ID: 1097266033

View in Genome Browser
Species Human (GRCh38)
Location 12:57745348-57745370
Sequence GAATTCCTGGGGACTTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097266026_1097266033 -1 Left 1097266026 12:57745326-57745348 CCAGGAACTTCCGGCGACGAGGG 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1097266033 12:57745348-57745370 GAATTCCTGGGGACTTCCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 58
1097266022_1097266033 11 Left 1097266022 12:57745314-57745336 CCGGGAAGATTCCCAGGAACTTC 0: 1
1: 0
2: 0
3: 26
4: 232
Right 1097266033 12:57745348-57745370 GAATTCCTGGGGACTTCCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 58
1097266024_1097266033 0 Left 1097266024 12:57745325-57745347 CCCAGGAACTTCCGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1097266033 12:57745348-57745370 GAATTCCTGGGGACTTCCGTGGG 0: 1
1: 0
2: 0
3: 8
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097266033 Original CRISPR GAATTCCTGGGGACTTCCGT GGG Intronic
905695924 1:39973426-39973448 GAATTCTTGGGGACTTCTTTCGG + Intergenic
906651002 1:47512840-47512862 GAATTCCTGGGAATTTCCACTGG + Intergenic
908006370 1:59733095-59733117 GAATTCCAGGGGAGCTCAGTAGG - Intronic
909839815 1:80305928-80305950 GAATTCCTGTGGACTTCCAAGGG + Intergenic
913842761 1:123454184-123454206 GAATTCCTAGTAACTTCCCTTGG + Intergenic
922356110 1:224777808-224777830 GAATTCCTGGGAAATTCGGAAGG + Intergenic
922481858 1:225944855-225944877 GAATCCCTGGGGACTTCCAGAGG - Intergenic
922857008 1:228783934-228783956 GAATCCCTGGGGTCTCCCGATGG - Intergenic
1064245757 10:13666463-13666485 GTGTGCCTGGGGACTTCAGTGGG - Intronic
1076554009 10:131310759-131310781 GATTTCCCGGCCACTTCCGTCGG + Intronic
1079809344 11:24976300-24976322 GTATTCCTAGGGACTTGAGTTGG + Intronic
1085529165 11:77181527-77181549 GGCTTCCTGGGGACTTCAGGTGG + Exonic
1092847030 12:12593119-12593141 GAATGCCTGTGGACTTTAGTAGG + Intergenic
1093617722 12:21248519-21248541 GAACTCCTGGGTACTACCTTAGG - Intergenic
1097266033 12:57745348-57745370 GAATTCCTGGGGACTTCCGTGGG + Intronic
1103030288 12:117607003-117607025 GAGTCCCTGGGGAGTTCTGTAGG + Intronic
1103469517 12:121168860-121168882 GAATTCCAGGTTACTTCCTTAGG + Intronic
1106000427 13:25717994-25718016 GAAACCCTGGGGACTTGCATAGG - Intronic
1113738849 13:112697127-112697149 GGAGCCCTGGGGCCTTCCGTGGG + Intronic
1119953166 14:78766954-78766976 GAATTACTGGGAAATTCTGTTGG - Intronic
1122782378 14:104149206-104149228 GAATTCCTGGGGCCTTGGGTGGG + Intronic
1133015631 16:2938201-2938223 GAGTTCCTGAGGACTTCCCTGGG + Exonic
1135113054 16:19705546-19705568 GAATCCCAGGTGACTTCTGTAGG - Exonic
1141247222 16:82319258-82319280 TAATTGCTGGTGCCTTCCGTAGG + Intergenic
1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG + Intronic
1158724785 18:59960913-59960935 GAATTCCTCTGGCCTTCCCTGGG + Intergenic
