ID: 1097270777

View in Genome Browser
Species Human (GRCh38)
Location 12:57772591-57772613
Sequence GAGGGCAAACTCAGGGAGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 312}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097270767_1097270777 3 Left 1097270767 12:57772565-57772587 CCTCCAGGAAATCGAACTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG 0: 1
1: 0
2: 1
3: 35
4: 312
1097270769_1097270777 0 Left 1097270769 12:57772568-57772590 CCAGGAAATCGAACTGGAGGAAG 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG 0: 1
1: 0
2: 1
3: 35
4: 312
1097270764_1097270777 13 Left 1097270764 12:57772555-57772577 CCTCATTCCACCTCCAGGAAATC 0: 1
1: 0
2: 0
3: 23
4: 295
Right 1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG 0: 1
1: 0
2: 1
3: 35
4: 312
1097270765_1097270777 6 Left 1097270765 12:57772562-57772584 CCACCTCCAGGAAATCGAACTGG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG 0: 1
1: 0
2: 1
3: 35
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097270777 Original CRISPR GAGGGCAAACTCAGGGAGGC GGG Exonic
901213449 1:7539751-7539773 GAGGGCAGACATAGGAAGGCAGG + Intronic
902754662 1:18541118-18541140 GAGGCCAGAGGCAGGGAGGCTGG - Intergenic
903663005 1:24990094-24990116 GAGGGAAGACTGTGGGAGGCAGG + Intergenic
904214975 1:28912214-28912236 GACTGCAAGCTCAGGAAGGCAGG - Intronic
904330545 1:29755517-29755539 GAGGGAGACCCCAGGGAGGCAGG + Intergenic
904777315 1:32918523-32918545 GGGAGCAAAGGCAGGGAGGCAGG - Intergenic
904941995 1:34170452-34170474 GTGGGCCAGCTCAGGGAGGGAGG + Intronic
904985619 1:34546113-34546135 AATGGCAAACTCAGGCAGGCAGG - Intergenic
905824109 1:41016295-41016317 GGGGCCAAACTGAGGGAGGAAGG + Intronic
905971581 1:42145940-42145962 GGGGGCCGACTCGGGGAGGCGGG - Intergenic
905972461 1:42152534-42152556 AAGGGCAACCTCAGGTGGGCCGG + Intergenic
906211120 1:44012822-44012844 GAGGGCACACTCAGGCCGGGGGG - Intronic
908229375 1:62088370-62088392 GAGAGCAAATTCAGGGGAGCAGG - Intronic
909688994 1:78384490-78384512 CAGTGCAAACTCATGGAGGAAGG + Intronic
910268612 1:85368312-85368334 GAAGGCAAACCCACGGAGCCAGG + Intronic
910842076 1:91570620-91570642 GTGGGCAAACTCAGGGAGATAGG + Intergenic
910915074 1:92279626-92279648 GAGGGCAAGCTGAGGCAGGGCGG + Intronic
911083634 1:93957928-93957950 GAGAGCAAAGTCATGGAGGCTGG - Intergenic
911368461 1:96968822-96968844 GAGAGCAAAGGCAGGGAGTCTGG + Intergenic
912447618 1:109750021-109750043 GAGACCAAAGGCAGGGAGGCAGG - Intronic
914263998 1:146021927-146021949 GAGTGCCAAGTCAGGGAGGGAGG + Intergenic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
916380939 1:164209891-164209913 GAGAGAAAACTCAGGGTAGCAGG - Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
917745958 1:178007403-178007425 CAGAGCAAAATGAGGGAGGCAGG + Intergenic
919747283 1:201016792-201016814 GAGGGCAGTCTCAGGAGGGCTGG - Intronic
919896763 1:202013798-202013820 GATGGCAAACTGATGGAGGCTGG + Intronic
920199640 1:204251717-204251739 GAGGGCAAGCTCAGGGTGCTGGG - Intronic
921055595 1:211540248-211540270 GAAGGCACAATCAGGGAGGTAGG - Intergenic
921273022 1:213489657-213489679 CAGTGGCAACTCAGGGAGGCAGG + Intergenic
922323881 1:224510863-224510885 GAGGACAAAGCCAGGGAGGAAGG - Intronic
