ID: 1097274770

View in Genome Browser
Species Human (GRCh38)
Location 12:57805473-57805495
Sequence ACTTCTATGCAGATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097274770_1097274775 7 Left 1097274770 12:57805473-57805495 CCAGCCTCCATCTGCATAGAAGT 0: 1
1: 0
2: 0
3: 11
4: 203
Right 1097274775 12:57805503-57805525 ATTTCTGCTAGGTGTAAGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 162
1097274770_1097274773 -4 Left 1097274770 12:57805473-57805495 CCAGCCTCCATCTGCATAGAAGT 0: 1
1: 0
2: 0
3: 11
4: 203
Right 1097274773 12:57805492-57805514 AAGTTTATGAGATTTCTGCTAGG 0: 1
1: 0
2: 2
3: 19
4: 394
1097274770_1097274774 6 Left 1097274770 12:57805473-57805495 CCAGCCTCCATCTGCATAGAAGT 0: 1
1: 0
2: 0
3: 11
4: 203
Right 1097274774 12:57805502-57805524 GATTTCTGCTAGGTGTAAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097274770 Original CRISPR ACTTCTATGCAGATGGAGGC TGG (reversed) Intronic
900396626 1:2455690-2455712 CCTTTGCTGCAGATGGAGGCGGG + Intronic
900464923 1:2820917-2820939 ACATCCATGCAGCTGGACGCTGG - Intergenic
902724943 1:18329171-18329193 AATTCAAGCCAGATGGAGGCTGG - Intronic
904346550 1:29875791-29875813 GGTTCTATGATGATGGAGGCAGG - Intergenic
904453098 1:30629132-30629154 TCTTCCATTCAGATGGATGCCGG + Intergenic
906556897 1:46721240-46721262 GCTTCCATGCTGATGGAGCCAGG - Intergenic
910374037 1:86549837-86549859 ACATCCATGTAGATGGAGGCAGG + Intronic
911268297 1:95770152-95770174 ACTTCTCTACAGATGGAGAGTGG - Intergenic
911761015 1:101616751-101616773 ACTTCTATGTAAATAGAGGGAGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912635303 1:111286287-111286309 ACATGTATTCAGATGAAGGCTGG + Intergenic
912882438 1:113429665-113429687 ACTCCTATGCAAATGAAGACTGG + Intronic
915624676 1:157107335-157107357 ACTACTGGGCAGAGGGAGGCAGG - Intergenic
915837252 1:159187827-159187849 CCTTCTGTGCACATGGAGGATGG - Intronic
916882429 1:169032887-169032909 ATTTCTATGCAGATGCCAGCAGG - Intergenic
918290167 1:183099733-183099755 ACTAGTATGCAGATGGACACTGG - Intronic
918311849 1:183290755-183290777 ACCTCACTGCAGAGGGAGGCAGG - Intronic
919723466 1:200865720-200865742 ACTTCTATCAAGATTGAAGCAGG - Intergenic
921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG + Intergenic
1062942931 10:1438311-1438333 TCTCCTTAGCAGATGGAGGCAGG + Intronic
1062942950 10:1438403-1438425 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062942979 10:1438539-1438561 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062942989 10:1438585-1438607 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943021 10:1438721-1438743 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943041 10:1438812-1438834 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943072 10:1438948-1438970 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943103 10:1439084-1439106 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943123 10:1439175-1439197 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943139 10:1439266-1439288 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943183 10:1439448-1439470 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943203 10:1439539-1439561 