ID: 1097269784

View in Genome Browser
Species Human (GRCh38)
Location 12:57766900-57766922
Sequence AGCTGGGCGTAGAGGGGCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 276}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097269775_1097269784 2 Left 1097269775 12:57766875-57766897 CCCTTGCAGAAAAGTTCGGCCAG 0: 1
1: 0
2: 0
3: 16
4: 205
Right 1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG 0: 1
1: 0
2: 1
3: 29
4: 276
1097269772_1097269784 5 Left 1097269772 12:57766872-57766894 CCCCCCTTGCAGAAAAGTTCGGC 0: 1
1: 0
2: 1
3: 51
4: 638
Right 1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG 0: 1
1: 0
2: 1
3: 29
4: 276
1097269776_1097269784 1 Left 1097269776 12:57766876-57766898 CCTTGCAGAAAAGTTCGGCCAGA 0: 1
1: 0
2: 1
3: 15
4: 229
Right 1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG 0: 1
1: 0
2: 1
3: 29
4: 276
1097269769_1097269784 15 Left 1097269769 12:57766862-57766884 CCTCGACAGCCCCCCCTTGCAGA 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG 0: 1
1: 0
2: 1
3: 29
4: 276
1097269770_1097269784 6 Left 1097269770 12:57766871-57766893 CCCCCCCTTGCAGAAAAGTTCGG 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG 0: 1
1: 0
2: 1
3: 29
4: 276
1097269773_1097269784 4 Left 1097269773 12:57766873-57766895 CCCCCTTGCAGAAAAGTTCGGCC 0: 1
1: 0
2: 1
3: 3
4: 96
Right 1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG 0: 1
1: 0
2: 1
3: 29
4: 276
1097269774_1097269784 3 Left 1097269774 12:57766874-57766896 CCCCTTGCAGAAAAGTTCGGCCA 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG 0: 1
1: 0
2: 1
3: 29
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097269784 Original CRISPR AGCTGGGCGTAGAGGGGCCT GGG Exonic
900087597 1:905885-905907 AGCTGGTCGTGGTGGAGCCTGGG - Intergenic
900119086 1:1041000-1041022 AGCGGGGCTGGGAGGGGCCTGGG + Intronic
900119124 1:1041075-1041097 AGCGGGGCTGGGAGGGGCCTGGG + Intronic
900131809 1:1090421-1090443 AGCTGGGCCTGGAGGGGACACGG + Exonic
900293815 1:1938676-1938698 ACCTGGGTGCAGAGAGGCCTGGG - Intronic
901289996 1:8116655-8116677 TGTGGGGCGTGGAGGGGCCTTGG - Intergenic
901534395 1:9872859-9872881 AGCTGGGTATGGAGGGGCTTGGG + Intronic
902448845 1:16484295-16484317 AGCAGGCCGGGGAGGGGCCTCGG + Intergenic
902505924 1:16939058-16939080 AGCAGGCCGGGGAGGGGCCTCGG - Exonic
903070864 1:20726480-20726502 AGCTGGGCATTGCGGGGCCCTGG - Intronic
903154913 1:21436725-21436747 AGCAGGCCGGGGAGGGGCCTCGG - Intergenic
903403993 1:23081028-23081050 TCCTGGGCTTGGAGGGGCCTGGG + Intronic
903888105 1:26552870-26552892 AGATGGGAATAGAGGGGGCTGGG - Intronic
903944621 1:26954057-26954079 TGCTGGGGGCAGAGGGGACTGGG + Intronic
903964965 1:27082273-27082295 AGCTGGGCGTGGTGGCGCATAGG - Intergenic
905355706 1:37382758-37382780 AGCTGAGCCTACAGGGGCCCAGG + Intergenic
906583580 1:46956313-46956335 AGCTGGGTGTAGAGGGACAACGG - Intergenic
907918465 1:58891856-58891878 AGCTGGGAGTAGAGTGTCCAAGG + Intergenic