922336040 1:224618565-224618587 GAGGGGAAACTCGGGGAGGAAGG + Intronic
923552155 1:234972795-234972817 GAGGTCAGACTTAGGCAGGCAGG - Intergenic
924381043 1:243464740-243464762 GAGGGAAAAGGCAGGCAGGCAGG + Intronic
924645347 1:245872448-245872470 GTCGGCCAGCTCAGGGAGGCCGG - Intronic
924932016 1:248740316-248740338 CAGGGAAAACTCAGGCAGGGAGG - Intronic
1062915372 10:1239186-1239208 GGGAGTAAACTCCGGGAGGCAGG - Intronic
1063941557 10:11135120-11135142 GAGGAAAAACACAGGGAGTCGGG - Intronic
1067051573 10:43024615-43024637 GAGGGAAGACTCAGAGGGGCTGG - Intergenic
1068486624 10:57667161-57667183 CAGGGAAAACTCATGGAGACAGG - Intergenic
1070644549 10:78192569-78192591 GAGGGCCAACTCAGGCTGGGAGG + Intergenic
1071446916 10:85757107-85757129 GGGGGCAAACTTGGGGCGGCAGG + Intronic
1073214485 10:101829039-101829061 GAGGCCAAACTCAGCGAGGGTGG - Intronic
1073461447 10:103667972-103667994 GAGGGCCATCTCAGCCAGGCAGG + Intronic
1073874244 10:107902853-107902875 TAGGGGAAAGTCAGGGATGCGGG - Intergenic
1074389048 10:113041790-113041812 GCTGGGAAATTCAGGGAGGCGGG - Intronic
1075365625 10:121885652-121885674 GAGGGCCAAGGCAGGCAGGCAGG + Intronic
1075629478 10:123992310-123992332 GTGGGGCAACTGAGGGAGGCCGG - Intergenic
1076219610 10:128722677-128722699 GAGGGGAAACTGAGTCAGGCTGG + Intergenic
1076783775 10:132739027-132739049 GAAGTCAAAGTAAGGGAGGCCGG + Intronic
1076799500 10:132814052-132814074 CAGGGCAGACCCAGGGAGCCGGG + Intronic
1076804277 10:132847380-132847402 GAGGGCCCACCCAGGGAGGCCGG + Intronic
1076849276 10:133085272-133085294 GAGGTAAGAGTCAGGGAGGCAGG + Intronic
1078567987 11:12433738-12433760 GATGCCAAACCCAGAGAGGCCGG - Intronic
1078742763 11:14082654-14082676 GAGTGAACACTCAGGGAGACTGG + Intronic
1079930513 11:26554086-26554108 CAGGGGAAGGTCAGGGAGGCAGG - Intronic
1081677292 11:44977866-44977888 GAGCGCAATCTCAGGCATGCAGG + Intergenic
1081784241 11:45735412-45735434 CAGGGCAAACGCAGCCAGGCTGG + Intergenic
1083298607 11:61728448-61728470 AAGGACAAGCTCAGGAAGGCAGG - Intronic
1083319917 11:61839184-61839206 GAGGGCGAGCTGAGGCAGGCAGG - Intronic
1083669715 11:64292917-64292939 GCGGGCAAAACCAGGGATGCTGG - Exonic
1083949438 11:65945929-65945951 CAGATGAAACTCAGGGAGGCAGG + Intronic
1083951932 11:65961420-65961442 AAGTGCAAGCGCAGGGAGGCCGG + Intergenic
1084190417 11:67496121-67496143 GAGGGCACACACAGGAAGGGAGG - Intronic
1084478048 11:69400110-69400132 GTGGCCCAGCTCAGGGAGGCAGG + Intergenic
1084590631 11:70088037-70088059 GAGGGCAACCTCCTGGAGGCGGG + Exonic
1084761259 11:71272597-71272619 CAGGCCTAACTCAAGGAGGCAGG + Intergenic
1084903168 11:72325423-72325445 GATGGCAAACTCAGGGACAGGGG + Intronic
1084943670 11:72627502-72627524 GTGAGCAAAGGCAGGGAGGCAGG + Intronic
1085514989 11:77106683-77106705 ATGGGCAAACTCAGGGAGGGAGG - Intronic
1089589135 11:119529397-119529419 GATGGCAGACCCAGGGAGGTGGG - Intergenic
1089685692 11:120145305-120145327 GAGGGCAAAGTCAGAGAGGATGG + Intronic
1090440141 11:126718583-126718605 GAGGGCAAACTGGGGAAGGAAGG + Intronic
1091600868 12:1916959-1916981 GAGGGCCAAGTCGGGGTGGCTGG - Intronic
1091799195 12:3314062-3314084 GAGAGCAAAGGCAGGGAGGCTGG - Intergenic
1096727410 12:53575754-53575776 GAGGACACACTCAGGGAAGAAGG + Intronic
