ID: 1097266806

View in Genome Browser
Species Human (GRCh38)
Location 12:57750751-57750773
Sequence CCAGAGTGTAACAACCTAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097266800_1097266806 26 Left 1097266800 12:57750702-57750724 CCACAGGTGTTGCATATGTGGAC 0: 1
1: 0
2: 1
3: 8
4: 123
Right 1097266806 12:57750751-57750773 CCAGAGTGTAACAACCTAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097266806 Original CRISPR CCAGAGTGTAACAACCTAAA GGG Exonic
903799897 1:25958924-25958946 CCTGACTGGAACATCCTAAAAGG + Intergenic
905006350 1:34713200-34713222 CCACAGTGTAACTACAAAAAGGG + Intronic
908556730 1:65264030-65264052 CCAGAGTGCAATAACCAAGAAGG + Intronic
916252451 1:162752474-162752496 CCAGTGTGAAACAACCAAAAAGG - Intronic
916977940 1:170101700-170101722 CCATAGTGTAAGAATCTAGAAGG - Intergenic
917239013 1:172927179-172927201 CCAGAGTGTAAAAACCCAATGGG - Intergenic
920275831 1:204803519-204803541 GCAGAGTGTAAGACCCTGAAGGG - Intergenic
924391132 1:243559653-243559675 CCAGATTAAAACAACGTAAAAGG + Intronic
1065225023 10:23534770-23534792 CCAGAGTGTAAACACCAAACAGG - Intergenic
1066428617 10:35332064-35332086 CCACAGTGTAACCAGCTACAGGG - Intronic
1066552999 10:36580337-36580359 GCACAGTGTAACACTCTAAAGGG + Intergenic
1066661978 10:37745802-37745824 CCAAAGTGTTAGAACCAAAATGG - Intergenic
1068621755 10:59192603-59192625 AGAGAGTGTAACTACCTAAATGG + Intronic
1074427643 10:113366257-113366279 CCAGAGTGTTTTATCCTAAATGG + Intergenic
1078141522 11:8696648-8696670 CCAGAATGTAATACCCTCAATGG - Exonic
1082310079 11:50635533-50635555 CCAAAATGTCACAATCTAAAGGG + Intergenic
1088349244 11:108866137-108866159 CCAGAGTCCAACTACCAAAATGG - Intronic
1091876013 12:3933520-3933542 ACAGAGAGTTACAACCTAACTGG + Intergenic
1093331348 12:17845926-17845948 ATAGAGTGTACAAACCTAAATGG + Intergenic
1093616711 12:21233924-21233946 CTAGTGTGTAACCACCTAACGGG + Intronic
1094108861 12:26839750-26839772 CCATAGTGTAACAGCCCAATGGG + Intergenic
1095318249 12:40793067-40793089 TCAGAGTCTAACAATCTTAAAGG + Intronic
1095887544 12:47204944-47204966 CAATAGTGTAACCACCTAACAGG + Intronic
1097266806 12:57750751-57750773 CCAGAGTGTAACAACCTAAAGGG + Exonic
1099374765 12:81885785-81885807 CCAGGGAGTGCCAACCTAAAAGG + Intergenic
1099946976 12:89255899-89255921 CCAGAGATTAGCAATCTAAATGG + Intergenic
1101190189 12:102324711-102324733 CTAGAGTATAACAAGCTAAAAGG + Intergenic
1101615473 12:106332383-106332405 CCAAACTGAAACAACCAAAATGG + Intronic
1105835765 13:24210265-24210287 CGAGACTGTATCAAGCTAAAAGG - Intronic
1106564539 13:30872951-30872973 CCAGAGTGTGAATACTTAAAAGG - Intergenic
1109096676 13:58127728-58127750 CCAAAGTGTAACCTCCTAAGAGG + Intergenic
1109246546 13:59961142-59961164 CCACAATGTAACAAGTTAAATGG - Intronic
1109972842 13:69792184-69792206 CCAGAGTATCAAAACGTAAAAGG + Intronic
1110198617 13:72820981-72821003 CCAGAGTGTAAACATCTTAAGGG - Intronic
