ID: 1097275801

View in Genome Browser
Species Human (GRCh38)
Location 12:57812852-57812874
Sequence TAATGATGTTAGGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097275801_1097275806 24 Left 1097275801 12:57812852-57812874 CCTGCAGCTTCCTAACATCATTA 0: 1
1: 0
2: 0
3: 16
4: 157
Right 1097275806 12:57812899-57812921 TCCATGTGCCCTTATGGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 100
1097275801_1097275805 18 Left 1097275801 12:57812852-57812874 CCTGCAGCTTCCTAACATCATTA 0: 1
1: 0
2: 0
3: 16
4: 157
Right 1097275805 12:57812893-57812915 GTCTGGTCCATGTGCCCTTATGG 0: 1
1: 0
2: 0
3: 8
4: 88
1097275801_1097275804 1 Left 1097275801 12:57812852-57812874 CCTGCAGCTTCCTAACATCATTA 0: 1
1: 0
2: 0
3: 16
4: 157
Right 1097275804 12:57812876-57812898 TGAGGCTGCTATGAACAGTCTGG 0: 1
1: 0
2: 3
3: 32
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097275801 Original CRISPR TAATGATGTTAGGAAGCTGC AGG (reversed) Intronic
902847964 1:19127185-19127207 TAATGAGCTTAGGGAGCTGTGGG - Intronic
904705049 1:32383788-32383810 TACAGATGTTAGGCATCTGCAGG + Intronic
913662823 1:121019889-121019911 GAAGGATGTTGGGAAGCTGTGGG + Intergenic
914420757 1:147526653-147526675 TAATGAGTTGAGGAAGCTGTGGG + Intergenic
916871783 1:168922467-168922489 TAATGATGTTTGCACACTGCAGG + Intergenic
916901914 1:169234742-169234764 AACTGAATTTAGGAAGCTGCAGG + Intronic
919653534 1:200174912-200174934 TCATGATGTTAAGAAAATGCAGG + Exonic
920710265 1:208288096-208288118 TGATTATGCTAGGAGGCTGCAGG + Intergenic
924729878 1:246701401-246701423 TGATGATGTTAGGGAGCAACTGG + Intergenic
1063193893 10:3722028-3722050 TAATGATGGAAGTAGGCTGCAGG - Intergenic
1064381786 10:14849343-14849365 TAATGATGTTAAGAACTTGGGGG + Intronic
1064454252 10:15472219-15472241 TATTGATTTTAGGCAGCAGCAGG - Intergenic
1076654114 10:132010672-132010694 TAATGATATTAGGAAACTTAAGG + Intergenic
1077457739 11:2691084-2691106 TACTGTTGTCAGGAATCTGCAGG - Intronic
1077891317 11:6419867-6419889 TAAAGATGTAAGGAAGATGGTGG + Intergenic
1079574695 11:21988974-21988996 AAGTGATGTAGGGAAGCTGCAGG - Intergenic
1080207483 11:29747395-29747417 TAATTAGGTTAGGAAGATGGAGG - Intergenic
1080952182 11:37047324-37047346 TAATTATGTTAGCATGCTGTTGG - Intergenic
1086514852 11:87599970-87599992 TCATGATGTTAAGAAAGTGCAGG + Intergenic
1086734219 11:90285670-90285692 GAGAGATGTGAGGAAGCTGCAGG - Intergenic
1087208584 11:95422390-95422412 TAATGATGGTACGTGGCTGCTGG - Intergenic
1087489561 11:98807068-98807090 TAGTGATGTTAGAAAGATACAGG + Intergenic
1087489970 11:98812819-98812841 TAATTATTTTAAGATGCTGCAGG - Intergenic
1088694562 11:112355751-112355773 TGATTATGTCAGGAAGTTGCAGG + Intergenic