911509651 1:98795661-98795683 AGATGGGGGTTGAGGGGCCAAGG + Intergenic
918328398 1:183432260-183432282 AGCTGGGCATGGAGCGGCCCTGG + Intergenic
918332140 1:183471509-183471531 AGCCGGGCGTGGAGAGGGCTGGG - Intergenic
919972740 1:202591451-202591473 AGAGGTGAGTAGAGGGGCCTGGG - Exonic
920215570 1:204359744-204359766 AGCTGGGGGGAGGGGTGCCTTGG - Exonic
922152534 1:223018093-223018115 AGCCGGGCCTCAAGGGGCCTTGG - Intergenic
922793225 1:228322107-228322129 AGCTGGTGGAACAGGGGCCTCGG + Exonic
923550598 1:234960014-234960036 AGATGGATGTGGAGGGGCCTGGG - Intergenic
923586206 1:235274234-235274256 AGCTGGGCGTGGTGGTGGCTTGG + Intronic
1062911175 10:1213429-1213451 GGCTGGGCTTCGAGGGGCCTGGG + Intronic
1063909083 10:10811476-10811498 AGATGGGGGGAGAGGGGCCCTGG + Intergenic
1064221586 10:13445463-13445485 GGCTGGGAGTCGAGGGACCTGGG + Intronic
1065068985 10:22003170-22003192 GGCCGGGCGGAGAGGGGCCAGGG - Intronic
1065970037 10:30798861-30798883 AGCTGGGAGAAGCGGGGCCGTGG - Intergenic
1066182946 10:32981111-32981133 AGCTGGCCCAGGAGGGGCCTGGG + Intronic
1066186681 10:33016275-33016297 AGCTTGACTTAGAGGGGACTTGG - Intergenic
1067477919 10:46578669-46578691 AGCTGCGGCTGGAGGGGCCTCGG + Intronic
1067616818 10:47763118-47763140 AGCTGCGGCTGGAGGGGCCTCGG - Intergenic
1067759782 10:49035987-49036009 GGCAGGCAGTAGAGGGGCCTTGG + Intronic
1069955047 10:72044805-72044827 AGCTGGGTGGGGAGGGGGCTGGG - Intergenic
1070596176 10:77834634-77834656 ACCTGGCTGTGGAGGGGCCTGGG + Intronic
1071103055 10:82061520-82061542 AGCTGGAGGTAGAGGGGACCAGG - Intronic
1071566510 10:86674010-86674032 TGCTGTCCCTAGAGGGGCCTGGG - Intronic
1073151190 10:101312771-101312793 AGCTGAGCCAGGAGGGGCCTCGG + Intergenic
1073537661 10:104292301-104292323 AGCTGGGTGTAGTGGTGCCCAGG - Intronic
1074142863 10:110690541-110690563 AGCTGGGGGAAGAGGGACATGGG - Intronic
1074183392 10:111082079-111082101 ATCTGGGCACTGAGGGGCCTGGG + Intergenic
1075199346 10:120389178-120389200 AGCTGGGATTACAGGTGCCTGGG + Intergenic
1076435841 10:130440735-130440757 CGCTGTGCATAGAAGGGCCTGGG - Intergenic
1076994111 11:289991-290013 AGCCGGACGTTGAGGGGGCTGGG - Exonic
1077061331 11:619073-619095 AGCTGGTCGTGGAGGGTCCCTGG + Exonic
1077602404 11:3582515-3582537 CTCAGGGAGTAGAGGGGCCTAGG - Intergenic
1078016738 11:7621291-7621313 AGCTGGGCCAAGAAGGGGCTAGG + Intronic
1078107775 11:8369527-8369549 AGGTGGGGGCAGTGGGGCCTGGG + Intergenic
1078433033 11:11302258-11302280 AGCTTGGCCTGGAGGTGCCTTGG + Intronic
1078855891 11:15206299-15206321 AGCTGGGCCCAGAAGGGCCAGGG + Intronic
1081617930 11:44601468-44601490 AGCTGGGCCTAATGGGGCCAAGG - Intronic
1083335593 11:61919949-61919971 AGCTGGGCTCAGAGAGTCCTAGG - Intronic
1083667577 11:64284301-64284323 AGCTCTGCAGAGAGGGGCCTGGG - Exonic
1084595081 11:70112062-70112084 AGCTGGGGGTAGGGGAGCCCAGG - Intronic
1084950425 11:72662318-72662340 TGCTGGGAGTTGAGGGACCTTGG - Intronic