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943224 10:1439630-1439652 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943233 10:1439676-1439698 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943242 10:1439722-1439744 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943262 10:1439813-1439835 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943311 10:1440041-1440063 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1062943319 10:1440087-1440109 TCTCCTCAGCAGATGGAGGCAGG + Intronic
1064540617 10:16401878-16401900 GCTTCTCAGGAGATGGAGGCAGG - Intergenic
1065392176 10:25194094-25194116 ACTTCTTTCAAGCTGGAGGCTGG + Intronic
1066810620 10:39329055-39329077 ATTTGGATGCACATGGAGGCTGG - Intergenic
1068494072 10:57762847-57762869 AGTTTCATGTAGATGGAGGCTGG + Intergenic
1069955252 10:72046493-72046515 AGTTGTAGTCAGATGGAGGCTGG + Intergenic
1070812730 10:79306411-79306433 ATTTCTGTGCTGATGGTGGCAGG + Intronic
1072208695 10:93226560-93226582 AATTCTAGGCAGACAGAGGCAGG - Intergenic
1074393694 10:113079320-113079342 ACATCAACGCAGATGCAGGCAGG - Intronic
1077969346 11:7171586-7171608 ACTACTAGGCAGATGGTGACTGG - Intergenic
1079501740 11:21108318-21108340 ACTCTTATGCAGATGGAACCTGG + Intronic
1080058972 11:27936925-27936947 ACTTCTATCCAAATGAAGGAAGG - Intergenic
1082180774 11:49116601-49116623 AGTTTTATCCAGATGAAGGCAGG + Intergenic
1082846056 11:57726399-57726421 TCTTTTATGGAGATGGAGTCTGG - Intronic
1083102732 11:60326769-60326791 AATTCTGTGCAGAAGAAGGCAGG - Intergenic
1085662198 11:78378735-78378757 ACTACTTGGGAGATGGAGGCAGG - Intronic
1091115978 11:133013936-133013958 ACTTTTAAGCAAATAGAGGCAGG - Intronic
1091672243 12:2460571-2460593 ACTTAAGTGCAGATGGAGACAGG - Intronic
1092359252 12:7822369-7822391 ACTTATATGAAGGTGTAGGCTGG + Intronic
1094215776 12:27940462-27940484 GCTACTCAGCAGATGGAGGCAGG - Intergenic
1095166877 12:38983442-38983464 ACTTCTATGCAAACGAAGACTGG + Intergenic
1097274770 12:57805473-57805495 ACTTCTATGCAGATGGAGGCTGG - Intronic
1098128533 12:67323876-67323898 ACTTGTATGCAGATGAAGAAGGG - Intergenic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1101523865 12:105509754-105509776 ACTTCTATCCAAAAGGAGGTTGG + Intergenic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102536057 12:113582493-113582515 TCTCCTCTGCAGATGGAGTCAGG + Intergenic
1102565595 12:113795370-113795392 ACTTCAATACAGAGGAAGGCAGG - Intergenic
1102594335 12:113981099-113981121 ACTTCTATGAAGGTGGGGCCAGG + Intergenic
1103242795 12:119428967-119428989 AATTCTAGGCGGCTGGAGGCTGG - Intronic
1103741508 12:123094646-123094668 GCATCTGTGCAGATGGAGGACGG - Intronic
1110041340 13:70763180-70763202 ACTTCTCTACAGATTGAGTCAGG - Intergenic
1112609019 13:100937797-100937819 GCTTATATGCTGTTGGAGGCAGG - Intergenic
1116130831 14:40854470-40854492 AGTCCTATGCAGAAGGGGGCAGG + Intergenic
1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG + Intergenic
1121613978 14:95300444-95300466 ACATCTTTGCTGTTGGAGGCAGG - Intronic
1121951436 14:98174175-98174197 ACTGCTATGCACATTGAGGTTGG + Intergenic
1123428060 15:20188755-20188777 GCTTCCAGGCAGATGAAGGCAGG + Intergenic
