698263-33698285 TAGGGGTTAGGGTGGGAAGAGGG - Intergenic
1110180038 13:72605810-72605832 TATTGAGTAGGCCGAGGAGAAGG - Intergenic
1113229763 13:108199738-108199760 TATTGGAAAGTGGGGGAAGAGGG - Intergenic
1115508192 14:34112633-34112655 GATTGAGTAGGGGTGGAAGAGGG + Intronic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1118765046 14:68904037-68904059 TGTTGGGTAGGGAAGGAAGGAGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1121715895 14:96074022-96074044 TGTTGGGAAGGGTGGGAAGAGGG + Intronic
1122503473 14:102217168-102217190 TACTGTGTGGGGCAGGAAGAAGG - Intronic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1127487888 15:59436412-59436434 TATTGGGGTGGGCGGGGAAAGGG + Intronic
1127585020 15:60370280-60370302 TCTTGGGCAGGGCGGTAGGAGGG - Intronic
1127857895 15:62967558-62967580 AATTGGGTAAGGTGGGAGGAAGG - Intergenic
1129085077 15:73080794-73080816 AGTTGGGTAGGACTGGAAGAAGG + Intronic
1129921916 15:79326599-79326621 TAGGGAGGAGGGCGGGAAGAAGG + Intronic
1130148212 15:81291730-81291752 TAATGGGGAGGGAGGGAGGAAGG + Intronic
1135429042 16:22366633-22366655 TATTGGGCAGGGAGGGGAGGGGG + Intronic
1136065762 16:27757290-27757312 TGGTGGGTAGGGCGGGAGGTGGG + Intronic
1136548216 16:30967080-30967102 TGTGGGGTAGGGTGGGGAGAGGG + Intronic
1140269746 16:73454692-73454714 TATTGGGTGGGTGGGGGAGAGGG - Intergenic
1140344140 16:74195817-74195839 TATTGGGAAGGGTAGGAAGATGG - Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1142159288 16:88548315-88548337 TGGTGGGTGGGGCAGGAAGAGGG - Intergenic
1142880423 17:2879060-2879082 CAGTGGGTAGGGCAGGAAGGAGG - Intronic
1142957953 17:3534086-3534108 TGTTGGGTGGGGCGAGGAGAGGG - Intronic
1144584903 17:16482126-16482148 TATTGGGTAGGGCCTGAACCTGG + Intronic
1144669086 17:17121803-17121825 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1148036300 17:44663665-44663687 TATTGGGTGGCGGGGGGAGAAGG - Intronic
1150500465 17:65646070-65646092 TAGTGGGCAGGGCAGGAGGAAGG - Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153966400 18:10186632-10186654 AGTTGGGTGGGGCTGGAAGAGGG - Intergenic
1155292938 18:24359256-24359278 TATGGTGGGGGGCGGGAAGAGGG + Intronic
1155766170 18:29635737-29635759 TACTGGGTAGGTTGAGAAGATGG + Intergenic
1157639679 18:49202035-49202057 TGTTGGGTAAGAAGGGAAGATGG - Intronic
1158661366 18:59391325-59391347 AATGGGGTAGGGAGAGAAGAAGG - Intergenic
1158858393 18:61567478-61567500 TGTTGGGGAGGGTGGGAGGAGGG - Intergenic
1160174581 18:76582235-76582257 TATTGGGTAGGAGGGGAAGGAGG - Intergenic
1160431345 18:78814916-78814938 TGCTGGCTAGGGCGGGAGGAGGG - Intergenic
1160433333 18:78827309-78827331 TGTTGCGTGGGGCCGGAAGAGGG - Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161842393 19:6690595-6690617 GGTAGGGTAGGGTGGGAAGATGG + Intronic
1165461394 19:35946053-35946075 CATGGGGTGGGGCAGGAAGATGG + Intergenic
1166073653 19:40401102-40401124 TATTGGGTATGATGGAAAGAGGG - Intronic
1166476175 19:43126841-43126863 TCTTGGAAAGGGCGGGAGGAAGG - Intronic
1168375364 19:55873000-55873022 TATTCAGTATGGCGGGGAGACGG + Intronic
926472558 2:13279434-13279456 TATTGGAAAGAGCTGGAAGAGGG - Intergenic
928432920 2:31235022-31235044 TATTGGGTAGGATGGGAAGGGGG - Intronic
928712770 2:34025887-34025909 TATTGAATAGGGAGAGAAGATGG - Intergenic