1097146275 12:56941492-56941514 GAGGACAGACCCAGGTAGGCTGG + Intergenic
1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG + Exonic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1097661906 12:62439482-62439504 GAGGGCAAAGTGTGGGAGGAGGG - Intergenic
1101840007 12:108321227-108321249 GAGTGCAAACTTAGGGAGGAGGG + Intronic
1103853681 12:123949842-123949864 GAGAGCATACTCGGCGAGGCCGG - Intronic
1104373411 12:128243748-128243770 CAGTACAAACCCAGGGAGGCAGG - Intergenic
1104882600 12:132082916-132082938 GAGCACAAAGTCAGGGAGACAGG - Intergenic
1104889765 12:132134643-132134665 GTGGGCACACTCGGGGAGGTAGG - Intergenic
1104889798 12:132134749-132134771 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104889822 12:132134819-132134841 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104889857 12:132134924-132134946 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104889890 12:132135032-132135054 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104889958 12:132135242-132135264 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890004 12:132135383-132135405 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890038 12:132135491-132135513 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890084 12:132135631-132135653 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890096 12:132135667-132135689 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890108 12:132135703-132135725 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890202 12:132135979-132136001 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890226 12:132136049-132136071 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890238 12:132136085-132136107 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890250 12:132136121-132136143 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890262 12:132136157-132136179 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890297 12:132136262-132136284 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104890331 12:132136369-132136391 GTGGGCACACTCGGGGAGGTGGG - Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1106086171 13:26543781-26543803 GAGGTCAAGCTTAGTGAGGCTGG - Intergenic
1106308004 13:28530827-28530849 GATTGCAAACTCGGAGAGGCAGG - Intergenic
1107853411 13:44591975-44591997 GAGGGGAAGCTGAGGGTGGCTGG + Intergenic
1108619547 13:52168080-52168102 GAAGGCAAACTCAGGGTGAGTGG + Intergenic
1108640296 13:52377537-52377559 GAAGGCAAACTCAGGGTGAGTGG + Exonic
1113279860 13:108777513-108777535 GTGGGGAAATTCACGGAGGCTGG + Intronic
1114451262 14:22827461-22827483 GAGTTCAAACTCATGGAAGCAGG + Intronic
1114648247 14:24267588-24267610 GGGGGCAAAGTCAGGGACGTGGG + Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1117561068 14:56939354-56939376 GAGGGCAGCGTCAGGGAGACAGG - Intergenic
1118064460 14:62175746-62175768 GAGGGCAAACTCAGAAAACCAGG - Intergenic
1118323097 14:64764786-64764808 GAGAGCGAACTCTGGGGGGCCGG - Intronic
1119649326 14:76372509-76372531 GAGCTCAAACTCAGGGAGGGAGG + Intronic
1120579623 14:86230005-86230027 CAGGGCAAAGTCAGGGAAGTGGG + Intergenic
1120971695 14:90213401-90213423 AAGGCCAAACTCAGGGGGCCGGG - Intergenic