1123476810 15:20596709-20596731 ACACCCAGGCAGATGGAGGCAGG - Intergenic
1123641201 15:22403655-22403677 ACACCCAGGCAGATGGAGGCAGG + Intergenic
1123793980 15:23753347-23753369 ACTTCTGTGCTGCTGGAGGCTGG - Intergenic
1126057722 15:44747364-44747386 ACTTGTATGAGGATGGAGGCAGG - Intronic
1128870715 15:71153295-71153317 ACCTGTATGCACAAGGAGGCTGG - Intronic
1129155217 15:73713441-73713463 GATTCTATGCAGGTGGAAGCAGG - Exonic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134015327 16:10884158-10884180 GCTTCTCAGCAGTTGGAGGCAGG - Intronic
1134046471 16:11104608-11104630 ACTTCTCTCCAGAGGGAGGAAGG + Intronic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1136552158 16:30987570-30987592 GGTTCTTTGCAGATGCAGGCTGG + Intronic
1140236128 16:73160556-73160578 CCCTCTATGTAGATGGAGGGAGG - Intergenic
1203117834 16_KI270728v1_random:1509484-1509506 GCTTCCAGGCAGATGAAGGCAGG - Intergenic
1143353076 17:6303564-6303586 TCTTCTATGGATATGGAGGTGGG + Intergenic
1144779607 17:17801206-17801228 CCTCCTATCCAGATGGAGCCTGG + Intronic
1144847352 17:18226762-18226784 ACATCAGTGCAGAGGGAGGCGGG - Intronic
1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG + Intronic
1150006425 17:61472037-61472059 AATTCTATGCAGCTGCAGGCCGG - Intronic
1150462470 17:65364222-65364244 ACATCTCAGCTGATGGAGGCAGG - Intergenic
1152026195 17:77811031-77811053 ACATCTGGGCACATGGAGGCTGG - Intergenic
1154294748 18:13138261-13138283 ACTTCTATGCAAAGGAAGACTGG + Intergenic
1155136492 18:22999313-22999335 AGTTGTAGGCAGATGGTGGCTGG + Intronic
1155840268 18:30633964-30633986 AATTCTAGGCAGACAGAGGCAGG - Intergenic
1155988759 18:32257579-32257601 TCTCCTAGGCAGATGGAGGAAGG - Intronic
1156946970 18:42844832-42844854 AATTCTAGGCAGATAGGGGCAGG - Intronic
1158376178 18:56870781-56870803 ACTACTATCCAAATTGAGGCTGG - Intronic
1160442580 18:78903672-78903694 TCTTCTGAGCAGTTGGAGGCAGG + Intergenic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1161865604 19:6830000-6830022 ACTTCCATGTAGATGTAGTCTGG - Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162860761 19:13504819-13504841 ACATCTATCGAGATGTAGGCAGG - Intronic
1166198667 19:41222349-41222371 AATTCTATTCAGAGAGAGGCCGG - Intronic
1167440924 19:49508382-49508404 ACTCCTTTGGAGAGGGAGGCAGG + Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925282393 2:2693734-2693756 ACTTTTAGGCAGACTGAGGCTGG + Intergenic
926473074 2:13285423-13285445 ATGTCTAGGCAGATAGAGGCGGG - Intergenic
927703910 2:25285546-25285568 ACTCCTCAGCAGTTGGAGGCAGG + Intronic
927745338 2:25614740-25614762 TCCTCTAAGGAGATGGAGGCGGG + Intronic
930118920 2:47743950-47743972 ATGTCTAGGCAGATGGAGGTGGG + Intronic
931934928 2:67186443-67186465 TCTTCTATGCAGGTGCAGGGTGG + Intergenic
932388611 2:71362910-71362932 ACTTCTGTGCATATGCTGGCCGG + Intronic
932582145 2:72998996-72999018 ACTTGGATGCAGGTGAAGGCTGG + Exonic
932995981 2:76853412-76853434 ACTTCTACTTAGATGGTGGCAGG - Intronic
933424938 2:82098776-82098798 ATTGCCATGGAGATGGAGGCTGG + Intergenic
935094417 2:99930681-99930703 CCTGCTATGCAGATGGGGGGAGG + Intronic
938714799 2:134009692-134009714 ACTCCTATGCAAGAGGAGGCAGG - Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