930088137 2:47512764-47512786 GGTTGGGGAGGGCAGGAAGAGGG + Intronic
930636728 2:53814462-53814484 TAATGGGTAGGGTGAGAAGATGG - Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
937042369 2:118832621-118832643 CATTGGCTAAGGTGGGAAGAAGG + Intergenic
937190202 2:120088433-120088455 GAGTGGGGAGGGTGGGAAGAGGG + Intronic
938393162 2:130921021-130921043 TAGTGGGTAGGGCAGGGAGGAGG - Intronic
942360496 2:175167610-175167632 CCTTGGGTTGGGCGGGGAGAGGG - Intronic
942360670 2:175168350-175168372 TCTTCGGCAGGGCGGGTAGAGGG + Intronic
944606847 2:201359456-201359478 TATTGTGTAAGGAGAGAAGAGGG + Intergenic
947190253 2:227497159-227497181 TGTGGGGTGGGGGGGGAAGAGGG - Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
1171500656 20:25590456-25590478 TATTGGAATGGGAGGGAAGAAGG - Intergenic
1173870565 20:46339379-46339401 TAGTGGGTAGGAGGGGAAGCAGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1177020400 21:15848535-15848557 TATTGGGTAGTGGGGGAGGGGGG + Intronic
1178011763 21:28295450-28295472 TATTGAGTAGGCTGAGAAGAAGG - Intergenic
1178477540 21:32950479-32950501 CATTGGGTGGGGCGGGCAGAGGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1183336911 22:37254045-37254067 TATGGGGGAGAGGGGGAAGAGGG + Intergenic
1183432509 22:37774303-37774325 TAGGAGGTAGGGCAGGAAGAGGG - Exonic
1184885747 22:47343642-47343664 GATTGGGTAGGGCAGGGAGCGGG - Intergenic
1184975515 22:48058745-48058767 TGCGGGGGAGGGCGGGAAGAAGG + Intergenic
950599227 3:14017248-14017270 TTTTGGGTTGGGCGGGAACTGGG - Intronic
955105566 3:55894581-55894603 TATAAAGTAGGGAGGGAAGAAGG - Intronic
955629718 3:60960169-60960191 TGTTAGATAGGGTGGGAAGAAGG - Intronic
955945219 3:64187394-64187416 AGTTGGGAAGGGAGGGAAGAAGG - Intronic
959129154 3:102331357-102331379 TAGTGGGGAGGGCAGGAGGAAGG - Intronic
959267152 3:104157025-104157047 TATTGGATAGGGCCAGTAGATGG + Intergenic
960363371 3:116741555-116741577 AATTGGGAAGGGTGGGAGGAAGG - Intronic
962764540 3:138549351-138549373 TGTTGGGTGGGGCGGGTAGTGGG + Intronic
965748781 3:171955246-171955268 TATTGTGTAAGGCAGGAAGATGG - Intergenic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966490468 3:180522486-180522508 GAATGGGGAGGGCGGGAGGAAGG + Intergenic
967876167 3:194269833-194269855 GATGGGGGAGGGCGGGAAGACGG + Intergenic
968795190 4:2698899-2698921 TATCTGCTAGGGTGGGAAGAAGG + Intronic
972763586 4:42131061-42131083 TATTGGGGAGGGGGGGCAGTGGG + Intronic
974435136 4:61846835-61846857 GGTGGGGTGGGGCGGGAAGAAGG + Intronic
978910146 4:114052728-114052750 TAATGGGTTGGGTTGGAAGAAGG + Intergenic
979810439 4:125029751-125029773 TATGGGGCAGGAGGGGAAGAGGG - Intergenic
983981497 4:174002532-174002554 TACTGAGCAGGGAGGGAAGAGGG - Intergenic
984676052 4:182548878-182548900 GATGGGGAAGGGTGGGAAGAGGG - Intronic
985367954 4:189253397-189253419 GAGTGGGTAGGGTGGGAGGAGGG + Intergenic
985997884 5:3606756-3606778 TCTCGGGTGGGGCGGGAGGAGGG - Intergenic
987055705 5:14189437-14189459 GATTGAGGAGGGCGGAAAGAAGG + Intronic
990114999 5:52379341-52379363 TGTGGGGTTGGGGGGGAAGAGGG - Intergenic
991480343 5:67071359-67071381 TATTTGGTAGGGAGGGAGGGAGG + Intronic
992173070 5:74123151-74123173 AATGGGGTAGGGTGGGGAGAAGG + Intergenic
996613621 5:125413597-125413619 TGTTGGGGTGGGCTGGAAGAAGG - Intergenic
