ID: 1097277134

View in Genome Browser
Species Human (GRCh38)
Location 12:57821327-57821349
Sequence ACACTCCCACCAAGCCATCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 3, 1: 0, 2: 1, 3: 13, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097277131_1097277134 13 Left 1097277131 12:57821291-57821313 CCTAAAAAGCAGGGGCTTCATGC 0: 1
1: 2
2: 0
3: 4
4: 265
Right 1097277134 12:57821327-57821349 ACACTCCCACCAAGCCATCCTGG 0: 3
1: 0
2: 1
3: 13
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097277134 Original CRISPR ACACTCCCACCAAGCCATCC TGG Exonic
904587430 1:31588049-31588071 TCAGTCTCTCCAAGCCATCCAGG + Intergenic
908543998 1:65147467-65147489 CCACTCCCACCCAGCCTGCCTGG - Intergenic
911760295 1:101606347-101606369 AGACACCCACCCTGCCATCCTGG + Intergenic
922354137 1:224760305-224760327 ACAAGTCCACCAAGCCATCCAGG - Intergenic
924358255 1:243207511-243207533 GAACACCCACCAAGCCAACCTGG + Intronic
1063035781 10:2285466-2285488 ACACTCACACCAATGCCTCCTGG - Intergenic
1063379430 10:5575115-5575137 TCACTCCCACAAGGCCATCCTGG + Intergenic
1063702038 10:8394223-8394245 ACACCCCCACCCTGCCTTCCTGG - Intergenic
1067281187 10:44874430-44874452 ACACTCCCATCCAGCTATCCTGG - Intergenic
1067781651 10:49211957-49211979 CCACTCCCTCCATTCCATCCTGG - Intergenic
1072188411 10:93062528-93062550 ACAGTCCCTCCCAACCATCCAGG - Intronic
1074154872 10:110789304-110789326 CCACTGCCACCAAGCCCTTCTGG + Intronic
1074430629 10:113391137-113391159 AAAATTCCACCAACCCATCCAGG + Intergenic
1076595526 10:131622768-131622790 ACACACCCACCTTGCCATCAAGG - Intergenic
1078386768 11:10899368-10899390 ACACTCCCACCACGCCCAGCTGG - Intergenic
1079083965 11:17432307-17432329 GCGCTGCCTCCAAGCCATCCTGG - Intronic
1079391272 11:20024048-20024070 ACTCTACCACCATGCCTTCCTGG + Intronic
1082249080 11:49960178-49960200 ACAATTCCAGCATGCCATCCAGG + Intergenic
1083008100 11:59367814-59367836 CCACCCCCACCAAGCTCTCCAGG + Intergenic
1083692006 11:64415081-64415103 ACACTCCCTCCAGGGCCTCCAGG - Intergenic
1084266154 11:68006284-68006306 GCACCTCCACCAACCCATCCAGG + Intergenic
1085204238 11:74721070-74721092 ACATTCCCAGCAAGCCAGCAAGG + Intronic
1089975766 11:122730233-122730255 CCACAGCCACCAAGCCATCTCGG - Intronic
1089983491 11:122791715-122791737 CAACTCCCACCATGCCAGCCAGG - Intronic
1090204002 11:124875041-124875063 ACAGGCCCTCCAGGCCATCCAGG - Intronic
1090502116 11:127271229-127271251 ACATTCCCCCCAAGCCATCTGGG - Intergenic
1093675091 12:21928912-21928934 GCGCTCCTACCAAGCCATCGAGG - Intronic
1097277134 12:57821327-57821349 ACACTCCCACCAAGCCATCCTGG + Exonic
1098690260 12:73479124-73479146 CCTCTCCCACCAAGCCATCAAGG + Intergenic
1100391693 12:94149877-94149899 ACACTCCCGCCCAGACGTCCAGG - Exonic
1103865966 12:124052412-124052434 ACACTCACACCAAGTCATCAGGG + Intronic
1104036743 12:125102818-125102840 ACACACACACCCAGCCATGCCGG - Intronic
1110229681 13:73154972-73154994 AGACTCCAACCCAGGCATCCTGG - Intergenic
1110426211 13:75370200-75370222 TCACTCCCATCCAGCCATGCTGG - Intronic