942896517 2:181062142-181062164 ACTTCTGAGCAGTTGGAGTCAGG + Intronic
946540278 2:220676768-220676790 ACAGCTATGCAGAGGAAGGCTGG + Intergenic
946577873 2:221095944-221095966 ACTTCTGTGCCCATGGAAGCTGG - Intergenic
948180623 2:235977127-235977149 AGTTCTCTGCTGATGGACGCCGG - Intronic
948817478 2:240520034-240520056 ACTTATATTCAGGAGGAGGCGGG - Intronic
1168816995 20:744622-744644 ACTGCTCTGGAGCTGGAGGCAGG - Intergenic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1171306060 20:24107351-24107373 ATTTCAATGCAGAAGGAGACTGG - Intergenic
1171987369 20:31670046-31670068 ACTTCCCTGAAGTTGGAGGCTGG + Intronic
1173003545 20:39122952-39122974 TGTTCTTTCCAGATGGAGGCAGG + Intergenic
1173554055 20:43953052-43953074 ACGGCTATGAAGATGGAGGAAGG + Intronic
1173566377 20:44041274-44041296 ACTTTTCTGGAGATGGGGGCAGG + Intronic
1175206880 20:57317902-57317924 GCTTTTATGCTGAGGGAGGCGGG - Intergenic
1175653051 20:60745392-60745414 AATCCTAAGCAGATGGAGGAGGG - Intergenic
1175886234 20:62292415-62292437 GCGTCTGTGCACATGGAGGCTGG + Intronic
1178103477 21:29295217-29295239 ACGCCTAGGCAGATAGAGGCAGG + Intronic
1178683399 21:34692632-34692654 ACTTCTCTGCAGCTGGGAGCTGG - Intronic
1179035036 21:37752385-37752407 ATTTCTATACACATGGCGGCTGG + Intronic
1181795628 22:25307077-25307099 ATTTCTATAGAGATGGGGGCCGG - Intergenic
1185142151 22:49108528-49108550 ACCTGTGTGCAGATGGAGGGGGG + Intergenic
951082437 3:18467851-18467873 ACTTCTAGGCTGATGTGGGCTGG + Intergenic
951912762 3:27768651-27768673 AGTTCTAAGCAGTTGGAGGAGGG - Intergenic
955090327 3:55744088-55744110 ACTTCTATGCAAATGAAGACTGG - Intronic
956636110 3:71367161-71367183 ACTTCTGTGCAGAAGGAGGGAGG + Intronic
958591774 3:96168765-96168787 ATTCCTAGGCAGATAGAGGCAGG + Intergenic
959733290 3:109628647-109628669 ACCTCTATGCAGATGGCTGATGG - Intergenic
960324060 3:116273345-116273367 TTTTCTATTAAGATGGAGGCAGG - Intronic
960554150 3:119009003-119009025 GCTTCTGTGTATATGGAGGCTGG - Intronic
967137597 3:186525576-186525598 AGTGCTATGCAAATGGAGGGAGG - Intergenic
971104734 4:23512107-23512129 ACTTCTATGCCAATGAAGGCTGG - Intergenic
973200820 4:47500202-47500224 ATTTCTACGCTGATGGAGGAGGG + Intronic
974554948 4:63434307-63434329 ACTTGTATGCAGATGGAAGATGG + Intergenic
979946759 4:126842862-126842884 AATTCTAGGCAGATAGGGGCAGG + Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
987473517 5:18362032-18362054 GCTTCTATGCAGATGGTTGGTGG + Intergenic
987559717 5:19504345-19504367 ACTTATTTGGAGATGGAGGCAGG - Intronic
989207879 5:38829566-38829588 ACTTCTAGGCAGATAAAGGGAGG - Intergenic
990570223 5:57071036-57071058 GCTTTTAGGCAGATGGAGGAAGG + Intergenic
991913782 5:71586739-71586761 ACTTCTATGCAAACGAAGACTGG + Intergenic
992776493 5:80093722-80093744 GCGTGAATGCAGATGGAGGCTGG - Intergenic
992986327 5:82234209-82234231 ACTTTTAGGCAGATGGGGGAGGG + Intronic
993947450 5:94132675-94132697 AATTCTCTGCACATGGTGGCGGG - Intergenic
996109599 5:119549744-119549766 ACTTCTATGCAAACGAAGACTGG - Intronic
996361665 5:122654699-122654721 ACGGCTATGCAAATGGAAGCTGG + Intergenic
997228181 5:132225278-132225300 ACTATTATGCAGATGGAAGTTGG - Intronic
997363906 5:133313194-133313216 AGCTCTATGCAGCTGGAAGCTGG - Intronic