1085521599 11:77142427-77142449 AGCTGGGCTTTGAGAGGCCTTGG + Intronic
1087564857 11:99842038-99842060 AGCTGGGCGTGGTGGTGCGTGGG - Intronic
1089740133 11:120576797-120576819 TGGTGGTCATAGAGGGGCCTTGG - Intronic
1091222283 11:133936559-133936581 AGCTGGGGGTGCAGGGGCCGAGG + Intronic
1091408194 12:221760-221782 AGCTGCACGTAGAGGTGCCCAGG - Intronic
1092062726 12:5564404-5564426 AGCTGGGTGAAGTGTGGCCTGGG - Intronic
1093165943 12:15804417-15804439 AGCTGAGCGAAGAGAAGCCTGGG - Intronic
1094122172 12:26986161-26986183 AGATGTGCGCAGATGGGCCTAGG - Intronic
1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG + Exonic
1099975614 12:89542804-89542826 AGCCTGGCTTGGAGGGGCCTGGG + Intergenic
1101086647 12:101243014-101243036 AGCAGGGGGTGGAGGGGACTGGG + Intergenic
1101387940 12:104274236-104274258 AGCTGGGCCTGAAGGAGCCTTGG - Intronic
1102218532 12:111178945-111178967 AGCAGGGCTGAGAGAGGCCTGGG + Intronic
1103502330 12:121412854-121412876 AGCTGGGATTACAGGTGCCTGGG + Intronic
1103983176 12:124750036-124750058 AGCGGGGCGGGGAGGGGGCTTGG + Intergenic
1105634774 13:22206867-22206889 CTCTGGGCATAGAGAGGCCTGGG + Intergenic
1107890302 13:44908589-44908611 AGCTGGGTGTGGAAGGCCCTGGG - Intergenic
1112502912 13:99956221-99956243 GGCTGGGCGGAGAGGGGAGTGGG - Intergenic
1113488013 13:110669352-110669374 GGCTGGGTGTAGAGGGGGTTTGG - Intronic
1113567366 13:111326998-111327020 AGCCAGGCTCAGAGGGGCCTGGG - Intronic
1114233268 14:20802640-20802662 AGCTGGGGGCAGAGGGGTCAGGG - Intronic
1114611045 14:24040704-24040726 ACCTGGAAGTAGAGGGGCATGGG + Intergenic
1115235541 14:31206706-31206728 AGCTGGGGAAAGAGGGCCCTAGG - Intronic
1115987462 14:39116546-39116568 AGCTGGGACTACAGGCGCCTGGG + Intronic
1118629944 14:67693793-67693815 AGCTGGGCGTGGTGGCGCATGGG - Intronic
1118747188 14:68782748-68782770 ATAAGGGCTTAGAGGGGCCTTGG - Intergenic
1124956422 15:34363425-34363447 AGCTGGGCATGGAGGGGTCCTGG - Exonic
1125937393 15:43648865-43648887 AGCGGGGCGGGGCGGGGCCTAGG - Intronic
1129245682 15:74277403-74277425 CGGTGGGCGTGGAGGGGCCATGG + Intronic
1129860280 15:78855245-78855267 TGCTGGTCCTGGAGGGGCCTGGG - Intronic
1129992238 15:79975214-79975236 AGCTGGGATTACAGGCGCCTGGG + Intergenic
1130260832 15:82353057-82353079 AGCTGGGGCAAGTGGGGCCTAGG + Intergenic
1130280401 15:82515949-82515971 AGCTGGGGCAAGTGGGGCCTAGG - Intergenic
1130471774 15:84232132-84232154 AGCTGGGGCAAGTGGGGCCTAGG - Intergenic
1130479268 15:84346703-84346725 AGCTGGGGCAAGTGGGGCCTAGG - Intergenic
1130492502 15:84441426-84441448 AGCTGGGGCAAGTGGGGCCTAGG + Intergenic
1130594071 15:85236770-85236792 AGCTGGGGCAAGTGGGGCCTAGG - Intergenic
1131158270 15:90088317-90088339 AGCTGGGAGAGGAGGGGCCCAGG + Intronic
1131283558 15:91039875-91039897 AGCTGGGGCAAGTGGGGCCTAGG + Intergenic
1134341753 16:13352978-13353000 ATCTGGGCGTATATGAGCCTTGG + Intergenic
1136349670 16:29698776-29698798 AGCTGGGATTAGAGGGGACAGGG - Intergenic