1088830724 11:113534100-113534122 TAAAGATGTTAGGAATTTACCGG + Intergenic
1093782707 12:23155345-23155367 GAATGATGTTAGGGTTCTGCTGG - Intergenic
1094214241 12:27923489-27923511 TAATGCTGCTAGGGAGCAGCAGG - Intergenic
1095047192 12:37520484-37520506 CTATGATGATAGGAAGCTGCAGG - Intergenic
1096428000 12:51520649-51520671 TGAGGATGCCAGGAAGCTGCAGG + Intergenic
1096762967 12:53858741-53858763 TAATAATGTTAGGAATATGTAGG - Intergenic
1097275801 12:57812852-57812874 TAATGATGTTAGGAAGCTGCAGG - Intronic
1097959700 12:65520499-65520521 TATTGCTGTTGGGAAGCTGGTGG - Intergenic
1098017895 12:66125740-66125762 CAATGATGATTGGAAGCTGGAGG - Intronic
1099305752 12:80953634-80953656 TAATGATGTTACCAAGTTGCAGG - Intronic
1099569823 12:84303022-84303044 AAATTATGGTAGGAATCTGCAGG - Intergenic
1099869677 12:88331127-88331149 TAAGGAGGCTAGGAAGCTGATGG + Intergenic
1101031929 12:100669043-100669065 TAGTGATGCCAGGAATCTGCAGG - Intergenic
1103661426 12:122522187-122522209 TAATGATGTTTTGAAGCTCTAGG + Exonic
1104500243 12:129278359-129278381 TCATGCTGTTATGTAGCTGCTGG + Intronic
1105201079 13:18179065-18179087 TAAAAATATAAGGAAGCTGCAGG + Intergenic
1105271629 13:18881620-18881642 TAATGAAGTAAGGCAGGTGCAGG + Intergenic
1106286023 13:28318533-28318555 TACTGCTGGTAGGAAGCAGCTGG + Intronic
1108010310 13:46000496-46000518 GAAAGAGGTAAGGAAGCTGCAGG - Intronic
1110558966 13:76889473-76889495 GAATGATGATAGTAGGCTGCAGG - Intergenic
1113548849 13:111176212-111176234 TAATGATGGCCAGAAGCTGCTGG + Intronic
1113602153 13:111577582-111577604 AAATGATCTCTGGAAGCTGCTGG + Intergenic
1113850716 13:113416075-113416097 CAATGATGCTCAGAAGCTGCTGG - Intergenic
1114884414 14:26830641-26830663 TCATGATGTTGGGAGGCTGATGG - Intergenic
1116647600 14:47549149-47549171 TACTGCTTTCAGGAAGCTGCTGG + Intronic
1119905230 14:78295930-78295952 TAAAGATGTTTGGCAGCTGCAGG - Intronic
1120750068 14:88188949-88188971 TAAAGAAGTGAGGAAGCTCCTGG + Intronic
1121302773 14:92885238-92885260 TAGAGATGTTAGGAAGGGGCTGG - Intergenic
1127149317 15:56057258-56057280 AAATGGTGTCAGGAAGCTGCTGG - Intergenic
1128182226 15:65613992-65614014 TAATGATGAGAGGAAGGGGCTGG - Intronic
1128506019 15:68273423-68273445 TGGTGAAGTTAGGATGCTGCAGG + Intergenic
1128791359 15:70436724-70436746 TGGTGATGTAAGGTAGCTGCTGG - Intergenic
1129330525 15:74824736-74824758 CCATGATGTCAGGAAGCTGAGGG + Intronic
1129515209 15:76153089-76153111 TCAGGTGGTTAGGAAGCTGCAGG - Intronic
1129529400 15:76251113-76251135 TAATGAGGAAAAGAAGCTGCTGG + Intronic
1129918889 15:79301448-79301470 TAATGATATTTGGAAGATGATGG + Intergenic
1137368734 16:47884661-47884683 TAATTGTGTTTGGATGCTGCAGG - Intergenic