1121309097 14:92925300-92925322 GAGGGCATTTTCTGGGAGGCAGG - Intronic
1122234418 14:100323715-100323737 GGAGGCAGAGTCAGGGAGGCTGG + Intronic
1122308655 14:100780968-100780990 GATGGCAAATTCTGGGGGGCTGG + Intergenic
1123438540 15:20273130-20273152 ATGGGAAAACTCAGGGAAGCCGG - Intergenic
1128788933 15:70418519-70418541 GAGTGCAAAGTAAGGAAGGCTGG + Intergenic
1128793303 15:70448603-70448625 TCAGGCACACTCAGGGAGGCCGG + Intergenic
1129110984 15:73336950-73336972 TTGGGCAGAGTCAGGGAGGCCGG - Intronic
1130032827 15:80331984-80332006 GAGTGAACACTCAGGGAGGGCGG + Intergenic
1130375922 15:83328515-83328537 GAGTGTAAACCCAGGAAGGCTGG - Intergenic
1130529488 15:84735328-84735350 GAGAGCAAACGCAGAGAGGCTGG - Intergenic
1131303937 15:91224438-91224460 GAGGGGCTACTCAGTGAGGCGGG + Intronic
1131514114 15:93066056-93066078 GTGGGGCAACTGAGGGAGGCCGG + Intronic
1131671128 15:94620532-94620554 GAGGCCAAACAGATGGAGGCAGG - Intergenic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1132734165 16:1377458-1377480 GAGGGAGGACTCAGGGAGGGAGG - Intronic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1132826947 16:1909868-1909890 GAGGCCAGACTCAGGCAGGCTGG - Intergenic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1134638088 16:15807988-15808010 AAGGGCAGACGCAGGGAGCCTGG - Intronic
1135134783 16:19879543-19879565 GAGGGCGAACACAGGCAGGCAGG + Intronic
1135350666 16:21726545-21726567 AAGGGCACACACTGGGAGGCTGG - Exonic
1135899757 16:26446179-26446201 GTGGACAGACTGAGGGAGGCTGG - Intergenic
1138390729 16:56668322-56668344 GCAGGCAACCTCAGGGAAGCTGG - Intronic
1138434428 16:56989299-56989321 GACGGGAAACTGAGGCAGGCGGG - Intergenic
1138548841 16:57736064-57736086 GGGGGCAAAACCAGGGAGGCCGG + Intronic
1139605361 16:68014330-68014352 GTGGAGAAACTCAGGTAGGCTGG - Intronic
1140087245 16:71808437-71808459 GAGGGCTCATTCAGGGAGCCTGG - Intronic
1140650991 16:77088295-77088317 GTGGGCAAACCCAGGCAAGCTGG - Intergenic
1140970890 16:80011118-80011140 GAGGTGAATCCCAGGGAGGCTGG + Intergenic
1141675007 16:85513236-85513258 GAGGGAAAACCCAGGCGGGCTGG - Intergenic
1141934776 16:87229953-87229975 AAGGGCAAGGACAGGGAGGCAGG - Intronic
1142363331 16:89637407-89637429 GAGGGCCTGCCCAGGGAGGCGGG - Intronic
1142742693 17:1940424-1940446 GAGGGGAAACTGAGGTAGGAGGG - Intronic
1143492082 17:7290418-7290440 GTGGGGCAACTGAGGGAGGCCGG + Exonic
1143943481 17:10568196-10568218 AAGGCCAAACACTGGGAGGCAGG + Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1145007684 17:19346679-19346701 GAGGGAGACATCAGGGAGGCAGG - Intronic
1146515997 17:33489750-33489772 GAGTGAACACTCAGGAAGGCTGG - Intronic
1146678981 17:34793456-34793478 GAAGGCAAAGCCAAGGAGGCTGG + Intergenic
1147676564 17:42210623-42210645 TAGGTAAAACTCAGGTAGGCGGG - Intronic
1149905891 17:60526085-60526107 GGGGGCAAACTGAGGGACGGCGG + Exonic
1150225660 17:63523259-63523281 GAGGGCAGACGCAGGCTGGCGGG + Intergenic
1150633529 17:66897232-66897254 GAGGCCATTCCCAGGGAGGCTGG + Intergenic
1150720058 17:67606861-67606883 GAGAACAATCTCAGGGAGGGTGG - Intronic
1150833080 17:68541047-68541069 CAGGGCAGGATCAGGGAGGCAGG - Intronic
1151186383 17:72367187-72367209 GAGGTCAAACTCAGTGAGGAGGG + Intergenic