1138647855 16:58438288-58438310 AGCTGGGAGCAGATGGGCCCTGG - Intergenic
1141652366 16:85399915-85399937 AGCTGGGTGTGCAGTGGCCTGGG - Intergenic
1142147382 16:88498230-88498252 AGCTGGGCAGAGGGGGCCCTGGG + Intronic
1142623816 17:1180147-1180169 CGCTGGGCGAGGAGGGGCCGCGG + Intronic
1144626841 17:16848190-16848212 AGCAGTGCTTACAGGGGCCTGGG - Intergenic
1145101973 17:20085066-20085088 TTCTGGGCTTAGAGTGGCCTTGG + Intronic
1145218893 17:21072731-21072753 AGCTGGGAGCAGGGGTGCCTCGG - Intergenic
1145265582 17:21378210-21378232 AGCTGCGCGAGGAGGGGCCGCGG - Intronic
1146842591 17:36166241-36166263 ACCTGGACGTAGAGGGGCCTTGG - Exonic
1146854904 17:36254200-36254222 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146865716 17:36334176-36334198 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1146870804 17:36378092-36378114 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146878163 17:36429174-36429196 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146882112 17:36450320-36450342 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1147073688 17:37978716-37978738 ACCTGGACGTAGAGGGCCCTTGG - Intronic
1147080108 17:38014325-38014347 ACCTGGACGTAGAGGGCCCTTGG + Intronic
1147085209 17:38058254-38058276 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG + Intergenic
1147101156 17:38182220-38182242 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1148242809 17:46011581-46011603 AGCTGGTGGGAGAGGAGCCTCGG - Intronic
1148344399 17:46893890-46893912 AAGTGGGCGTGGAGGTGCCTTGG + Intergenic
1148357352 17:46984369-46984391 AGCCGGGCTTAGAGGGGCTCAGG + Intronic
1148386537 17:47238466-47238488 AGGTGTGCAGAGAGGGGCCTGGG - Intergenic
1148456224 17:47812991-47813013 AGCTGGGAGTACAGGGGCTGGGG - Intronic
1150587017 17:66528084-66528106 AGCTGGGCTTACAGATGCCTGGG - Intronic
1151486146 17:74402088-74402110 AGCTGGGAGTGGAGGGGCAAAGG - Intergenic
1151955088 17:77376190-77376212 AGCTGGCTGGAGAGGGGGCTGGG + Intronic
1152232827 17:79123393-79123415 AGCTGGGGGTAGAGGGGGTGGGG - Intronic
1152625012 17:81384081-81384103 AGCTGGGTGTCGGGGGGCCTGGG + Intergenic
1152634227 17:81423866-81423888 AGCTGGGCTGGGCGGGGCCTGGG + Intronic
1154145969 18:11866493-11866515 GGCTGTGAGAAGAGGGGCCTGGG + Intronic
1160357204 18:78238722-78238744 AGGCGGTCGCAGAGGGGCCTGGG + Intergenic
1160390476 18:78527633-78527655 TGGTGGGCGTGGAGGGGCCTGGG - Intergenic
1160509832 18:79447215-79447237 AGATGGGGCTAGAGGGGCCCGGG - Intronic
1162511775 19:11123362-11123384 CTCTGGGTGAAGAGGGGCCTAGG - Intronic
1163290497 19:16376518-16376540 AGCTGTGCGTTGAGATGCCTGGG + Intronic
1163642673 19:18470357-18470379 AGGTTGGGGTAGAGGGGCATGGG + Intronic
1163665909 19:18604072-18604094 AGAAGGGCTGAGAGGGGCCTGGG - Intronic
1164718236 19:30409441-30409463 AGCTGGGAGCAGGGGGGCCAGGG - Intronic
1167159184 19:47756309-47756331 AGCTGGGCTTAGAGGAGTCACGG - Intronic