1160764019 19:799095-799117 GCATTCCTCGGGGCTTCCGATGG + Intronic
1164238150 19:23356262-23356284 TAATTCCTGGGCATTTCAGTTGG - Intronic
1164868265 19:31623063-31623085 GACTTCCTGGGGACTGGGGTTGG + Intergenic
925990674 2:9251668-9251690 GAATTCATGGGGTCTTTCCTGGG + Intronic
933715325 2:85355567-85355589 GCACTCCTGGGGCCTTCAGTAGG - Intronic
934126131 2:88892553-88892575 GATATCCTGGGGATTTCCTTGGG + Intergenic
936685106 2:114818493-114818515 GAAGTGCTGGGGATTTCCTTAGG + Intronic
946309623 2:218876163-218876185 GTCTTCCTTGGGACTTCTGTTGG - Intergenic
948836490 2:240628570-240628592 GAGTTCCCGGGGACCACCGTGGG + Intronic
1168829715 20:839092-839114 AGATTCCTTGGGACTTCCTTGGG + Intronic
1179551294 21:42145624-42145646 GAATTACTGGGGCTTTCCATGGG + Intergenic
1183045525 22:35216613-35216635 GTACTCCTGGGCACTTCAGTTGG - Intergenic
1185027435 22:48423640-48423662 GAGTGCCTGGGCACTTCAGTTGG + Intergenic
962396380 3:135018320-135018342 GACTTCCTGGGGGCTTCCTGGGG + Intronic
971958428 4:33453810-33453832 GAATTCCTGGAGATTTGCCTAGG - Intergenic
982482399 4:155928381-155928403 GAATTCCTGGGGAAGTTCTTGGG - Exonic
994594318 5:101811201-101811223 GAATTTTTGGGGACTTCACTGGG + Intergenic
996391440 5:122966919-122966941 GAATTCCTGGGGACATTCTGGGG - Intronic
1006639081 6:35479782-35479804 AACTGCATGGGGACTTCCGTGGG - Intronic
1007383264 6:41504030-41504052 GAATTCCTGCCGGATTCCGTAGG - Intergenic
1017957316 6:159189375-159189397 AAATTCCTGGGAAGTTCCCTGGG + Intronic
1023454635 7:40324738-40324760 GAACTCCTGGGGTCTCCCATTGG - Intronic
1030102673 7:105960442-105960464 GTATTTCAGGGGACTTCCCTGGG - Intronic
1036481309 8:9141965-9141987 CATTTCTTGGGGCCTTCCGTTGG + Intronic
1037888383 8:22607198-22607220 GAGGTGCTGGGGACTTCAGTAGG - Exonic
1037927082 8:22851996-22852018 CAATCCCTGGGGACTGCAGTTGG + Intronic
1038394659 8:27238003-27238025 GAAAACCTGGGGGCCTCCGTGGG - Intronic
1041388643 8:57329979-57330001 GAATTCCTGGGGTCTTTCCTAGG - Intergenic
1047795879 8:128255136-128255158 GAATTCCTATGAACTTCAGTTGG + Intergenic
1049350318 8:142160821-142160843 GACTTCCTGGGAACGTCCATCGG - Intergenic
1051264743 9:15299617-15299639 GAGTACCTGGGGACTCCTGTGGG - Intronic
1060999298 9:127893926-127893948 TCATTCCTGGGGACTTCTGTTGG - Intronic
1203791873 EBV:156007-156029 GAAGTCCAGAGGGCTTCCGTGGG + Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187361723 X:18634251-18634273 GAATTCCTCAGGACTTCCTTTGG + Intronic
1191033843 X:56004889-56004911 GCATACCTGGAGATTTCCGTGGG + Intergenic
1199457847 X:148049343-148049365 GAATTCATGGTGACTTTCTTAGG + Intergenic
1202161416 Y:21939953-21939975 GGATTCCTGGGGAGTCCCGCAGG - Intergenic
1202229940 Y:22646420-22646442 GGATTCCTGGGGAGTCCCGCAGG + Intergenic
1202313216 Y:23549745-23549767 GGATTCCTGGGGAGTCCCGCAGG - Intergenic
1202557586 Y:26120849-26120871 GGATTCCTGGGGAGTCCCGCAGG + Intergenic