1151240482 17:72753683-72753705 CAGAGCACATTCAGGGAGGCGGG + Intronic
1152120129 17:78413390-78413412 GAGGGGCAACTCGGGGATGCTGG + Intronic
1152519217 17:80845585-80845607 GAGGGCATCCTCGGGCAGGCTGG - Intronic
1155263307 18:24066566-24066588 GAGGGCAAAATCAGGAAAACTGG - Intronic
1155907497 18:31469279-31469301 CAGGCCGCACTCAGGGAGGCTGG + Exonic
1157617681 18:48996900-48996922 GGGAGCAAAGGCAGGGAGGCTGG + Intergenic
1159637725 18:70825775-70825797 TAGGCAAAAATCAGGGAGGCTGG + Intergenic
1160716251 19:578144-578166 GGAGGGAAACTGAGGGAGGCGGG - Intronic
1160825685 19:1079625-1079647 GACAGAAACCTCAGGGAGGCGGG - Intronic
1160911516 19:1476019-1476041 GAGCACACACTTAGGGAGGCAGG + Intronic
1161466827 19:4435663-4435685 GAAATCAAACTCAGGGAGCCAGG - Intronic
1163483522 19:17572906-17572928 GTGGGCAAAGGCCGGGAGGCTGG + Intronic
1165177392 19:33940247-33940269 AAGGGGAAAGGCAGGGAGGCTGG - Intergenic
1165705248 19:37971398-37971420 CAGGGCAGAATCAGGGAAGCGGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166709934 19:44930354-44930376 CTGGGCATACGCAGGGAGGCTGG + Intergenic
1167414604 19:49363479-49363501 GAGGGCAAGATCTGGGACGCAGG + Intronic
924998458 2:385240-385262 GAGGGCTGCCTCAGGGTGGCTGG - Intergenic
925251429 2:2442178-2442200 GTGGGGAGACTCAGGGAGGTGGG + Intergenic
927135917 2:20096503-20096525 CTGAGCAAACTCAGTGAGGCTGG + Intergenic
928116914 2:28551911-28551933 GAATGCAAGCTCAGTGAGGCAGG + Intronic
929814967 2:45223363-45223385 GAGAGCAAACTCAGAGAGGAAGG + Intergenic
930200304 2:48546354-48546376 GTGTGCAAAGACAGGGAGGCAGG - Intronic
932421037 2:71601568-71601590 GATGCCAAACACAGGGAGACTGG - Intronic
932713023 2:74081598-74081620 GTGGGCAAAGGCAGAGAGGCTGG + Intronic
933052954 2:77623115-77623137 GTGGGAAAAACCAGGGAGGCAGG + Intergenic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
936518784 2:113198943-113198965 CAGGACTAACTCGGGGAGGCTGG + Intronic
938883140 2:135613152-135613174 GAGGCCAAAGTCAGCCAGGCTGG + Intronic
941336739 2:164254975-164254997 CTGGGCAAACTCAAGGAGGTAGG + Intergenic
942022643 2:171882109-171882131 TAGGGGTGACTCAGGGAGGCTGG - Intronic
942446102 2:176080057-176080079 CCGGGCACACTCAGAGAGGCGGG + Exonic
942777985 2:179607659-179607681 GAGGTCATAGTCAGGGAGTCAGG + Intronic
943672693 2:190680357-190680379 CAGGGCACACTCTGGGAAGCCGG - Intronic
945225354 2:207528093-207528115 AAGAGCAAACTCAGGTAGGGAGG + Intergenic
946740363 2:222795302-222795324 GAGGTCAAATTCAGGGAAGAAGG - Intergenic
948844710 2:240677502-240677524 GAGGGCAGGCCCAGGGAGGCGGG + Intronic
948849150 2:240697377-240697399 GAGGGCAGGCCCAGGGAGGCGGG - Intronic
949053692 2:241912300-241912322 GAGGGCAACACCGGGGAGGCGGG + Intergenic
949063908 2:241977845-241977867 GATGGCAAACCATGGGAGGCAGG - Intergenic
1168970882 20:1929991-1930013 GAGGGCAGACTGTGGGAGGAGGG - Intronic
1170813186 20:19691328-19691350 GAGGGCAAAGTCCTTGAGGCAGG + Intronic
1171220697 20:23394221-23394243 GAGAGCAAAAGCAGGGAGACCGG + Intronic
1171393779 20:24817875-24817897 GACGGCACAGTCAGGGAGGGCGG + Intergenic
1172099625 20:32477374-32477396 GAGGGCCAACTCAGTTAGGAGGG - Intronic
1172766219 20:37352481-37352503 GAAGCCAGGCTCAGGGAGGCTGG - Intronic