1167201595 19:48069150-48069172 AGGTTGGCATACAGGGGCCTGGG + Intronic
925376437 2:3389240-3389262 ACCTGGGCCGAGAGAGGCCTGGG - Intronic
926294253 2:11556711-11556733 AGCTGGGAAAAGATGGGCCTGGG - Exonic
927031812 2:19127960-19127982 AGCTGGGAGTAGAATGGACTAGG - Intergenic
928317621 2:30258309-30258331 AGCTGGGAGCAGAGAGGCCATGG - Exonic
928720526 2:34115783-34115805 GGCCGGGAGGAGAGGGGCCTAGG - Intergenic
929911300 2:46091462-46091484 TGAGGGGAGTAGAGGGGCCTGGG + Intronic
935186804 2:100741996-100742018 AGCTGGGGGAAGAGGGACATAGG + Intergenic
935860120 2:107320527-107320549 AGCAGGGCGTAAGGGGGCCAGGG + Intergenic
937248401 2:120508900-120508922 AGCTTGGGGTGGACGGGCCTTGG + Intergenic
937306501 2:120874820-120874842 AGCTGGGGGTGGAGGGTACTCGG + Intronic
937439378 2:121903520-121903542 TGCTGTGCGTAGAAGGGCATGGG + Intergenic
938299952 2:130203329-130203351 AGCTGGACCCAGAGAGGCCTGGG + Intergenic
938456761 2:131471160-131471182 AGCTGGACCCAGAGAGGCCTGGG - Intronic
941464046 2:165804166-165804188 AGCTGGGCGTGGAGGCCACTTGG - Intergenic
942555746 2:177170877-177170899 TGCTGGGAGGAGAGGTGCCTAGG - Intergenic
943812249 2:192202155-192202177 AGCTGGGCATGGTGGGGCCCAGG - Intergenic
946708742 2:222485441-222485463 AGCAGGGCGGAGAAGGGCTTTGG + Intronic
947594067 2:231399893-231399915 GGCTGGGCTGTGAGGGGCCTGGG - Exonic
947752810 2:232541560-232541582 AGCTGCTCTCAGAGGGGCCTGGG + Intronic
948770278 2:240248243-240248265 AGCAGGGGGTGGATGGGCCTGGG - Intergenic
1168897603 20:1334587-1334609 AGCTTGGCAAAGAGGGGCTTTGG + Intronic
1169375602 20:5064429-5064451 AGCTGGGTGTGGTGGGGCGTGGG + Intergenic
1171439413 20:25148454-25148476 AGGTGGGCTTGGAGGGGCCCCGG - Intergenic
1172699759 20:36845832-36845854 AGCTGGGGGTGGGGGGCCCTGGG + Intronic
1174213047 20:48895112-48895134 AGCTGGGAGTGGAGGGGGCAGGG + Intergenic
1174536246 20:51253768-51253790 AGCTTGGTGTAGTGGGACCTGGG + Intergenic
1174543377 20:51306912-51306934 GGCTGGGCGCAGGTGGGCCTCGG + Intergenic
1174850999 20:53994662-53994684 AGTTGTGCGTAGAGGGACCCAGG - Intronic
1175336547 20:58199912-58199934 AGAAGGGAGGAGAGGGGCCTGGG + Intergenic
1175770845 20:61623154-61623176 AGGTGGGAGTAGAAGGGCCTGGG + Intronic
1175793806 20:61758684-61758706 AGCTGGGGTTAGAGTGGCCACGG - Intronic
1175795155 20:61766360-61766382 GGCTGGGCCAAGGGGGGCCTAGG - Intronic
1178067697 21:28924365-28924387 AGCTGGGGGTAGAGTGGGGTAGG + Intergenic
1178975865 21:37220832-37220854 AGCTGGGCGCCAGGGGGCCTGGG - Intergenic
1179818156 21:43921275-43921297 AGCTGGGCGGAGAGGAGCACAGG - Intronic
1180170500 21:46055763-46055785 AGCTGGGCGTGGTGGGAGCTGGG + Intergenic
1180199269 21:46214993-46215015 AGCTGGGCGTGCAGGGGTCCAGG + Intronic
1180963632 22:19774279-19774301 AGCTGGGACTACAGGTGCCTAGG - Intronic
1181006126 22:20014570-20014592 AGCTGGGCCTTGGGGGTCCTGGG - Intronic
1181236309 22:21449730-21449752 AGCTGGGCTTGGAGGGGCCCTGG - Exonic
