ID: 1097273693

View in Genome Browser
Species Human (GRCh38)
Location 12:57796224-57796246
Sequence GTGCCATCTGGGTTCTACGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097273693 Original CRISPR GTGCCATCTGGGTTCTACGT TGG Exonic
901379473 1:8863351-8863373 ATGCCATCTGGGTTGTTCCTTGG - Intronic
902630091 1:17699617-17699639 CTGGCATCTGGGATCTCCGTGGG + Intergenic
903010702 1:20328115-20328137 GTGTGATCTGGGTTCTCTGTGGG - Intronic
903579460 1:24359889-24359911 GTTACATCTGGGATCTACCTGGG - Intronic
907552893 1:55319296-55319318 GTGAAATTTGGGTTCTAAGTAGG + Intergenic
909061351 1:70882385-70882407 CTGCCATCTGGGTGCTTCCTGGG + Intronic
912873236 1:113328812-113328834 GTGCCAGCTGAGTTCTGCCTGGG + Intergenic
916299701 1:163259978-163260000 GTGCCCTCAGGGTTCTATTTTGG - Intronic
917654415 1:177112104-177112126 GTGCAATCTGGGTTCCAGGCTGG + Intronic
924690474 1:246345115-246345137 GTGCTTTCTGTGTTCTACATAGG + Intronic
1065124084 10:22556193-22556215 GTGCCCTCTGTGTTCCCCGTGGG - Intronic
1075255520 10:120923551-120923573 GTCCCATCTGGCTTCTTCATAGG + Intergenic
1075315926 10:121453581-121453603 GTGCCATCTTGTTTCTGCTTGGG - Intergenic
1077726224 11:4677535-4677557 TTGCCATGTTGGTTCCACGTTGG - Intergenic
1078418147 11:11182792-11182814 GTGCCCACTAGGTTCTATGTGGG - Intergenic
1078753755 11:14189403-14189425 CTGCCATCTGGGTACTACCAGGG + Intronic
1084424039 11:69074849-69074871 GGGCCATCTGGGCTCTCCCTGGG + Intronic
1086498237 11:87425841-87425863 GAGCCATCTGTGTTCTATGGAGG + Intergenic
1095983077 12:47983678-47983700 GGGCCATCTGGGTTCCAGGTAGG - Exonic
1097273693 12:57796224-57796246 GTGCCATCTGGGTTCTACGTTGG + Exonic
1098124345 12:67274547-67274569 GGGCCATGTGGGTTCTCAGTAGG + Intronic
1102406162 12:112676126-112676148 GTGCCCTCTGATCTCTACGTGGG + Intronic
1104503712 12:129310563-129310585 GTGCCTTCTGGCTTCCACCTGGG - Intronic
1105020919 12:132816403-132816425 GTGCCATCTGAGTCCCACGTGGG - Intronic
1109361003 13:61294483-61294505 GTGCCATCTGGCTTCTTCACAGG + Intergenic
1111605813 13:90538077-90538099 CTGCCATCTGGGTGCTTCCTGGG - Intergenic
1113796017 13:113058992-113059014 GTGCCATTTGGGTGCTGAGTGGG + Intronic
1118042808 14:61935700-61935722 GTCCCATGTGGGCTCTAAGTCGG + Intergenic
1120158574 14:81121156-81121178 TTGCCATATGGGTTCTCCGTGGG - Intronic
1123676554 15:22715011-22715033 CTGCCCTCTATGTTCTACGTGGG + Intergenic
1123807902 15:23894355-23894377 GTGCCAGGTGGGGTCCACGTGGG + Intergenic
1124328772 15:28789271-28789293 CTGCCCTCTATGTTCTACGTGGG + Intergenic
1125254240 15:37744934-37744956 CTGCCATCTGGGTGCTTCCTGGG - Intergenic
1126351179 15:47746362-47746384 GTGACATCTGGGTTCTGCACTGG + Intronic
1133895823 16:9928068-9928090 GTGCTAGCTGTGTTCTGCGTGGG - Intronic
1134024148 16:10941911-10941933 CTGCCCTCTATGTTCTACGTGGG - Exonic
1136016166 16:27402528-27402550 GTGGCAGCTGGGTTCAGCGTGGG - Exonic
