ID: 1097277721

View in Genome Browser
Species Human (GRCh38)
Location 12:57824501-57824523
Sequence ATCCATTGGAAGCCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097277721_1097277727 6 Left 1097277721 12:57824501-57824523 CCCTCACCAGGCTTCCAATGGAT 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1097277727 12:57824530-57824552 TCCCAACCTCAACCTGGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 203
1097277721_1097277726 0 Left 1097277721 12:57824501-57824523 CCCTCACCAGGCTTCCAATGGAT 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1097277726 12:57824524-57824546 CAGTGGTCCCAACCTCAACCTGG 0: 1
1: 0
2: 0
3: 16
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097277721 Original CRISPR ATCCATTGGAAGCCTGGTGA GGG (reversed) Intronic
900536425 1:3179912-3179934 ATCCGGTGGCAGCCTGGGGAAGG - Intronic
902059431 1:13629702-13629724 ATCAGTTGGCAGCCTGCTGAGGG - Intergenic
902458539 1:16553935-16553957 ATCCAGTGGTAGCCTGTTGGAGG - Intergenic
902493619 1:16853981-16854003 ATCCAGTGGTAGCCTGTTGGAGG + Intronic
909829741 1:80173109-80173131 TTCATTTGGAAGCATGGTGACGG + Intergenic
911402407 1:97392866-97392888 ATTGATTGCAAGCCTTGTGAGGG - Intronic
914973332 1:152331938-152331960 AGGAATTGGAAGCTTGGTGAGGG - Intergenic
917677524 1:177333907-177333929 CCCCATAGGAAGCCTCGTGAAGG - Intergenic
918960493 1:191270412-191270434 AAACATTGGAAGAATGGTGAGGG + Intergenic
920836925 1:209519766-209519788 ATCCTTTGGAATCTTGGTGGAGG - Intergenic
921573922 1:216811823-216811845 TTCCATTTTAAGCCTAGTGATGG + Intronic
1063631406 10:7737080-7737102 ATCCATTGGAATACTGGTGTAGG - Intronic
1068682598 10:59836354-59836376 AACCCTGGGAAGCCTGGTGCAGG + Intronic
1071697097 10:87887945-87887967 ATCCTTTGAAATCCTGGTGGTGG - Intronic
1072025893 10:91456112-91456134 AGCCATTGGTAGCCTGATGGGGG + Intronic
1075975510 10:126690677-126690699 ATTCAGTGGAAGGCTGGTCAAGG - Intergenic
1076142413 10:128090389-128090411 ATCCATTGCAAGCCTGGTTAGGG + Intergenic
1076977855 11:189154-189176 ATTCAGTGGAAGGCTGATGAAGG + Intronic
1082691265 11:56307848-56307870 ATGCATTGGAAGGGTAGTGATGG + Intergenic
1083331911 11:61902660-61902682 TTCCTTTGGAAGCCGGGTGGGGG - Intronic
1083518256 11:63281391-63281413 ATCCATTGGTAGCCTGATGGGGG + Intronic
1093786142 12:23193956-23193978 ATCCATTGGAACTCTGGCCAAGG + Intergenic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1099939539 12:89169282-89169304 TTCAATTGCAATCCTGGTGATGG + Intergenic
1100380475 12:94057157-94057179 ATAGAATGGAAGGCTGGTGAGGG - Intergenic
1100993152 12:100272053-100272075 TTCTATTGAAAGCCAGGTGATGG + Intronic
1104723442 12:131060097-131060119 GTCCCTTGGAGTCCTGGTGAGGG + Intronic
1108741630 13:53344709-53344731 CTCCATGGGCAGCCTGGTAAAGG - Intergenic
1110264881 13:73526024-73526046 ATGGATTGGAAGCATGGGGAGGG + Intergenic
1113450077 13:110402815-110402837 ATCCCTTGGAAGCTGGGTGGAGG + Intronic
1114783166 14:25562927-25562949 ATCCATTTGAAGTTAGGTGAGGG - Intergenic
1115766637 14:36629659-36629681 TACCATTGGAGGCTTGGTGAAGG - Intergenic
1119158304 14:72431741-72431763 ATCCCTTGGGGGCCTGGTGATGG - Intronic
