ID: 1097265525

View in Genome Browser
Species Human (GRCh38)
Location 12:57742225-57742247
Sequence TGAGTTTCAAACCCACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 174}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097265516_1097265525 18 Left 1097265516 12:57742184-57742206 CCTGCCCGCCCTTCCGTCTGTCG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265518_1097265525 13 Left 1097265518 12:57742189-57742211 CCGCCCTTCCGTCTGTCGACCTC 0: 1
1: 0
2: 0
3: 5
4: 140
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265523_1097265525 -6 Left 1097265523 12:57742208-57742230 CCTCACTTCCTGACTGGTGAGTT 0: 1
1: 0
2: 2
3: 15
4: 178
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265514_1097265525 20 Left 1097265514 12:57742182-57742204 CCCCTGCCCGCCCTTCCGTCTGT 0: 1
1: 0
2: 1
3: 19
4: 290
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265513_1097265525 23 Left 1097265513 12:57742179-57742201 CCGCCCCTGCCCGCCCTTCCGTC 0: 1
1: 0
2: 6
3: 99
4: 1240
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265517_1097265525 14 Left 1097265517 12:57742188-57742210 CCCGCCCTTCCGTCTGTCGACCT 0: 1
1: 0
2: 0
3: 7
4: 118
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265519_1097265525 10 Left 1097265519 12:57742192-57742214 CCCTTCCGTCTGTCGACCTCACT 0: 1
1: 0
2: 0
3: 12
4: 88
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265520_1097265525 9 Left 1097265520 12:57742193-57742215 CCTTCCGTCTGTCGACCTCACTT 0: 1
1: 0
2: 1
3: 3
4: 88
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265511_1097265525 25 Left 1097265511 12:57742177-57742199 CCCCGCCCCTGCCCGCCCTTCCG 0: 1
1: 0
2: 8
3: 150
4: 1300
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265515_1097265525 19 Left 1097265515 12:57742183-57742205 CCCTGCCCGCCCTTCCGTCTGTC 0: 1
1: 0
2: 1
3: 24
4: 299
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265521_1097265525 5 Left 1097265521 12:57742197-57742219 CCGTCTGTCGACCTCACTTCCTG 0: 1
1: 0
2: 1
3: 16
4: 214
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174
1097265512_1097265525 24 Left 1097265512 12:57742178-57742200 CCCGCCCCTGCCCGCCCTTCCGT 0: 1
1: 0
2: 3
3: 59
4: 826
Right 1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097265525 Original CRISPR TGAGTTTCAAACCCACAGCC TGG Intronic
900418990 1:2547469-2547491 TGAGTTTCTGGCCCACAGCTTGG + Intergenic
902205084 1:14862500-14862522 TGACTTTCAAACCCCCAGCCTGG + Intronic
902700835 1:18170806-18170828 TGAGTCTCAAATCTGCAGCCTGG - Intronic
905462149 1:38128999-38129021 TCAGGTCCAAGCCCACAGCCAGG - Intergenic
906009378 1:42509471-42509493 TGAGTTTGAGACCCCCACCCAGG + Intronic
906033595 1:42737988-42738010 TGGGATTGAAACCCAGAGCCAGG + Intronic
907748905 1:57243527-57243549 TTATGCTCAAACCCACAGCCCGG + Intronic
908653939 1:66367748-66367770 GCAGTTTGAAACCCACAGCAAGG - Exonic
912222452 1:107693937-107693959 TGACTTACAGACCCATAGCCTGG - Intronic
913112949 1:115672312-115672334 TGAATTTCAAACCAAAAGCCAGG + Intronic
914222962 1:145696727-145696749 TCCCTTTCAAACACACAGCCTGG - Intronic
914963398 1:152227881-152227903 TCAGCTTCAGACCCACACCCTGG + Intergenic
914992215 1:152508635-152508657 TGGGATTCAAACCCAGAGACTGG + Intergenic