1112404925 13:99110835-99110857 TCACTCCCATTCAGCCATCCAGG + Intergenic
1112566024 13:100551990-100552012 ACACTCCCTCCAGACCATGCTGG + Intronic
1116872797 14:50083965-50083987 ACCCTCCCACCAGAACATCCAGG + Exonic
1120124825 14:80729040-80729062 ACACCCCCACCAGCCCAGCCTGG - Intronic
1122319317 14:100844200-100844222 ACACCCCCACAAAGCCACCCAGG - Intergenic
1122764401 14:104055400-104055422 ATTCTCACACCAAGGCATCCAGG - Intergenic
1124458958 15:29871390-29871412 TCACTCCCACCATGCCCTCGTGG + Intronic
1125201522 15:37104476-37104498 GCACTCCCACCCAGGCTTCCAGG + Intergenic
1127255001 15:57282528-57282550 ACACTGCCAGGAACCCATCCTGG + Exonic
1127836548 15:62795260-62795282 ACACTCCCACCTCTCCACCCTGG - Intronic
1129166718 15:73782683-73782705 ACACCTCCACCCAGCCATCTGGG + Intergenic
1130008573 15:80127732-80127754 ACACTCCCACCAAGGCAGGAGGG - Intronic
1130149043 15:81297366-81297388 ACACACCCACCCAGCCATCCTGG + Intronic
1132106532 15:99066798-99066820 CCATTCCCACCAAGCCACTCAGG - Intergenic
1133345277 16:5065713-5065735 GGACCCCCACCATGCCATCCAGG + Exonic
1134303237 16:13009829-13009851 CCACTCCCACCAGGCCATGACGG - Intronic
1139319413 16:66101433-66101455 ACATTCCCAGCATGCCCTCCTGG + Intergenic
1139638331 16:68272974-68272996 ACTCTGGCACCAAGCCATGCAGG - Intronic
1140900682 16:79364433-79364455 ACACTGCCACCCACCCAGCCTGG - Intergenic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141555433 16:84833948-84833970 GCACCCCCACCAACCCATGCAGG - Intronic
1203138498 16_KI270728v1_random:1745565-1745587 CCAAGCCAACCAAGCCATCCAGG + Intergenic
1142597601 17:1037109-1037131 ACCCACCCACCCATCCATCCAGG + Intronic
1142736676 17:1905245-1905267 AAACCCACACCAAGCCTTCCTGG + Intergenic
1145255385 17:21319443-21319465 ACACCCCCACCAAGGCCTGCTGG + Intergenic
1147464865 17:40603234-40603256 ACACTCTCACCCAGCCAGCATGG - Intergenic
1149488999 17:57068458-57068480 GCACTCCCTCCAGGCCTTCCGGG - Intergenic
1151386709 17:73759495-73759517 CCACTTCCACCAACCCCTCCGGG - Intergenic
1151607397 17:75147170-75147192 ATACTGCCACCAAGCCCCCCAGG - Intronic
1157508793 18:48252747-48252769 CCCCTCCCACCAAGCCAACCTGG + Intronic
1160200438 18:76791517-76791539 ACACCCCCACCCCGCCTTCCAGG + Intergenic
1160218777 18:76957279-76957301 ACACTCCAAAAAAGCCATCCTGG - Intronic
1160987386 19:1845328-1845350 ACCATCCCTCCAAGCCACCCTGG + Intronic
1161823628 19:6546803-6546825 ACACTCCCCCTTGGCCATCCCGG - Intergenic
1162107999 19:8382464-8382486 ACACTGCTAACAAGCCATACTGG - Intronic
1163108350 19:15141218-15141240 ACACAGCCACCAAGCGGTCCTGG + Intergenic
1163765614 19:19161716-19161738 AGACTCCCCCCAATCCATGCTGG + Intronic
1164147491 19:22520934-22520956 TCACTACCACCCAGCCAACCCGG + Intronic
1164768759 19:30791945-30791967 ACACTTCCAACAAGGCACCCAGG - Intergenic
1166366578 19:42281131-42281153 ACACACCCACCCACCCACCCCGG - Intronic
1167613199 19:50517255-50517277 GCTCTCCCACCAAGCGTTCCGGG - Exonic
1167640124 19:50676844-50676866 ACACTCCCACTTGGGCATCCCGG - Intronic
1168710764 19:58498756-58498778 ACCCACCCACCAGGCCACCCTGG + Intronic