998850713 5:146348236-146348258 AATTCTATTCAGAAGGAGGTGGG - Intergenic
1001383211 5:171317427-171317449 AAGTCTAGGCAGATGGAGCCAGG - Intergenic
1001696363 5:173673338-173673360 ACTCCTATGCAACTGGAGGAAGG - Intergenic
1002348755 5:178567192-178567214 ACTTCTCTGCAGACAGAGGGAGG - Intronic
1002434692 5:179224017-179224039 ACTTCTGAGCAGGTGGAGACAGG + Intronic
1002484541 5:179525030-179525052 ACATGCAGGCAGATGGAGGCAGG + Intergenic
1005888905 6:30120240-30120262 ACTTCTATGCAGATTTCCGCGGG + Intergenic
1008544815 6:52575670-52575692 ACTTCCTTGGAGATGGAGGATGG - Intronic
1008736479 6:54550431-54550453 ACTTCTGGCCAGATGGTGGCAGG + Intergenic
1009023516 6:57970685-57970707 AATTCTATACAGAAGGAGGGTGG + Intergenic
1009199088 6:60722250-60722272 AATTCTATACAGAAGGAGGGTGG + Intergenic
1013770789 6:113625604-113625626 AGTTCTCTAGAGATGGAGGCAGG - Intergenic
1014571689 6:123016567-123016589 ACTTATTGGCAGATGGAGTCTGG - Intronic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1019131914 6:169883159-169883181 AAATCTTTGCAGATGGAGGAAGG + Intergenic
1019497770 7:1348360-1348382 ACTGCAATGCAGATAGAGGCTGG + Intergenic
1019834696 7:3371128-3371150 CCTTCAATGCATGTGGAGGCAGG - Intronic
1020509428 7:9034769-9034791 GCTTCTGTGAGGATGGAGGCAGG + Intergenic
1023136753 7:37060360-37060382 ACATGGATGCAGCTGGAGGCCGG + Intronic
1026812886 7:73483751-73483773 GCTACTTTGGAGATGGAGGCAGG - Intronic
1032619293 7:133511528-133511550 ACTTTTAGGCAGATGGGGGAGGG + Intronic
1036816883 8:11908959-11908981 ACTTCTATGAGTATGGGGGCTGG + Intergenic
1036820179 8:11933848-11933870 ACTTCTATGAATATGTGGGCTGG + Intergenic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1043481777 8:80660358-80660380 GCTACTTTGGAGATGGAGGCAGG + Intronic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1044006778 8:86947114-86947136 ACTTCTCTGCAGATAGACCCAGG - Intronic
1044528867 8:93285040-93285062 ACTTCTTTGCTGAAGGAAGCTGG - Intergenic
1050768417 9:9165413-9165435 CATTCTATGCAGATGAAGGTAGG + Intronic
1051020313 9:12534960-12534982 ACTTCTGTGCACCTGCAGGCTGG + Intergenic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1052738751 9:32373171-32373193 ATTGCTTTGCAGATGGAGGAAGG + Intergenic
1055392331 9:75836473-75836495 AAATCTATCCAGATGTAGGCTGG - Intergenic
1056232025 9:84556873-84556895 ACTTTTACTCAGATGGTGGCTGG + Intergenic
1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1186187417 X:7035132-7035154 ACTTCTATACAGAAGGTGGGTGG - Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1187675338 X:21710900-21710922 TCTTCTTTGCAGAAGGAGCCAGG + Intronic
1189945169 X:46170589-46170611 ACATCTATGTAGATGGTAGCAGG + Intergenic
1190291072 X:48992660-48992682 ACTTCTGTGGTGATGGATGCTGG - Intronic
1192139631 X:68636709-68636731 AGTGCTATGCAAATGGAGGGGGG - Intergenic
1193771265 X:85590710-85590732 ACTTCTGTGGGGATGGAGGTAGG + Intergenic
1195853274 X:109305862-109305884 AATTCTAGGCAGATAGCGGCAGG - Intergenic
1196940349 X:120769649-120769671 ACTGCTATGCTGAGGGAGCCCGG + Intergenic
1199928720 X:152496218-152496240 ATGTCTATGCCAATGGAGGCAGG - Intergenic
1201302818 Y:12524913-12524935 ACATTTTTGCAGATGGGGGCAGG - Intergenic