ID: 1097263150

View in Genome Browser
Species Human (GRCh38)
Location 12:57730938-57730960
Sequence TACTGTGGATGTAATCCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097263145_1097263150 -5 Left 1097263145 12:57730920-57730942 CCATCTCCTTGCCGTGGGTACTG 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1097263150 12:57730938-57730960 TACTGTGGATGTAATCCTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 102
1097263141_1097263150 26 Left 1097263141 12:57730889-57730911 CCCGGGACTTTGACTGTTGTTCG 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1097263150 12:57730938-57730960 TACTGTGGATGTAATCCTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 102
1097263142_1097263150 25 Left 1097263142 12:57730890-57730912 CCGGGACTTTGACTGTTGTTCGC 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1097263150 12:57730938-57730960 TACTGTGGATGTAATCCTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097263150 Original CRISPR TACTGTGGATGTAATCCTGG AGG Exonic