1139183085 16:64770578-64770600 TCATGCTGCTAGGCAGCTGCAGG - Intergenic
1139235525 16:65334428-65334450 GAATGGTGTTTGTAAGCTGCTGG + Intergenic
1139251183 16:65498102-65498124 AAATGAAGCTAGGAAGGTGCTGG + Intergenic
1145375847 17:22347491-22347513 CTATGACGATAGGAAGCTGCAGG + Intergenic
1145410486 17:22656993-22657015 CTATGATGATAGGAAGCTGCAGG - Intergenic
1146496737 17:33329396-33329418 TAATGAGGATAGCAACCTGCAGG + Intronic
1148044794 17:44736784-44736806 TAAGGATGTGAGGAAGCCACGGG - Intronic
1150991800 17:70268444-70268466 TAAGGGTGTTAAGAACCTGCAGG - Intergenic
1151055731 17:71029274-71029296 AAATTATTTTAGGAAGCTGGAGG + Intergenic
1151055736 17:71029344-71029366 AAATTATTTTAGGAAGCTGCAGG + Intergenic
1153578285 18:6544989-6545011 TAAAGATGTTAGAAATATGCAGG + Intronic
1155314862 18:24561607-24561629 TAATGATGGCAGGCAGCTGCTGG - Intergenic
1159090817 18:63846654-63846676 TAAAGATGTTAGGAAGCCTAAGG - Intergenic
1163442224 19:17328037-17328059 CATTGATGTTGGGATGCTGCAGG - Intronic
1163502431 19:17684558-17684580 TTACGATGTTGGGAAGCAGCGGG + Intronic
1164669303 19:30063651-30063673 TAATGATGTCTGGGGGCTGCTGG + Intergenic
1165682077 19:37786100-37786122 CTGTGATGATAGGAAGCTGCAGG - Intronic
1165772729 19:38388311-38388333 TAAGGAGGTTTGGATGCTGCAGG - Intergenic
1167115070 19:47484268-47484290 TGATGACGTACGGAAGCTGCCGG + Exonic
1168213846 19:54911001-54911023 AAATGATGTTTGGAAGATGACGG + Intronic
926991451 2:18685070-18685092 AAATAATGGTAGGAATCTGCTGG + Intergenic
931195650 2:60050106-60050128 TAAGGATTTTAAGAAGCTGGGGG - Intergenic
935845975 2:107166025-107166047 TTATCATCTTATGAAGCTGCAGG - Intergenic
939674540 2:145055700-145055722 TAATAATGTTAGGAAGGCCCTGG - Intergenic
941574318 2:167211782-167211804 TTATGATTATAGGAAACTGCAGG + Intronic
943355657 2:186851893-186851915 TAATGGTGTTAGAGAGTTGCAGG + Intergenic
943963010 2:194291285-194291307 TAATGATGTGAGTAAGCAGTAGG + Intergenic
944895004 2:204155173-204155195 TAATAAACTTAGGAAGCTCCTGG + Intergenic
946572184 2:221036292-221036314 TACTGGTGTGAGGAAGCTGATGG - Intergenic
947248171 2:228073210-228073232 TGATGATGTAAGGAGGGTGCTGG + Intronic
1169650566 20:7862176-7862198 GAATGATGATGGGAAGCTTCAGG + Intergenic
1170262456 20:14425343-14425365 TAATTATGTAAGAAAGCTGGAGG - Intronic
1171541752 20:25963946-25963968 CTATGATGATAGGAAGCTGCAGG - Intergenic
1171799306 20:29596367-29596389 CTATGATGATAGGAAGCTGCAGG + Intergenic
1173158734 20:40636871-40636893 TGATGATGTGAGTAACCTGCTGG - Intergenic
1174885334 20:54327980-54328002 TACTGATGTTAGAAGGATGCTGG + Intergenic
1177452705 21:21292132-21292154 TATTGATGTTGAGAATCTGCAGG - Exonic