998521576 5:142805808-142805830 TATTTGGTAGGGTGGGTAAAAGG + Intronic
999935467 5:156481295-156481317 TATTGGGGAAGGCTGGGAGATGG + Intronic
1005755530 6:28922401-28922423 TCTTGAGTAGGTTGGGAAGATGG - Intronic
1007088523 6:39167473-39167495 CATGGGGAAGGGCAGGAAGAGGG + Intergenic
1007791517 6:44311552-44311574 CATGGGGTGGGGGGGGAAGACGG + Intronic
1008546839 6:52590594-52590616 TCTTGGGGAGGGCGCAAAGAGGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013631456 6:111989933-111989955 TATGGGGTATTGGGGGAAGAGGG + Intergenic
1016086535 6:139921662-139921684 TATTCGCTTGGACGGGAAGATGG + Intergenic
1019272090 7:156133-156155 CACTGGCTACGGCGGGAAGAGGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021616625 7:22508392-22508414 TATTGGGAAGGTCTGGCAGAAGG - Intronic
1025922638 7:65927873-65927895 TATTTGGTGGGGTGGGGAGAGGG + Intronic
1028375834 7:90145946-90145968 TATTGGGAAGGTCTGGGAGAAGG + Intergenic
1029824434 7:103174290-103174312 TATTGGGAAGGTCTGGGAGAAGG - Intergenic
1034427411 7:151021333-151021355 TATGGGGTTGGGCGGGCAGTGGG + Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1037562685 8:20088973-20088995 TATTGGGGAGGGGAGGAAGATGG - Intergenic
1037835458 8:22212591-22212613 TGTTTGGTGGGGAGGGAAGAAGG + Intergenic
1038642277 8:29338106-29338128 TGTTGGGTTGGGAGGGAGGAGGG - Intronic
1039486810 8:37916511-37916533 TAATTGGAAGGGCGGGAGGAGGG - Intergenic
1039722541 8:40180022-40180044 TATTTAGCAGGGTGGGAAGAGGG - Intergenic
1040746133 8:50644380-50644402 TGTTGAGTAGGCTGGGAAGAAGG - Intronic
1041749702 8:61246949-61246971 GAGTGGGGAGGGTGGGAAGAGGG - Intronic
1041800773 8:61795510-61795532 TGTTGGGGAGGCCGGGGAGAGGG - Intergenic
1042659473 8:71137849-71137871 TGGTGGGTAGGGCAGAAAGAAGG + Intergenic
1044483370 8:92719651-92719673 TAGAGGGTAGGGTGGGTAGAGGG - Intergenic
1044807284 8:96021255-96021277 TATTGGCTAGGCCAGGAAAAAGG + Intergenic
1045198859 8:99958067-99958089 TGGTGGGTAGGGCGGGAGGAGGG - Intergenic
1046175178 8:110566421-110566443 GATTGGGTAGAGTGGGAAGCTGG - Intergenic
1047206935 8:122809938-122809960 GATTGGGTAGGGGGGGTGGAGGG + Intronic
1047463948 8:125094133-125094155 TATTGGGTATGAAGGGGAGAAGG + Intronic
1050255906 9:3791581-3791603 TATTGGGAAAGGTGGGAACAAGG - Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1055964984 9:81857411-81857433 TAATGGGTAGGGCCGGACAAGGG - Intergenic
1056204742 9:84309164-84309186 TGTTGGGTAGGGAGGGTAGATGG + Intronic
1058136576 9:101314297-101314319 TATTGGGGAGGGAAGGAAGAGGG - Intronic
1060044762 9:120331151-120331173 TGTTGTGTTGGGAGGGAAGATGG - Intergenic
1186398933 X:9238789-9238811 TTTTGGGTAGAGGGGGAAGATGG + Intergenic
1189950372 X:46223879-46223901 GATGGGGTAGGGTGGGAGGAGGG + Intergenic
1193866783 X:86741731-86741753 TATTGATGAGGGTGGGAAGAAGG + Intronic
1195464860 X:105169214-105169236 AATTGGGTAGAGCTGAAAGAAGG - Intronic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1197858808 X:130948182-130948204 TGTTGGGCAGGGTGGTAAGAAGG + Intergenic
1198278330 X:135118096-135118118 AATTGGGGAGGAGGGGAAGAGGG + Intergenic
1198292632 X:135254420-135254442 AATTGGGGAGGAGGGGAAGAGGG - Intronic
1198616292 X:138462377-138462399 TATTGGCTGGGGCGGGGAGGGGG + Intergenic
1200077298 X:153557501-153557523 TTTTCGGTAGGGCAGGGAGAGGG - Intronic