925198759 2:1949373-1949395 CCACCCCCTCCAAGCCAGCCTGG + Intronic
925308674 2:2866662-2866684 ACACTCTCAACAAGGCTTCCGGG - Intergenic
925636200 2:5943129-5943151 ACACACCCACCTCTCCATCCAGG + Intergenic
926645619 2:15287560-15287582 ACAGTCCCACACAGGCATCCCGG + Intronic
927878249 2:26673217-26673239 ACACTCCCATCTATTCATCCTGG + Intergenic
929914600 2:46123975-46123997 ACAATTTCACCAAGCCATCCTGG + Intronic
929994423 2:46816534-46816556 ACAATCCCACCAAGCCTGCAAGG + Intergenic
930403956 2:50930129-50930151 ACACTCCCACCCAGCCTGCTTGG + Intronic
932402047 2:71487442-71487464 ACACTGCCCCCCTGCCATCCTGG - Intronic
932433842 2:71691645-71691667 ACGCTCCCATCACCCCATCCTGG - Intergenic
932616074 2:73232546-73232568 ACACCCCCAGAAAGCCTTCCTGG + Intronic
935832828 2:107018533-107018555 AAACTTCCACCAACCCATGCAGG - Intergenic
944128648 2:196321429-196321451 ACACTCCAACCTAGGCAACCCGG - Intronic
946344810 2:219100721-219100743 AGAATCCCACCAAGCCAGACAGG + Intronic
1170828731 20:19820903-19820925 ATACTCCCACCAAGCTACCAAGG + Intergenic
1172250543 20:33476148-33476170 AGACTGCCACAAAGCCAGCCTGG + Intergenic
1175275933 20:57770870-57770892 ACACCCCCACGAAGCATTCCAGG - Intergenic
1175278267 20:57786565-57786587 ACAAACCCAGTAAGCCATCCTGG - Intergenic
1178942060 21:36914640-36914662 ACACCTCCACCAAGCCAAACAGG + Intronic
1181728803 22:24830038-24830060 ACACTCCTCCGAACCCATCCCGG - Intronic
1183676534 22:39301909-39301931 CCACGCCCACCCACCCATCCAGG + Intergenic
949188294 3:1219893-1219915 AACCTCCCACCTAGCCCTCCTGG - Intronic
950126537 3:10513363-10513385 ACACTTTCCCCCAGCCATCCGGG - Intronic
954632148 3:52053386-52053408 ACACTCCAAGCAAGCCCTACAGG + Intronic
962841355 3:139235535-139235557 CCACCCCCACCATGCCACCCAGG - Intronic
964881333 3:161426361-161426383 ACAGTCTCACCCAGCCACCCAGG - Intergenic
968963806 4:3759286-3759308 ACACTCCCACAGTGCCCTCCAGG + Intergenic
969629218 4:8325798-8325820 ACACCCCTACCAAGGCTTCCTGG + Intergenic
979243564 4:118472007-118472029 GAACACCCACCAAGCCAACCTGG - Intergenic
979439259 4:120731812-120731834 ACACTTCCACAAAGTCATCCAGG - Intronic
980554712 4:134388138-134388160 ACATACACACCAAGGCATCCTGG + Intergenic
982788018 4:159558740-159558762 AGACTGCCACCCAGCCACCCTGG - Intergenic
985123589 4:186668321-186668343 AGACTCTCACTCAGCCATCCTGG - Intronic
985677186 5:1238207-1238229 CCCCTCCCGCCACGCCATCCTGG - Intronic
985947957 5:3201297-3201319 ACGCTCCCTCCAAGGCCTCCAGG + Intergenic
986899622 5:12415721-12415743 TCCCTCCCAAAAAGCCATCCCGG - Intergenic
990454420 5:55971190-55971212 CCACTCCCATCCAGACATCCAGG + Intronic
990460533 5:56027333-56027355 ACGCTCCTACCAAGCCATATTGG - Intergenic
990729750 5:58795462-58795484 ACACTCCAGCCTACCCATCCTGG + Intronic
992455267 5:76910503-76910525 ACACTGATAACAAGCCATCCCGG - Intronic
994239762 5:97406918-97406940 AGACCCACACCAAGCCACCCTGG + Intergenic
998457309 5:142283313-142283335 AAACTCATACCAAGCCAGCCCGG + Intergenic
999308793 5:150538185-150538207 TCACTCCCCTCCAGCCATCCCGG - Intronic