1138117846 16:54374476-54374498 GTGTCATCTGGAAGCTACGTTGG + Intergenic
1143930989 17:10424493-10424515 ATTACATCTGTGTTCTACGTAGG - Intergenic
1149327200 17:55544217-55544239 GTGACAGCTGGGCTCTGCGTGGG + Intergenic
1156748442 18:40420861-40420883 GTGCCATCTGGGTTGAGGGTGGG + Intergenic
1157896591 18:51474820-51474842 GTGCCCTCTGGGTTTCATGTGGG + Intergenic
1161104556 19:2436911-2436933 GTGCCCTGTGGGTTCCACCTGGG + Intronic
1161550987 19:4911958-4911980 CTGCCATCTGGTGTCTAGGTTGG + Intronic
1164044849 19:21528244-21528266 GTTCCATCTGTGTTCTCCATTGG + Intronic
1166062493 19:40335309-40335331 TTGCCATCTGGGTCCCACATAGG + Intronic
930889770 2:56370693-56370715 ATGCCAGCTGGCTTCTAAGTTGG + Intronic
933204286 2:79487520-79487542 GTGCTATCTGGGTTCTCAGATGG - Intronic
939244879 2:139610324-139610346 GTGCAATCTGGGTTTTGGGTAGG + Intergenic
944508952 2:200445482-200445504 GTGACATCTGGTTTGTATGTGGG - Intronic
946763585 2:223019792-223019814 GTGCGTTCTGTCTTCTACGTTGG - Intergenic
947273856 2:228369781-228369803 GTGCCATCTGGTTTCTTCACAGG - Intergenic
1168919205 20:1516874-1516896 GTGCCATCTGGGTTCTTGGTGGG + Intergenic
1168989591 20:2082956-2082978 GTGGCATTTGGGTTCTGCTTAGG - Intergenic
1174705464 20:52651031-52651053 GTGCCATGTGAGTGCTATGTAGG + Intergenic
1175267556 20:57711637-57711659 GTGCCATCTGGGGTAGACGCTGG - Intergenic
1180229454 21:46418084-46418106 GTTTCATCTGGGGTCTATGTGGG + Intronic
951498974 3:23362590-23362612 CTGCCATCTGGGTCCTTCCTGGG - Intronic
960299491 3:115984813-115984835 GTGACATCAGGGTTCTATATAGG + Intronic
962384683 3:134923299-134923321 GTGCTATCTGGGTTACAGGTAGG + Intronic
978904613 4:113991126-113991148 GTGGCATCTGGCTTCTGCCTAGG + Intergenic
995690493 5:114820421-114820443 GTGCCTTCTGGGTTTTTCATTGG - Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1002517703 5:179771964-179771986 GTGCTACCTGGGGTCAACGTGGG + Intronic
1006893124 6:37446886-37446908 GTGCCATCCAGGTTCTAAATAGG + Intronic
1009331176 6:62422594-62422616 CTGCCACCTGAGTTGTACGTGGG + Intergenic
1019704445 7:2490771-2490793 GTGCCATCTGGGATCCCCCTGGG + Intergenic
1035382949 7:158451920-158451942 GTGCCATCTGGATTTTATTTTGG + Intronic
1037621640 8:20568423-20568445 TTGCCCTCTGGTTTCTACCTGGG + Intergenic
1038242526 8:25823130-25823152 GTGCCATCTCAGTCCTACCTGGG - Intergenic
1047570857 8:126097416-126097438 GTGCCATCTGGCTTCTTCACAGG - Intergenic
1049609764 8:143549302-143549324 GTGCCATCTGGGTTCACTGGTGG - Intergenic
1053344204 9:37365990-37366012 GTGAACTCTGGGTTCTTCGTGGG - Intergenic
1056795912 9:89658777-89658799 GTGCCATCTGTTTTCAACATGGG + Intergenic
1062703344 9:137919660-137919682 ATGACATCTGGGTTCTTTGTGGG + Intronic
1198957160 X:142145994-142146016 GTGACATCTGAGCTCTACCTGGG + Intergenic
1201360186 Y:13138450-13138472 ATCCCATCTGGGTTTTATGTTGG - Intergenic