1178279626 21:31270274-31270296 TGATGATGTTAGTGAGGTGCTGG - Intronic
1179330681 21:40398077-40398099 TAAGGATGTTTGGATTCTGCTGG + Intronic
1183332279 22:37228085-37228107 TGATGATGTTGGGAAGTTCCTGG - Intronic
1184497493 22:44850495-44850517 TAATGAAGTTGGGAGGCTTCTGG - Intronic
950751858 3:15135441-15135463 TTGGGATGTTAGGATGCTGCAGG + Intergenic
950778649 3:15372559-15372581 CAATGATTGTAGGAAGCTTCTGG + Intergenic
953092543 3:39743789-39743811 TAATGAGGTCAGGAGGCTGTAGG - Intergenic
953690552 3:45114385-45114407 TAATGAAATTAGAAATCTGCTGG - Intronic
955957539 3:64305711-64305733 GAATGGTGTTAGGGACCTGCCGG - Intronic
956677496 3:71749857-71749879 TACTGTTTCTAGGAAGCTGCAGG - Intronic
957377692 3:79380047-79380069 TAATTATGTGAGGAATCTACAGG - Intronic
960717604 3:120592976-120592998 AATTGATGTTAGTAAACTGCTGG + Intergenic
960815480 3:121667543-121667565 GAATGAATTAAGGAAGCTGCTGG - Exonic
968391783 4:198726-198748 AAAAGATGTTAGAATGCTGCTGG + Intergenic
971240357 4:24883014-24883036 TAAGGAAGTTAGGAGGCTGGGGG - Intronic
971481258 4:27116939-27116961 TAATGAGGTTAGGGAGATGCCGG + Intergenic
972395348 4:38654581-38654603 TAATGGTGTTTGGGGGCTGCAGG + Intergenic
975240754 4:72055901-72055923 AAAAGAGGTGAGGAAGCTGCAGG + Intronic
975596458 4:76051274-76051296 CAATGACTTTAGGGAGCTGCCGG + Intronic
976066376 4:81192527-81192549 TAATGAAGCAAGGAAGGTGCTGG - Intronic
976118281 4:81751704-81751726 GAATAAATTTAGGAAGCTGCAGG - Intronic
978635228 4:110796668-110796690 GACTGATGCTAGGGAGCTGCTGG + Intergenic
978813428 4:112876446-112876468 TAAAGAGGGTAGGAAACTGCGGG + Intronic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
979546082 4:121941558-121941580 TAATGAGGGTGGGAAGCAGCAGG + Intronic
979636362 4:122958852-122958874 TAAGGGAGTTAGGAAGCTGGAGG + Intronic
980550891 4:134333571-134333593 TTATAATCTAAGGAAGCTGCAGG - Intergenic
980779171 4:137474975-137474997 TGATCCTGCTAGGAAGCTGCAGG + Intergenic
981286240 4:143022412-143022434 TAATTATGTTAGGAAGTTAATGG - Intergenic
982582764 4:157200172-157200194 TTATGATGTTATAAAACTGCTGG + Intergenic
984238534 4:177191406-177191428 TAACCATGTAAGGAAGATGCTGG + Intergenic
987333502 5:16877573-16877595 CATGGATGTTGGGAAGCTGCAGG + Intronic
989540892 5:42617456-42617478 AAATGATGTAAGGAAGATCCAGG - Intronic
991502501 5:67290932-67290954 TAATGATGTGAGGAAGCAGAGGG - Intergenic
992464564 5:76991043-76991065 TAATGATGTCAATAACCTGCAGG - Intergenic
996063884 5:119060747-119060769 TAATGATTTTAGGAAGTGCCTGG - Intronic
1001399170 5:171436639-171436661 TGATGCTTTTAGGAAGCTGCTGG + Intronic
1001798036 5:174518606-174518628 TAAACAAGCTAGGAAGCTGCTGG - Intergenic
1002561317 5:180084155-180084177 TAATGATTTTAGATAGCTTCAGG + Intergenic