1181750177 22:24983724-24983746 AGCTGGGGGTCTGGGGGCCTGGG + Intronic
1182695769 22:32198488-32198510 AGGGGGGCGTAGGGGGTCCTAGG + Intronic
1183088659 22:35505740-35505762 AGCTGGGTGTAGAGGTGCCCAGG + Intergenic
1183359977 22:37378465-37378487 GGCTGAGCGTGGAGGGGCATGGG + Intronic
1184089566 22:42285108-42285130 AGCAGGGCCTGGAGGGGCCCTGG - Intronic
1184114869 22:42416605-42416627 AGGTGGGTGTAGAGGGGGCTGGG + Intronic
1184257421 22:43295183-43295205 AGGTGGGCATGGAGGGGCCAGGG - Intronic
1185277953 22:49957861-49957883 AGGTGGGCGTGGCGGGGTCTTGG - Intergenic
1185328105 22:50237459-50237481 ATCAGGGAGTAGAGGGGCCCAGG + Intronic
1185377301 22:50488387-50488409 AGGTGGGGGTGGAGTGGCCTTGG + Intronic
949368640 3:3310453-3310475 AGCTGGAGGCAGAGGGACCTCGG - Intergenic
950282354 3:11719346-11719368 GGCTGGCCTGAGAGGGGCCTTGG - Intronic
951110864 3:18802225-18802247 ATCTGAGAGTAGAGGGACCTTGG - Intergenic
953027491 3:39153417-39153439 AGGTGAGCGCCGAGGGGCCTCGG - Exonic
953265286 3:41381017-41381039 AGCTGGGGGCAGAGGGGCAGGGG - Intronic
954581612 3:51706307-51706329 ATCTGGGAGGGGAGGGGCCTAGG - Intergenic
955327250 3:58018645-58018667 AGCTGGGATTACAGGCGCCTTGG + Intronic
961038605 3:123661217-123661239 AGCTGGGCATCGTGGGGGCTGGG + Intronic
961370362 3:126424876-126424898 GGCTGGGCGAAGAGGGTCCCAGG + Intronic
962008193 3:131369159-131369181 AGCTGGCCCTAAAGGGGCTTAGG + Intergenic
962902949 3:139776661-139776683 AGCTGGCCACAGAGGGGCTTTGG + Intergenic
962977988 3:140463068-140463090 AGGTGGGCTTAGAGGGGCACAGG - Intronic
965812498 3:172605925-172605947 AGCTGGGCGTAGTGGGGCACGGG + Intergenic
968680022 4:1911454-1911476 AGCTGGGATTACAGGCGCCTGGG - Intronic
969737109 4:8999439-8999461 CTCAGGGAGTAGAGGGGCCTAGG + Intergenic
969796301 4:9531027-9531049 CTCAGGGAGTAGAGGGGCCTAGG + Intergenic
970441149 4:16082540-16082562 AGCTAGGCCTGGAGGGGGCTTGG - Intronic
971176112 4:24284152-24284174 AGCTGGGCGTGGTGGGGCAGGGG + Intergenic
973279333 4:48342152-48342174 AGCTGGGCGGGGACGGGCCCGGG + Intronic
973997656 4:56475467-56475489 AGCAGGGCCTAGGAGGGCCTAGG + Intronic
980450014 4:132958703-132958725 AGGTGGGCAGAGAGGGGCCCTGG + Intergenic
980901588 4:138910450-138910472 TGCTGGGAGAAGAGGAGCCTCGG - Intergenic
983406076 4:167332455-167332477 AGCTGGGCGTGGTGGCGCCCAGG - Intergenic
985826714 5:2197363-2197385 AGCTCGGCTGAAAGGGGCCTCGG - Intergenic
988482548 5:31641948-31641970 AGCCGGGGGTAGTGGGGTCTGGG - Intronic
991355768 5:65767390-65767412 AGCTGGGCTAAAAGGGGCCAAGG - Intronic
991408138 5:66321479-66321501 AGTTGGGGGAAGAGGGGGCTAGG + Intergenic
992986257 5:82233697-82233719 AGTTGAGGGCAGAGGGGCCTGGG - Intronic
996559179 5:124810267-124810289 AGCTGGCTATAAAGGGGCCTTGG - Intergenic
997232193 5:132253302-132253324 AGCTGGGCCCAGAGAGGCCCTGG - Intronic
997426520 5:133806643-133806665 AGCTCGACGTTCAGGGGCCTCGG + Intergenic
998220520 5:140274859-140274881 AGCTGGGATTACAGGTGCCTGGG - Intronic