1111354218 13:87078816-87078838 AAAGAGTGTATCAACCCAAATGG + Intergenic
1114371990 14:22099886-22099908 CCAGGGTGTAACATCTTAGAGGG + Intergenic
1117018251 14:51541227-51541249 GCAAATTGTTACAACCTAAATGG + Intronic
1117517062 14:56512359-56512381 ACAGAGAGGAACAACCTAACAGG + Intronic
1117610136 14:57474725-57474747 ACAGTGTTTAAAAACCTAAATGG + Intronic
1119459743 14:74790508-74790530 CCAAAATGTAAAAACCTAAGAGG - Intronic
1120145613 14:80975602-80975624 CCAGATTGCACCAAGCTAAATGG - Intronic
1127060070 15:55173231-55173253 CCTGCTTGTAACAACCTAAAGGG + Intergenic
1128133804 15:65248166-65248188 CCAGAGTGTGGCCATCTAAAGGG - Intronic
1130565209 15:84988229-84988251 ACAGAGAGCAACAACCTAACAGG - Intronic
1130748970 15:86688978-86689000 GCTGAGTGTAAAAAACTAAATGG - Intronic
1133895609 16:9925717-9925739 ACAGACTGAAACAACCAAAATGG - Intronic
1138544878 16:57711566-57711588 CCAGATTGTAACCACCCAAGGGG + Intronic
1141117939 16:81326649-81326671 ACAGAGTGTACAAACCTAGAGGG + Intronic
1143240677 17:5440362-5440384 CCAGACTGTGACATCCTCAAGGG + Intronic
1148978478 17:51550176-51550198 CCAGTGTGTGACAACAGAAATGG - Intergenic
1156816302 18:41315619-41315641 CCAGAGTGTAACAGCCTGATGGG - Intergenic
1157236323 18:45968102-45968124 CCAGAATGTAAGATCCTCAAAGG + Intergenic
1164458185 19:28426614-28426636 ACAAAGTGTCACAAACTAAACGG - Intergenic
933522807 2:83394266-83394288 ACAGAGGGTAAAAACTTAAAAGG - Intergenic
935262089 2:101364378-101364400 CCAAGTTGTAACAACCAAAAAGG + Intronic
943033449 2:182713013-182713035 CCAGAATGTAGCAAGCCAAAAGG - Intergenic
943610660 2:190030047-190030069 TCATAGTGTAACATCCCAAAGGG + Intronic
946122732 2:217530648-217530670 CAAGAGGTTGACAACCTAAAAGG + Intronic
946625401 2:221606829-221606851 CCAGTGTGTAGCAAGCTAGAAGG + Intergenic
947183844 2:227437192-227437214 CCACTGTGTACCAACCAAAATGG - Intergenic
948345705 2:237296154-237296176 CCAAAATGTAAAAACCAAAATGG - Intergenic
1172262486 20:33580422-33580444 CCAGAGGCTTACAACCTAAGAGG + Intronic
1172265076 20:33604751-33604773 ACAGTGTGCAACAACCTAGAGGG - Intronic
1174484723 20:50853935-50853957 CCGCAGTGTAACAACCAAAAAGG + Intronic
949957555 3:9281463-9281485 CCAGAGTCTAACAACCAAGAGGG - Intronic
952347379 3:32501424-32501446 CCAGTGTGGAACCACCTAGAGGG + Intronic
953675044 3:44994496-44994518 CCAGAGGATAAAAACCCAAATGG - Intronic
954986650 3:54800237-54800259 CCAGGGTCTAACGACATAAAGGG - Intronic
956626835 3:71274891-71274913 GCAAAGTGTTACTACCTAAAGGG - Intronic
957252748 3:77794919-77794941 TGAGAGTGTAACTACTTAAATGG + Intergenic
958054074 3:88386786-88386808 CCAGAGTTTGACAACGTAAGTGG + Intergenic
958110510 3:89137396-89137418 CCAGAGTGTAATAAGCCTAAGGG - Intronic
964121903 3:153193870-153193892 CCAGAGTGTAATAAAAGAAAAGG - Intergenic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
966840830 3:184085905-184085927 CCACAGTATAACAAGCAAAATGG - Intergenic