918359844 1:183745620-183745642 TGAGTATCATATCCACAGACAGG - Intronic
919201172 1:194357199-194357221 AGAGTTTCTAACTGACAGCCAGG + Intergenic
919793263 1:201305888-201305910 TGGCTTTCAAACCCAGAGGCTGG - Intronic
920380968 1:205534359-205534381 TGAGTTCCACACCCCCAGGCTGG - Intergenic
920552768 1:206877905-206877927 TGAGATCCCAACCCAAAGCCTGG - Intergenic
1062865037 10:845026-845048 TGAGTCTCAACCAGACAGCCAGG - Exonic
1064225030 10:13475010-13475032 TGAATTTCGAACCAACACCCAGG + Intronic
1065476588 10:26144878-26144900 TGTGTTATAAACCCTCAGCCAGG + Intronic
1067856163 10:49795435-49795457 TTAGTTTCAAAAGCACACCCAGG - Intergenic
1069663478 10:70139277-70139299 TCATTTTCCAGCCCACAGCCTGG - Exonic
1070697435 10:78573414-78573436 TGAGTGTCTAACTCACATCCAGG + Intergenic
1070705834 10:78637577-78637599 TGAGCTTTAACCCCCCAGCCTGG + Intergenic
1071384264 10:85103895-85103917 AGAGATTGAAACCCACAGCTGGG - Intergenic
1072773091 10:98159837-98159859 TGACTTTAAAAGCCACAGTCTGG + Intronic
1073705877 10:105983669-105983691 TAAGTGTCAAACCCAAATCCTGG + Intergenic
1075393366 10:122109474-122109496 TGAGTTTCAGTCCCACAGCCTGG + Intronic
1077395186 11:2317012-2317034 GGAGGGTCCAACCCACAGCCAGG + Intronic
1078352909 11:10609538-10609560 TGAGTTGAAAACACCCAGCCTGG + Intronic
1081752541 11:45522199-45522221 TGACTTTCAGTCCCACAGCTGGG + Intergenic
1081810025 11:45909382-45909404 AGAGTTTCAAACCCACAGAGAGG - Intergenic
1083184757 11:61010991-61011013 TCAGTTTCTAACCCAAGGCCTGG + Intronic
1083687561 11:64385657-64385679 TGAGCTTCCAAGCCCCAGCCAGG - Intergenic
1088853921 11:113729201-113729223 TGAGTTTCAAATACACTGCCTGG + Intergenic
1089083679 11:115798821-115798843 TGTGTTTCAAACACAAACCCAGG - Intergenic
1090956665 11:131519159-131519181 TGAGTTTCAAATTGAGAGCCAGG + Intronic
1095896095 12:47281695-47281717 TGAGTTTACTACTCACAGCCAGG - Intergenic
1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG + Intronic
1097707177 12:62880462-62880484 TGAGTTTGCAACCCCCAGCCTGG + Intronic
1100458701 12:94777322-94777344 TGGGATCCAAACCCACAGTCTGG + Intergenic
1101017389 12:100516106-100516128 TGAGTGTGAAACCCACAGGATGG + Intronic
1101730146 12:107420104-107420126 TGAGAGTCAAACCCAAAGCAAGG + Intronic
1102058938 12:109917606-109917628 TGAGTCTCAGAACCACAGACCGG + Exonic
1102427138 12:112852722-112852744 TGAGTTGCAAAGCCACACCTAGG + Intronic
1102813129 12:115841337-115841359 TGAGTTTCAAACCCGAGGGCAGG + Intergenic
1103964513 12:124630285-124630307 TGAGCTGCAAAACCTCAGCCAGG + Intergenic
1104177550 12:126347767-126347789 TGAGCATAAAACCCACAGCATGG - Intergenic
1106122515 13:26872466-26872488 TGAATGTCAAGCCCACAGCAGGG + Intergenic
1107654222 13:42574773-42574795 TGAGATTCAAACCCATCGTCCGG - Intronic
1109328615 13:60900380-60900402 TGAGTTTCAAGCACAAAGCTGGG + Intergenic
1111447738 13:88371860-88371882 TGAGTTTGAGACTCACAGACAGG + Intergenic
1112559171 13:100496705-100496727 TGAGTGTTAAACAGACAGCCAGG + Intronic
1118283430 14:64449750-64449772 TGACTTACACAACCACAGCCTGG + Intronic
1118732959 14:68682206-68682228 TGAGACTCAAACCCATCGCCTGG + Intronic
1119779428 14:77268477-77268499 TGAGCTTCACACCCACTGCCCGG + Exonic
1119997524 14:79270004-79270026 TGAGGCTCAAACCCAATGCCTGG - Intronic