1007611091 6:43149471-43149493 TAATGAGCTTAGGAATCAGCTGG - Intronic
1009673184 6:66783262-66783284 TAATGAAGTTGTGAAGCTGCTGG - Intergenic
1010525565 6:76896068-76896090 TAATAATGTCAGGAAGCACCAGG + Intergenic
1010915646 6:81614610-81614632 GAATGATGTTAGGGATCTCCAGG + Intronic
1012272738 6:97235008-97235030 TAAATATGTTGGGAAGCTACTGG + Intronic
1013315833 6:108942004-108942026 TAATGATTTTAGGAAGTGGTTGG - Intronic
1013451861 6:110289797-110289819 TAGTGATGCTGGGAAGCTCCAGG - Intronic
1014554661 6:122831140-122831162 TAATGATGTGGAGATGCTGCAGG + Intergenic
1023002604 7:35826614-35826636 TAATGATATTGGGAAGTTGAAGG + Intronic
1025293205 7:57750269-57750291 CTATGATGATAGGAAGCTGCAGG - Intergenic
1028781631 7:94744069-94744091 TAATGGTGTGGGGAAGCTGCAGG - Intergenic
1034684220 7:152955818-152955840 TAAGGATGTTTTCAAGCTGCAGG - Intergenic
1034983936 7:155496172-155496194 TAAGAGTGTTAGGAAGCTCCAGG - Intronic
1035342721 7:158174464-158174486 TGATGATGGTGGGAAGCTGATGG - Intronic
1038573969 8:28687887-28687909 TAACGAATTTAGGAAGTTGCTGG + Intronic
1039113516 8:34066454-34066476 TAATGATATTAGAAAGATGTGGG - Intergenic
1039787571 8:40847392-40847414 ACATGATGTCAGGAAGTTGCTGG + Intronic
1044017963 8:87069682-87069704 TAAAAATGTTAGGAATCTACTGG + Intronic
1046351302 8:113016568-113016590 TAATATTTTTAGGAATCTGCAGG - Intronic
1047178617 8:122566288-122566310 TAGACTTGTTAGGAAGCTGCAGG + Intergenic
1047494383 8:125399130-125399152 AAAGTATGTAAGGAAGCTGCAGG - Intergenic
1048793087 8:138122406-138122428 TAGGGATCTAAGGAAGCTGCAGG + Intergenic
1051084898 9:13337358-13337380 GAAAGAGGTAAGGAAGCTGCAGG - Intergenic
1052177300 9:25478218-25478240 TAATGATGTTGTTGAGCTGCTGG - Intergenic
1052472311 9:28915437-28915459 TAAGGAGATAAGGAAGCTGCTGG + Intergenic
1053148727 9:35729725-35729747 TGCTGATGATAGGAAGCTGTGGG - Intronic
1055566704 9:77576630-77576652 TAATGATGTAAGGAATGTGGAGG - Intronic
1203583278 Un_KI270746v1:34868-34890 TAAAAATATAAGGAAGCTGCAGG - Intergenic
1185526431 X:783927-783949 TAATGCTGTTAGGAAGTTTGTGG + Intergenic
1187115734 X:16348365-16348387 TAATGATTTAATGAAGCTGATGG + Intergenic
1187583008 X:20629706-20629728 AAATGATGTTAAGGAACTGCAGG - Intergenic
1189671494 X:43414987-43415009 AAATGATGTTATGAGGCTGAGGG + Intergenic
1193659588 X:84240713-84240735 TAATGATATTGGGAAGAAGCAGG + Intergenic
1194661947 X:96637628-96637650 TAATGGTGGCAGGAAGATGCAGG - Intergenic
1195475715 X:105282754-105282776 TAATGATGTTTTGAAGCTACTGG + Intronic
1196238821 X:113316410-113316432 GAATGATGTCAGGAAGATGGCGG + Intergenic
1197905062 X:131415805-131415827 TAATGATGTTTGGAGGTTGGTGG - Intergenic