998699474 5:144681580-144681602 AGCTGGGCGTATGGCTGCCTCGG - Intergenic
1000505420 5:162110930-162110952 AGCTGGGCCTAGAGCAGCCATGG + Intronic
1001245750 5:170105015-170105037 AAGAGGGCGCAGAGGGGCCTGGG - Intergenic
1002541160 5:179907517-179907539 AGCCGGGCGCGGAGGGGCCGGGG - Intronic
1002944610 6:1749441-1749463 AGCTGGGCGTGGTGGGGGCGGGG + Intronic
1003675653 6:8202178-8202200 AGCTGGGGGCAGAGGGGGCGGGG + Intergenic
1004702735 6:18094123-18094145 AGCTGGGGGAAGAGAGGACTGGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006369016 6:33633145-33633167 TGGTGGGCGTAGCGGGGCGTGGG + Intronic
1006614032 6:35312575-35312597 TGCAGGGCGAAGGGGGGCCTGGG + Intronic
1006717791 6:36131166-36131188 AGCTGGGCTGAGAGGGGACTAGG - Intronic
1006812717 6:36830422-36830444 AGCTGGGAGGAGAGAAGCCTTGG + Intronic
1007385526 6:41518004-41518026 AGCTGGGGGTAGTGGAGACTAGG - Intergenic
1007449260 6:41930776-41930798 AGCTGGGGGTTCGGGGGCCTTGG + Intronic
1007667969 6:43527416-43527438 AGCTGGGCGTAGTGGCGCGCAGG - Intronic
1013457349 6:110342706-110342728 GGCTGGGGGTAGAGGGGAATGGG - Intronic
1015535032 6:134258838-134258860 AGCTGGGCATAGTGGTGCATGGG + Intronic
1018702182 6:166435968-166435990 AGCTAGGTGTAGAGAGGCCCAGG - Intronic
1018722170 6:166581364-166581386 AGGTGGGTGTAGAGAGGCCTAGG - Intronic
1019554864 7:1624165-1624187 AGCTGGGCATCTAGGGGCCTGGG + Intergenic
1019745902 7:2700286-2700308 AGCTGGGCCTTAAGGGCCCTTGG + Exonic
1019869026 7:3741326-3741348 AGCTGGGAGAACAGGGGGCTGGG - Intronic
1020254830 7:6497308-6497330 AGCCGGATGTAGAGGGGCCCTGG - Intergenic
1024053370 7:45644230-45644252 AGCTGGCCCTAGAGCGGCCTGGG + Intronic
1024540703 7:50473247-50473269 AGCTGGGCTGAGAGGTGCCCTGG + Intronic
1024550243 7:50556724-50556746 AGCTGGGCGGAGTGGGACTTAGG - Intronic
1024648610 7:51387683-51387705 AGCTGGGCCTGGAGAGGCCCTGG + Intergenic
1025178898 7:56815189-56815211 AGGTGGGCGTGGAGGGCCCACGG + Intergenic
1025179334 7:56816979-56817001 AGGTGGGCGTGGAGGGCCCACGG + Intergenic
1025179792 7:56818865-56818887 AGGTGGGCGTGGAGGGCCCACGG + Intergenic
1025180241 7:56820703-56820725 AGGTGGGCGTGGAGGGCCCACGG + Intergenic
1025180712 7:56822685-56822707 AGGTGGGCGTGGAGGGCCCACGG + Intergenic
1031999224 7:128254015-128254037 GGCTGGGGGTAGAAGGGACTAGG + Intronic
1032125309 7:129188975-129188997 AGTTGGGCGCCGAGGGGCCGGGG + Exonic
1032605707 7:133349313-133349335 AGCTGGGAGAAGAGGGGTATGGG - Intronic
1032790846 7:135241433-135241455 AGCTGGGGGCAGAGTAGCCTGGG - Intronic
1034425804 7:151013527-151013549 AGGCGGGCCTAGAGGGGCCGGGG - Intronic
1034872925 7:154699712-154699734 GGCTGGGCCCAGAGTGGCCTTGG + Intronic
1037804892 8:22053671-22053693 AACGGGGCGTCGGGGGGCCTGGG + Intronic
1037966072 8:23135042-23135064 GGCTGAGCATGGAGGGGCCTGGG - Intergenic
1039616260 8:38957076-38957098 TGCTGGTGGGAGAGGGGCCTGGG + Intronic
1041191421 8:55359245-55359267 AGCTGGGCATGCAGAGGCCTGGG + Intronic