1129598673 15:76984402-76984424 TGAAGTCCAAACCCTCAGCCTGG + Intergenic
1129930678 15:79408124-79408146 TGACCTTCCAACCCACAGCAAGG + Intronic
1130950315 15:88581398-88581420 TGAGTTTTAAGCCCATACCCAGG - Intergenic
1130957374 15:88637212-88637234 TTAGGTTTAAACCCACATCCAGG - Intronic
1131359754 15:91780256-91780278 TGAGTCTTTAACCCAAAGCCGGG + Intergenic
1132095980 15:98985240-98985262 TAAGTTTTAAACCCACTGGCTGG + Intronic
1132615671 16:840186-840208 TGAGGGTTAAACCCACAGCTCGG - Intergenic
1133441229 16:5822694-5822716 TGGGTTTCCAACCCATGGCCTGG + Intergenic
1135066684 16:19316027-19316049 AGAGTTTCAAACACAAAACCTGG - Intronic
1135743319 16:24995392-24995414 TGAGTTGGAAACCCAGAGGCTGG + Intronic
1137428327 16:48398588-48398610 TGAATTTAAAATCCACAGACTGG + Intronic
1137970028 16:52975661-52975683 TGGGTTTCAAACACAAAGCTGGG - Intergenic
1141049572 16:80748214-80748236 TGAGTTTTAAAGGCAGAGCCAGG - Intronic
1143106113 17:4531349-4531371 GGAGATTCCAACCCTCAGCCTGG - Intronic
1143398748 17:6626204-6626226 TGTATTTGAAAACCACAGCCTGG - Intronic
1143818813 17:9542831-9542853 TGAGTTTGTAACACACTGCCAGG + Intronic
1144464030 17:15482207-15482229 TGACATTTACACCCACAGCCGGG + Intronic
1144747453 17:17625311-17625333 TGAGATTCAAACCCAGGTCCGGG - Intergenic
1144769908 17:17753707-17753729 TGAGTATCAAAACCACACACAGG - Intronic
1145248128 17:21283319-21283341 TGATTTTCCATCCCACTGCCTGG + Intergenic
1149357192 17:55852488-55852510 TGAGGTTCAAACATTCAGCCAGG - Intergenic
1150369973 17:64628996-64629018 GGAGTTTAAAAACAACAGCCTGG - Intronic
1153744458 18:8162857-8162879 TAAGTGTCCAATCCACAGCCTGG + Intronic
1154172979 18:12063983-12064005 TGAGTGACACACACACAGCCAGG - Intergenic
1155540770 18:26865666-26865688 TGAGTGACAGACCCACAGCAAGG - Exonic
1156316634 18:35974965-35974987 TGCGTCTCAAACCCAAAGCCAGG + Exonic
1158809038 18:61009679-61009701 TGAGTTTCACACACAAATCCTGG + Intergenic
1160153678 18:76415379-76415401 TGGGTGTCAAAGCCACAGCCGGG - Intronic
1161114388 19:2488653-2488675 GGAGATTCAAACCTAAAGCCAGG - Intergenic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1162069729 19:8146425-8146447 AGAGTCCCCAACCCACAGCCTGG - Intronic
1162569389 19:11462334-11462356 TGATTTTTAAAATCACAGCCAGG + Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168377220 19:55890528-55890550 TGCTTGTCCAACCCACAGCCTGG - Intergenic
926037240 2:9645414-9645436 TGAGTCTGAACCCCACTGCCAGG - Intergenic
928095292 2:28401025-28401047 TGCATTTCAAACCCAGAACCTGG + Intronic
929664925 2:43826564-43826586 TGAGTTTTAAGCACAGAGCCTGG - Intronic
929858081 2:45652147-45652169 TGAGCTTGAAGCCCACAGCCTGG + Exonic
931174014 2:59834728-59834750 TGAGTTTCCAAGCCACAGAAGGG - Intergenic
933702950 2:85268837-85268859 TGACTTTCCAGCTCACAGCCAGG - Intronic
936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG + Intergenic
936734820 2:115427806-115427828 TTTGTTTCTACCCCACAGCCAGG + Intronic
937298719 2:120825494-120825516 TCAGGTGCACACCCACAGCCAGG - Intronic
941254666 2:163213852-163213874 TGAATTTGAAAACCGCAGCCAGG + Intergenic
946855008 2:223943281-223943303 TGCTTTACAGACCCACAGCCAGG + Intronic
947389398 2:229623586-229623608 TGAGTTTCAAAACCACAATAAGG + Intronic