1172793752 20:37523310-37523332 GAGAGCAAATGCAGCGAGGCTGG - Exonic
1172894525 20:38291233-38291255 CATGGCTGACTCAGGGAGGCTGG + Intronic
1173429808 20:42977031-42977053 GAGGGCTAAGTCAGGCTGGCTGG - Intronic
1173522123 20:43708097-43708119 AAAAGAAAACTCAGGGAGGCAGG - Intronic
1173544668 20:43885869-43885891 AAAGGCAGAATCAGGGAGGCTGG - Intergenic
1175445666 20:59017939-59017961 GGGGGCAACCTCAGGGTGCCCGG + Intergenic
1176004090 20:62850392-62850414 GAGGGAAGACTCAGAGAAGCAGG - Intronic
1176192927 20:63821882-63821904 GAAGGGAAACTAAGGGAGTCAGG - Intronic
1178125303 21:29509595-29509617 GAGGGCAAAGTGAGGTAGGCTGG + Intronic
1178847845 21:36188315-36188337 GAGAGCCATCTCAGGGAGTCGGG - Intronic
1178977400 21:37231704-37231726 GAGGGCAAGATCAGGGAGGCCGG + Intronic
1179239974 21:39581389-39581411 GAAAGCACACTCAGTGAGGCAGG - Intronic
1180245201 21:46542692-46542714 AAGGGCCATCACAGGGAGGCAGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181594012 22:23902758-23902780 GGTGGGAAGCTCAGGGAGGCTGG - Intergenic
1182058817 22:27382186-27382208 GAGGGCAGAGTGAAGGAGGCTGG + Intergenic
1183321820 22:37169651-37169673 GGGGGCAAACCCTGGGAGGAGGG - Intronic
1184092329 22:42299235-42299257 GAGGACAATCACAGGGAGGACGG + Intronic
1185034123 22:48462382-48462404 GTGTGAACACTCAGGGAGGCGGG - Intergenic
1185081935 22:48714281-48714303 GAGTGCAAACTCAGCAAGACAGG + Intronic
1185156814 22:49198059-49198081 GAGGGCTGACACAGGGAGGCTGG - Intergenic
949735986 3:7172229-7172251 GAGAGCTAAATCTGGGAGGCAGG + Intronic
950574874 3:13826198-13826220 GACTGCAAACTCAGGGAAGGTGG - Intronic
951344084 3:21524788-21524810 GAGGTCAAAAGCAGGAAGGCAGG + Intronic
954145266 3:48631315-48631337 GAGGACAGAGTCAGGGAGGCAGG + Intronic
954389833 3:50262892-50262914 GAGGACAGGCACAGGGAGGCGGG - Intergenic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
955804968 3:62724236-62724258 GAGGAAAAAATCAGGGAGGAGGG - Intronic
956460101 3:69463006-69463028 GAGTGCAATCCCAGGGAAGCAGG - Intronic
958484729 3:94690330-94690352 GAGTGTAAACTCAAGGAGGATGG + Intergenic
958914341 3:100031707-100031729 GAAGGCAAAGACAGGGAGGGAGG + Intronic
959358254 3:105359022-105359044 GAGGACAAACTCCTGCAGGCTGG + Intergenic
959573032 3:107906123-107906145 GAGAGCACTCCCAGGGAGGCTGG + Intergenic
960531677 3:118772555-118772577 GAGGGAGAACTAAGGGAGCCAGG - Intergenic
960972372 3:123149069-123149091 GAGGACAAAGACAGGGAGGAAGG + Intronic
961817321 3:129557869-129557891 GCAGGCAAAGACAGGGAGGCAGG - Intronic
962210039 3:133470036-133470058 GAGAGAAAACCCAGGGAGGTTGG + Intronic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963240994 3:143002097-143002119 GGAGGGAAACTGAGGGAGGCCGG - Intronic
963643696 3:147887548-147887570 GAGTGCAAAATCAGGGATGGTGG + Intergenic
964450700 3:156810011-156810033 GAGGGCAAGCCCAAGGATGCAGG - Intergenic
966933729 3:184691999-184692021 GTGGGCACACTCACTGAGGCAGG + Intergenic
967007750 3:185400239-185400261 GTGCGCAGACGCAGGGAGGCGGG - Intronic
968726111 4:2248537-2248559 GGGGACAGACTCAGGCAGGCAGG + Exonic
969421075 4:7096116-7096138 GAGGGCCAAACCATGGAGGCAGG - Intergenic
969937505 4:10696739-10696761 GAAGGCAATCCTAGGGAGGCTGG - Intergenic
973649133 4:52980083-52980105 GAGGGCAAATGAAGGAAGGCAGG - Intronic