1047522997 8:125609820-125609842 AGATGGGGTTAGAGGGGCCAGGG + Intergenic
1048287234 8:133151437-133151459 AGCTGGGAGGAGAGGGCTCTTGG - Intergenic
1049692017 8:143965637-143965659 AGCTGGCAGCAGAGGGGCCAGGG - Intronic
1051418822 9:16870834-16870856 ACCTGAGCGCAGAGGGGCCGCGG - Intronic
1051904023 9:22074631-22074653 AGCTGAGAGTAGAGTGGGCTGGG + Intergenic
1052304211 9:26987233-26987255 AGCTGGGATTACAGGTGCCTGGG + Intronic
1052706687 9:32001883-32001905 AGCTGGGAGGAGAGAGGACTAGG + Intergenic
1052824655 9:33166502-33166524 TTCTGGGGCTAGAGGGGCCTCGG + Intronic
1052854421 9:33398277-33398299 AGATGGGCAGAGAGGGGCCAGGG + Intronic
1053084180 9:35204087-35204109 AGCTGGGCTCAGAAGGGCCCAGG + Intronic
1053682426 9:40494438-40494460 AGATGGGCAGAGAGGGGCCAGGG + Intergenic
1053932409 9:43122764-43122786 AGATGGGCAGAGAGGGGCCAGGG + Intergenic
1054281288 9:63130491-63130513 AGATGGGCAGAGAGGGGCCAGGG - Intergenic
1054295525 9:63329938-63329960 AGATGGGCAGAGAGGGGCCAGGG + Intergenic
1054393545 9:64634442-64634464 AGATGGGCAGAGAGGGGCCAGGG + Intergenic
1054428194 9:65139656-65139678 AGATGGGCAGAGAGGGGCCAGGG + Intergenic
1054502186 9:65881888-65881910 AGATGGGCAGAGAGGGGCCAGGG - Intronic
1055023438 9:71694269-71694291 AGCTGGGCGTAGAGGCGGGTGGG - Intronic
1056558212 9:87707134-87707156 AGCAGGGCGTGGAGGGGGCTGGG - Exonic
1056752848 9:89364395-89364417 AGCTGTGTGCAGAGGGGGCTGGG + Intronic
1057727495 9:97578548-97578570 AACTGGGCCTAGAGGAACCTGGG + Intronic
1058053369 9:100427453-100427475 GGCCGGGCGTAGAGGGGGCCGGG + Intronic
1059749697 9:117236399-117236421 AGCTGGCAGTAGATGGGCATTGG + Intronic
1061414493 9:130438979-130439001 TGCTGGGCATGAAGGGGCCTGGG - Intergenic
1061417207 9:130453577-130453599 AGCTGGGCGTATAGACCCCTGGG + Intronic
1061512491 9:131069595-131069617 TGCTGGGTTTAGAGGGGCCAGGG - Intronic
1061512500 9:131069626-131069648 TGCTGGGTTTAGAGGGGCCAGGG - Intronic
1061782228 9:133003066-133003088 TGCTGGGCTGAGAGAGGCCTGGG - Intergenic
1061942992 9:133893014-133893036 TGCTGGGCGGTGAGGGGCCCTGG + Intronic
1062184348 9:135209548-135209570 AGCTGAGGGAAGAGGGGCCTAGG + Intergenic
1062207824 9:135346975-135346997 AGCTGGGCCTAGGGGTGCCGGGG - Intergenic
1062322686 9:135998153-135998175 AGCTGGGCGGCAGGGGGCCTGGG - Intergenic
1062359510 9:136180881-136180903 TCCTGGGCGGAGAGGGGCCTGGG + Intergenic
1062380611 9:136284987-136285009 AGTTGGGCTGAGAGGGGCCTGGG + Intronic
1062414525 9:136441362-136441384 AGCTGGGCTTGGAGAGGCCCTGG + Exonic
1186405016 X:9294296-9294318 AGCCCGGTGTAGGGGGGCCTGGG - Intergenic
1190407893 X:50105746-50105768 AGCTGTGAGAAGAGGGGCTTTGG - Intergenic
1192184026 X:68934441-68934463 AACTGGGAGTCAAGGGGCCTAGG - Intergenic
1194699667 X:97098353-97098375 AGCTGGGGGTAGAAGGGTATGGG - Intronic
1198727471 X:139692288-139692310 AGCTGGGCTGAGCGGGGCCAGGG - Intronic
1198872799 X:141193776-141193798 AGCTGAGGGTAAAGGGGCCAAGG + Intergenic