947549542 2:231036936-231036958 TGGGTTTCAACCCCAGCGCCTGG + Intergenic
948220953 2:236269478-236269500 TAAGATGCAAACACACAGCCTGG + Intergenic
948830285 2:240595277-240595299 AGAGGTGCAGACCCACAGCCTGG - Exonic
1168852070 20:983910-983932 TGAGTGGCAAACTCAAAGCCAGG + Intronic
1169422412 20:5471112-5471134 TGCCTATCAAACGCACAGCCCGG - Intergenic
1170979458 20:21197572-21197594 TGATGTTCAAATCCACAGCTGGG - Intronic
1172773579 20:37395168-37395190 TGGGGCTCAAACCCACATCCGGG - Intronic
1172904423 20:38358359-38358381 TGAGTTGCAGACACACAGCAGGG - Intronic
1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG + Intronic
1175069964 20:56324884-56324906 TAATTTTCACACACACAGCCAGG - Intergenic
1175645895 20:60671391-60671413 TGAGTCACAAACTCACAGCCGGG - Intergenic
1179789311 21:43747298-43747320 TGAGTTAAAAACCCACAGGCAGG - Intronic
1181431693 22:22885313-22885335 TGAGTGTCATACCCACAGAGGGG + Intronic
961036571 3:123646788-123646810 TGGATTTCAAGCCCCCAGCCAGG + Intronic
961668182 3:128507028-128507050 GGAGCTTCAAAGGCACAGCCTGG + Intergenic
962080112 3:132129474-132129496 TGAGTCTCAAACCTAGAACCGGG - Intronic
962752602 3:138444873-138444895 TAAGTTTGAAAGTCACAGCCTGG - Intronic
968026795 3:195449386-195449408 GCAGTTTCATACCCACAGCTCGG + Intergenic
972802322 4:42490057-42490079 TGGGGTTCAAACACTCAGCCAGG + Intronic
977160676 4:93631093-93631115 TGAGACTCAAACCCAGAGTCTGG + Intronic
982767699 4:159367248-159367270 TGATTTTCAACCCCACACCTTGG + Intergenic
983697701 4:170553052-170553074 AGAGTTTCATAGCCACAGCCAGG - Intergenic
986501111 5:8400947-8400969 TGAGATTCAGACCTAGAGCCTGG - Intergenic
987110741 5:14684203-14684225 TAAATATCAAACCCACAGGCAGG - Intronic
988985601 5:36615520-36615542 TGATTATCAGACCCAGAGCCAGG - Intronic
990217792 5:53553073-53553095 TGGGATTCAAAACCACAGCAAGG - Intergenic
990479312 5:56192934-56192956 TGGTTTTCAATCCCACAGCACGG - Intronic
995189915 5:109309267-109309289 AGTGTTTAACACCCACAGCCTGG + Intergenic
997192330 5:131948698-131948720 TGAATCTCAAACCCACAAACTGG - Intronic
997469294 5:134107940-134107962 TGAGCTTGAAACTCATAGCCTGG - Intergenic
997884735 5:137620063-137620085 TCAGCTTCCAACCCACAGCCAGG + Exonic
997912405 5:137889233-137889255 CGATTTTTAAGCCCACAGCCAGG + Intronic
998552811 5:143093852-143093874 TGAGGTTCAACCCCACACCATGG + Intronic
999213752 5:149914150-149914172 TGAGTCCCAATCTCACAGCCAGG - Intronic
1001979963 5:176031257-176031279 TCCGTCCCAAACCCACAGCCAGG - Intronic
1002237419 5:177812406-177812428 TCCGTCCCAAACCCACAGCCAGG + Intergenic
1002350898 5:178582917-178582939 TGAGTGCCAAACCCACACACAGG + Intronic
1002724615 5:181286374-181286396 TCTGTCTCAAACCCACAGCCAGG + Intergenic
1003109715 6:3243395-3243417 TAAGTTTCCAACCCAGAGACTGG - Intronic
1004915492 6:20328247-20328269 GGAGTTTGAAACCACCAGCCCGG - Intergenic
1005015417 6:21370799-21370821 TCTGTTTCACACCCACAGCTGGG + Intergenic
1005970005 6:30753317-30753339 TGAGTTCCCAACCCAAATCCAGG + Intergenic
1007752802 6:44080641-44080663 TGAGTCTCTGACCCCCAGCCTGG + Intergenic
1008622346 6:53282934-53282956 TGGCCTTCAAACCCAGAGCCTGG + Intronic
1010750642 6:79613173-79613195 TGATTCTCAAAAGCACAGCCTGG - Intergenic
1010993970 6:82512325-82512347 TGAGTTTCAAGCACAAAGCTGGG + Intergenic