1000849581 5:166323441-166323463 ACAATCTCACCCAGTCATCCCGG + Intergenic
1005650180 6:27878801-27878823 ACACTCCCACCAAGCCATCCTGG + Intergenic
1006483878 6:34321705-34321727 ACACTCTCACCAAGGCGCCCAGG + Intronic
1008340964 6:50363549-50363571 AGAATCCCACCATGCCATCTGGG + Intergenic
1008631448 6:53366167-53366189 AGACTTCCACCTAGACATCCAGG + Intergenic
1013056155 6:106584831-106584853 ACTCACCCAGTAAGCCATCCTGG - Intronic
1019924478 7:4183026-4183048 CCACGCCCACCAAACTATCCTGG - Intronic
1020272828 7:6607305-6607327 GCGCTCCCACCAAGGCCTCCGGG - Intronic
1023383717 7:39634051-39634073 ACCCTACCACCCAGCCCTCCTGG - Intronic
1023394769 7:39742635-39742657 TCACACCCACCAACCCTTCCTGG - Intergenic
1026387745 7:69867246-69867268 AAACTCCCACCAAGTCCTCAAGG - Intronic
1026849358 7:73715461-73715483 GCACTCCCTCCCAGCCTTCCTGG - Intronic
1027691485 7:81352288-81352310 ACAGTCTCACCATGTCATCCAGG - Intergenic
1028610853 7:92710065-92710087 ACACCCCCACCAAGGCAGCAGGG - Intronic
1030461209 7:109839205-109839227 ACACTCCCACCAAGCCATCCTGG - Intergenic
1031886075 7:127247260-127247282 ACACACCCACCAACGCATGCAGG + Intronic
1033127118 7:138716147-138716169 ACATTCCTACCCAGCCTTCCTGG - Intronic
1035034850 7:155888036-155888058 CCACTCCCACCAATGCACCCAGG - Intergenic
1036064657 8:5366168-5366190 AAACTCCCTCCCAGGCATCCAGG + Intergenic
1036961579 8:13249958-13249980 AGAGGCCCCCCAAGCCATCCTGG - Intronic
1038586748 8:28796559-28796581 ACTCTCCCACCATTCCATCTGGG + Exonic
1039983739 8:42430063-42430085 TCACTCCCATCACGCCGTCCAGG - Exonic
1040409817 8:47143034-47143056 ACCCTCCAACCAAGCAATCCTGG + Intergenic
1042271452 8:66961134-66961156 AGACTCTTACCAAGCCACCCCGG + Intronic
1042823537 8:72957377-72957399 GCACCCCCACCAATCCCTCCAGG - Intergenic
1044839984 8:96329240-96329262 CCATTCACATCAAGCCATCCTGG - Intronic
1044844961 8:96371619-96371641 ACACTCCCATCTGCCCATCCAGG + Intergenic
1045319382 8:101070193-101070215 CCACTCCCACACACCCATCCAGG - Intergenic
1046291129 8:112163053-112163075 ACTCTCCCACCAAACCATGGTGG + Intergenic
1047495679 8:125407022-125407044 CCACTTCCACCCACCCATCCAGG - Intergenic
1050528355 9:6565257-6565279 ACACTCCCTCCAAGCCTTCTTGG - Intronic
1054810612 9:69431040-69431062 ACACACCCAGAAAGCCCTCCAGG + Exonic
1056776702 9:89518311-89518333 AGACTGCCTCCATGCCATCCGGG + Intergenic
1058539118 9:105993471-105993493 ACACTTCCTCCAGGCCACCCAGG - Intergenic
1060836952 9:126763270-126763292 AGACGCCCGCCAAGCCATGCTGG - Intergenic
1061233212 9:129326939-129326961 CCACTCCCACCCAGCCCTGCTGG - Intergenic
1061399773 9:130362022-130362044 ACACTGCCACCCAGCCTGCCAGG + Intronic
1061792163 9:133064542-133064564 CCACTCCCACCTTGCCAGCCAGG - Exonic
1062423238 9:136494063-136494085 AAGGTCCCACCCAGCCATCCTGG - Intergenic
1189277706 X:39798830-39798852 AGACAACCACCAAGCCACCCTGG - Intergenic
1190219206 X:48500187-48500209 ACTCTCACACCAAGCTATCAAGG - Intergenic
1200076059 X:153551814-153551836 CCACTCCCACTCAGCCTTCCCGG + Intronic
1200568721 Y:4801796-4801818 CCCCTCCCACCAAGTCCTCCAGG + Intergenic