974087202 4:57273836-57273858 GAGGGGAATCTCAGTGATGCTGG + Intergenic
974916766 4:68187424-68187446 GAATTCAAACTCAGGGAGTCTGG - Intergenic
976456025 4:85247568-85247590 CAGAGCAAAATGAGGGAGGCAGG - Intergenic
979485689 4:121267358-121267380 GAAGGCAAGCTCTGGGAGGAAGG + Intergenic
980878503 4:138686243-138686265 GGGCGCAAACTCATGGAGCCTGG + Intergenic
982033583 4:151325093-151325115 GAGGCCAGACTCGGGGAGGGTGG - Intronic
984261713 4:177451021-177451043 CAGGACAAATTCAGGGAGTCAGG + Intergenic
984361707 4:178742828-178742850 GAGCGCAGACGCAGGCAGGCAGG - Intergenic
985186922 4:187327562-187327584 GAGTGTAAACTTAGGGAGACAGG - Intergenic
986340652 5:6786426-6786448 GATGCCAAACTCAGGGAGCATGG - Intergenic
987194355 5:15510593-15510615 GAGGACAAATTCAGGGAGATTGG + Intronic
990278372 5:54224140-54224162 GAAGGCAATCACAAGGAGGCCGG + Intronic
991353783 5:65747255-65747277 GAGGAGAAATTCGGGGAGGCTGG + Intronic
991389666 5:66129058-66129080 TAAGGCAAGCTCAGGGAGGAGGG - Intergenic
991925141 5:71698129-71698151 GACGGCAAAATCAGGCAAGCTGG - Intergenic
994248486 5:97509185-97509207 GAGTACAATCTCAGGGAAGCAGG + Intergenic
998130956 5:139650804-139650826 GCGGGGAAACTCAGGCCGGCGGG + Intronic
999438300 5:151581443-151581465 GAGGGTTAGCTCAGGGAGGTAGG - Intergenic
999503627 5:152172052-152172074 GAGGGCAGTGTCAGGGAGTCAGG + Intergenic
999781490 5:154854267-154854289 GAGAGAAAACCCAGGAAGGCTGG - Intronic
1001147795 5:169200038-169200060 GAAGACAGACTCAGGTAGGCAGG - Intronic
1001568685 5:172716446-172716468 GAGCTCATGCTCAGGGAGGCTGG + Intergenic
1002091923 5:176810932-176810954 GAGGCCAAACTTTGCGAGGCGGG + Intronic
1003445216 6:6177861-6177883 GAGGGCAAGACCAGGGATGCAGG + Intronic
1004241706 6:13928883-13928905 GAGGGCAGGGTCAGGGAGTCTGG + Intronic
1004291548 6:14372144-14372166 GAGGGCAGAGGCAAGGAGGCTGG + Intergenic
1004431234 6:15545934-15545956 CAGGGCCAGCTCAGGCAGGCGGG + Intronic
1005102792 6:22191389-22191411 GAGGACAAGCTGAGTGAGGCAGG + Intergenic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1006271615 6:32970357-32970379 TAGGGCAAACCCCGGGAGGGCGG - Intronic
1007758430 6:44116436-44116458 GAGTAAAAACTCAGGGAGGTGGG - Intronic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1010672511 6:78702985-78703007 GGGGGGAAACTCAGGGAGATAGG - Intergenic
1013171095 6:107636722-107636744 GAGTGCAAACTCCAGGAGGAAGG + Intronic
1013207518 6:107958218-107958240 GAGGGAAAACTGAGCGGGGCGGG - Intergenic
1013812929 6:114065010-114065032 GAGAGCAAAAACAGGTAGGCTGG + Intronic
1014489230 6:122041940-122041962 GAGGTTAAACTCAGGGATCCAGG - Intergenic
1014695056 6:124609829-124609851 GAGAGCAAATTCAGGCAGTCTGG - Intronic
1017276967 6:152581130-152581152 GAGGGCATTCTCAGGGAAGCAGG - Intronic
1018345097 6:162891854-162891876 GAAGGTAAACTCAGGCAGCCTGG - Intronic
1019067970 6:169318437-169318459 GAGAGCAAACTCCTAGAGGCAGG + Intergenic
1019188493 6:170235936-170235958 CAGGGCCAGCTCAGGAAGGCTGG + Intergenic
1019633612 7:2063852-2063874 GAGGGCAGAGCGAGGGAGGCTGG - Intronic
1019697970 7:2458231-2458253 GAGTGCAGACTCAGGGTGGGTGG - Intergenic
1019763212 7:2829766-2829788 GAGGGCTACCACAGGGATGCTGG - Intronic
1020267086 7:6568165-6568187 GAGGGGAGACTCAAGAAGGCGGG + Intergenic