1011204249 6:84874462-84874484 TGTGTGCCATACCCACAGCCAGG - Intergenic
1016205516 6:141463318-141463340 TTAATTCCAAACTCACAGCCTGG + Intergenic
1018861341 6:167712746-167712768 AGGGGTTTAAACCCACAGCCTGG + Intergenic
1020725797 7:11812834-11812856 TTAGTTTAAAACCAGCAGCCAGG - Intronic
1022042214 7:26591956-26591978 TGGGTTTCAAACTCAGAGACAGG + Intergenic
1022766727 7:33420843-33420865 GGAGTTGCAAACACAGAGCCTGG - Intronic
1023352207 7:39331809-39331831 TGCCTTTCAAAACCACAGCGAGG - Intronic
1024495401 7:50040703-50040725 TGAGTTTCAAGCCCAAAACTTGG + Intronic
1026272226 7:68846401-68846423 GGAGTTTGAAACCACCAGCCTGG - Intergenic
1028295548 7:89125559-89125581 TTAAATTAAAACCCACAGCCTGG - Intronic
1028857558 7:95608849-95608871 TCAGTCCCACACCCACAGCCTGG + Intergenic
1029478202 7:100797625-100797647 TGAGAACCAACCCCACAGCCCGG + Intronic
1031596264 7:123653232-123653254 TGAGTTTGAAACCAACCACCTGG + Intergenic
1032055319 7:128679912-128679934 TGAGTTTCACACCCTAACCCTGG - Intronic
1033402946 7:141044268-141044290 TGGGCTTCAAACCCACAGTCTGG - Intergenic
1034878541 7:154746205-154746227 TGAGTTCCAAAGACACAACCTGG + Intronic
1036027318 8:4924425-4924447 TAAGTATAAAACCTACAGCCAGG + Intronic
1037459643 8:19096076-19096098 TGAGTCACAAACCCACAGAATGG + Intergenic
1038079020 8:24111147-24111169 TGGGTTTAAAATCCACAGTCTGG + Intergenic
1039472556 8:37822302-37822324 TGGTTTTCAAACCCACAAGCAGG + Intronic
1044312415 8:90709130-90709152 TGAGTTTCAAGCACAAAACCGGG - Intronic
1044356491 8:91228511-91228533 TGAGTTTCAGGCAGACAGCCTGG + Intronic
1044831903 8:96258890-96258912 TCAGTTACAAACCAACAGACAGG + Intronic
1046728522 8:117700231-117700253 TGAGTTTAAAACACTCAGACTGG + Intergenic
1048137223 8:131758160-131758182 TGAGATTCAAGGCCACATCCAGG + Intergenic
1048268861 8:133012042-133012064 GGAGTTTCCAACCCACAGGTTGG + Intronic
1048851170 8:138646721-138646743 TGAGTATCAGGCCCACATCCAGG + Intronic
1051002822 9:12305698-12305720 TTATTTTCAAACCCACAGTTAGG - Intergenic
1051840016 9:21385233-21385255 TCTGCCTCAAACCCACAGCCTGG - Exonic
1053014811 9:34655678-34655700 TGAGTGTCAGACCAACAGGCAGG - Intronic
1055253341 9:74335347-74335369 TGAGTTACACTGCCACAGCCAGG - Intergenic
1057541343 9:95974634-95974656 TGTGTTTCAAGACCACAGTCTGG + Intronic
1057868010 9:98696616-98696638 TGTGTAACAAACCCAGAGCCTGG + Intronic
1061982086 9:134111517-134111539 TGAGACTCAAAACCTCAGCCAGG + Intergenic
1189006713 X:37003137-37003159 TGAATTTCTAACCTACAACCAGG - Intergenic
1189058474 X:37726456-37726478 TGAGTTAGGAACCGACAGCCTGG - Intronic
1191132667 X:57031123-57031145 TGTGCTTGAAACCCAAAGCCTGG + Intergenic
1191254031 X:58272130-58272152 TGAGTTTCTGACCCCCACCCGGG - Intergenic
1192916093 X:75652553-75652575 TGAGTTTCAAGCACAAAACCAGG - Intergenic
1193161411 X:78233158-78233180 TGGGTTTCAAACACAAAACCAGG - Intergenic
1196718593 X:118832919-118832941 AGAGTTTCAAATCCCCAGGCCGG + Intergenic
1199851019 X:151725029-151725051 TGAGTTGCAAACAAACAGCACGG + Intergenic
1200967443 Y:9110105-9110127 TCAGTTTCCAGCCCACAGCCAGG - Intergenic
1201621333 Y:15962069-15962091 TGAGTTTCACACCTTCAGACAGG + Intergenic
1202143279 Y:21751471-21751493 TCAGTTTCCAGCCCACAGCCAGG - Intergenic