968245486 3:197142801-197142823 TCAGAGTGTAAAATCCAAAATGG + Intronic
973156943 4:46967281-46967303 CCATAGTGTGATAACCAAAAAGG + Intronic
974571077 4:63649665-63649687 GAAGAGTGTAATAACCTTAATGG + Intergenic
976335291 4:83878678-83878700 CCAGAGTGTAACAATAGAAGAGG + Intergenic
978529857 4:109702635-109702657 CCAGAGTGAAACAAACAAAAAGG - Intronic
978860807 4:113446781-113446803 CCATAGAATAACAACCTTAAAGG + Intergenic
983479381 4:168254265-168254287 CCAGAGTGGGACTATCTAAAGGG + Intronic
986212159 5:5684180-5684202 GCAGAGTGTAACCACCCAATGGG + Intergenic
988972804 5:36486726-36486748 CCAGAATGTAAAAACCTATGGGG - Intergenic
1000379012 5:160612175-160612197 CCACAGAGTAAAAACCTGAAAGG - Intronic
1002772102 6:298798-298820 CCAGAGTCTAACACGCTAAGAGG - Intronic
1004612788 6:17261229-17261251 CCAGAGAGTATAAACATAAAAGG + Intergenic
1006567011 6:34968360-34968382 CCAGAGTGTAACAGAATAGAAGG + Intronic
1008406029 6:51119577-51119599 CATGAGTGTAACAATCTAATAGG + Intergenic
1010301593 6:74266681-74266703 CCAGAGAGTAAAAATCTATAGGG + Intergenic
1013473657 6:110487816-110487838 CCAAACTGTAACAACCTAATGGG + Intergenic
1014625158 6:123715935-123715957 CCTGAGAGTAACAACATATATGG + Intergenic
1017191252 6:151655057-151655079 CCAGATTGTATCAACATTAAGGG + Intergenic
1017912083 6:158802086-158802108 CCAGATTGTTTCAATCTAAAGGG - Intronic
1021601020 7:22363263-22363285 CCAGAATGTAATCACCAAAATGG + Intergenic
1022970074 7:35508839-35508861 CCAGAGGGCAACAACCAAAGTGG + Intergenic
1023766191 7:43513265-43513287 CCAGAGTGTAAAGATCTTAAGGG - Intronic
1024712585 7:52033835-52033857 CCAGGGTGCAACACCCTTAAAGG - Intergenic
1024952452 7:54878710-54878732 CCCTAGTGAAACAACCTAATTGG - Intergenic
1028920484 7:96305259-96305281 CCAGAGTTTAGCAAGCAAAAAGG + Intronic
1030511917 7:110493156-110493178 CCACAGTGAAACAACAGAAATGG + Intergenic
1031507612 7:122606178-122606200 CCAGAGTGGAAAAACCTCCAGGG - Intronic
1035094974 7:156346684-156346706 CCAGGGTGTACCTACCTCAAAGG + Intergenic
1039052141 8:33504875-33504897 CCAGATTGTAACAGCCGGAAAGG - Intronic
1040997583 8:53417691-53417713 CCAAAATGTAACCACCTGAATGG + Intergenic
1041358785 8:57028678-57028700 CCAGTGCATAACAAGCTAAAGGG + Intergenic
1041893707 8:62900498-62900520 CCAGAGTGTCCCTACCTAAGTGG + Intronic
1046126781 8:109920194-109920216 CCAGAGTGTAAGCTCCTTAAAGG - Intergenic
1051951541 9:22640253-22640275 CCAGTGTGAAATAACCTAACTGG - Intergenic
1055370011 9:75588221-75588243 TCAGGGTGTAAAAACCTACAAGG - Intergenic
1056071735 9:82994165-82994187 CCAGAGTGTAATAAAATCAAAGG + Intronic
1187081573 X:15995190-15995212 CCAGAGTATAAAAACTTCAAGGG - Intergenic
1188018942 X:25135855-25135877 CCAAAGAGAAACAACCTATAGGG - Intergenic
1192621854 X:72684385-72684407 TCATAGTGAACCAACCTAAAAGG - Intronic
1194670839 X:96730699-96730721 CTAGAGTGTAACCTCCTTAAAGG + Intronic
1196744155 X:119054376-119054398 CCTGAGGGTAAGAACCTAAGGGG - Intergenic