1022992372 7:35721093-35721115 GACTGCAGACTCAAGGAGGCAGG + Intergenic
1023312544 7:38902648-38902670 CAGCACAAACTCAGGCAGGCAGG - Intronic
1024043018 7:45569374-45569396 GAGGAAATACTCAGGGGGGCTGG + Intergenic
1024298087 7:47862375-47862397 GAGGGGAGACTCAGGCAGGAGGG + Intronic
1026518311 7:71092410-71092432 GAGGGCAAAGGCTGGGAGGAGGG + Intergenic
1027895660 7:84040578-84040600 GAGAGCCATGTCAGGGAGGCCGG + Intronic
1028687064 7:93602217-93602239 GGAGGCAAACACAGGTAGGCTGG - Intronic
1029372009 7:100156315-100156337 AAGGAAAAAGTCAGGGAGGCAGG - Intronic
1031623780 7:123968721-123968743 GAAGTCAAACTCAGGTAGTCTGG - Intronic
1031919411 7:127589804-127589826 GAGGGCTAAATCAGGCAGCCTGG - Intronic
1032341696 7:131079834-131079856 GACTGCAAACTGAGTGAGGCAGG - Intergenic
1033599495 7:142878409-142878431 GAGGGCAATCTCAGGGCACCTGG - Intronic
1033989413 7:147265431-147265453 GAGGGCCCACTCAGTGAGGAGGG - Intronic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1035275446 7:157745471-157745493 CAGGGCAGGCTCAGGGAGGCAGG + Intronic
1035760334 8:2064200-2064222 GGGGGCAAACCCTGGGAGGCAGG + Intronic
1037802479 8:22043168-22043190 GCTGTCAAACTCAGGTAGGCGGG + Exonic
1039100536 8:33937029-33937051 GATGGCATACTCATGGAGACAGG + Intergenic
1039228577 8:35418241-35418263 GTGAGCAAACCCAGGGAGGCAGG - Intronic
1039232439 8:35463434-35463456 AGGGGCAAACTCAGGTAGCCTGG - Intronic
1040816288 8:51511635-51511657 CAGGCCAGACTCAGGCAGGCAGG + Intronic
1044143061 8:88678259-88678281 GAGAGCAAAACCAGGGAGGAAGG - Intergenic
1045213365 8:100122151-100122173 GAGGGCAAAATTAGGGAAGCTGG - Intronic
1045361271 8:101435838-101435860 AAAGTCAAACTCAGGGAGACTGG - Intergenic
1048017799 8:130513097-130513119 GAGGGCAAAACCAGGGAGCAGGG + Intergenic
1049686216 8:143940292-143940314 GAGGGCTGACTCACGGAGGCCGG + Intronic
1049702253 8:144020624-144020646 GAGAGTATACTCAGGGAGGAGGG - Intronic
1050056811 9:1664144-1664166 GACAGCAAACTCAGGGAGAAAGG + Intergenic
1051335387 9:16061272-16061294 GATGGAAAACTGAGGCAGGCAGG - Intronic
1051370688 9:16356432-16356454 GAGGGAGAACTCAGGGAACCAGG + Intergenic
1052369330 9:27645988-27646010 GAGGTGTCACTCAGGGAGGCTGG - Intergenic
1054945585 9:70792607-70792629 GAGGGGAAACAAAGGGAGACAGG + Intronic
1055236699 9:74131297-74131319 GAGGGAGAACTCAAGGACGCTGG + Intergenic
1058270994 9:102971344-102971366 GAGGGCCAACCCAGGCAGGGAGG - Intergenic
1058483899 9:105424146-105424168 GAGGGCAAGAGCAGGGAGCCTGG - Intronic
1060069929 9:120537363-120537385 GAGGGCAAGGGCAGGGAGGAGGG - Intronic
1060988667 9:127835968-127835990 GTTGGGAAACTCAGGGGGGCTGG + Intronic
1061168917 9:128940781-128940803 GAGGGCAACCTCTTGGACGCTGG - Intronic
1061946549 9:133911624-133911646 GAGGCCTAAGTCAGGGTGGCAGG + Intronic
1062197902 9:135284837-135284859 AAGGGCATCCCCAGGGAGGCAGG - Intergenic
1189052927 X:37665336-37665358 AAGGGCAAAGACATGGAGGCAGG - Intronic
1192180231 X:68911814-68911836 AAGGGCAAACTCAGGCAGGTGGG - Intergenic
1192603860 X:72493139-72493161 GGAGGCAAAGTCAGGGAGGTGGG + Intronic
1197784375 X:130185996-130186018 CAGGGCAAAATCAGGGGGGCAGG + Intergenic
1198122487 X:133607809-133607831 GAGGGCAAAGTCAAAGAGGAAGG + Intronic