1122125335 14:99575710-99575732 GGCCAGTGGAAGCCTGGAGAGGG - Intronic
1123427208 15:20182644-20182666 AGCAACTTGAAGCCTGGTGAGGG - Intergenic
1123536440 15:21189169-21189191 AGCAACTTGAAGCCTGGTGAGGG - Intergenic
1125512830 15:40302099-40302121 AGCCCCTGGAAGCCTGGGGAGGG + Intronic
1127007324 15:54585015-54585037 AACCAATGGTAGTCTGGTGATGG - Intronic
1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG + Intronic
1129386197 15:75197414-75197436 AGCCATTGGAGGCTTGGTGCTGG - Intronic
1131154331 15:90065460-90065482 AGTCCTTGGAAGCCTGGAGAGGG + Intronic
1132774487 16:1584977-1584999 AGCCACTGGAAACGTGGTGAAGG + Intronic
1134798626 16:17064684-17064706 ATCGAGTGGAACCCTGGTGAAGG + Intergenic
1134840795 16:17400041-17400063 ATAAATGAGAAGCCTGGTGAGGG - Intronic
1136857088 16:33667193-33667215 AGCAACTTGAAGCCTGGTGAGGG + Intergenic
1142442477 16:90108179-90108201 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
1142465276 17:133619-133641 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1144316084 17:14062904-14062926 TTCCATTGGAGGCTTTGTGAAGG - Intergenic
1149321162 17:55482430-55482452 AGCCTGTGGAAGCCTGGAGAAGG - Intergenic
1152288242 17:79424609-79424631 AGCCCTTGGAAGCCTGGTGGGGG - Intronic
1156908856 18:42387074-42387096 ATCCTTAGGAAGCATGGTGCTGG - Intergenic
1159497655 18:69226467-69226489 AGCCACTGGAAGATTGGTGATGG + Intergenic
1159881729 18:73864763-73864785 ATCCATTAGAAGGCTGCTGTAGG - Intergenic
1160817205 19:1041695-1041717 ATGTATTGGCGGCCTGGTGAAGG - Intronic
1163701112 19:18787099-18787121 ATCCAAGGGAAGGCTAGTGAGGG + Intronic
1164908784 19:31988865-31988887 ATCCATGGGAGGCCAGGTGGAGG + Intergenic
1165982184 19:39734241-39734263 ATCCCATGGAAGCCGGGTGCGGG + Intronic
1167238061 19:48326820-48326842 CTGCAGTGGAAGCCTGGGGAGGG - Exonic
924964734 2:65317-65339 ACCCACTGCAAGCCTGGTAAAGG + Intergenic
925955028 2:8955018-8955040 CTCCATTGCAAGCCTGGGGCAGG - Intronic
929550033 2:42884342-42884364 ATCCATAGTTACCCTGGTGAAGG - Intergenic
932332511 2:70905747-70905769 ATCCTTTGGAAGCCCGGACAAGG + Intronic
932498815 2:72162115-72162137 ATTTTTTGGAAGCTTGGTGAAGG - Intergenic
936901024 2:117481998-117482020 ATACATTGAAAGCCAGATGATGG - Intergenic
938899920 2:135791219-135791241 GTCCATTGGAAGCCTGGAGCTGG - Intronic
940071876 2:149697875-149697897 ATCCATTGGCTGTCAGGTGATGG + Intergenic
941377570 2:164750692-164750714 ATGCATTGGAAGGCCAGTGAAGG - Intronic
944091480 2:195916769-195916791 AGTCATTTGAAGCCTGGAGACGG + Intronic
946998268 2:225421155-225421177 AGCGTTTGGAAGCCTGGGGAGGG - Intronic
1169178727 20:3543028-3543050 AACCAGTGAAAGCCTGATGATGG + Intronic
1175693703 20:61085168-61085190 AGCCATGGGAAGCCAGGAGATGG - Intergenic
1175752123 20:61505956-61505978 GTCCATTCGAAGTCTGGTGATGG + Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1179416388 21:41201952-41201974 AACCACTGGAGGCCTGGTGTTGG + Intronic
1181269672 22:21651878-21651900 AGCGCTTGGAAGCCCGGTGAGGG - Intergenic
1181539382 22:23565384-23565406 CTCCATAGGAGGCCTGGGGAGGG + Intergenic
1182149965 22:28020987-28021009 CTGCCTTGGAAGCCAGGTGAGGG - Intronic
1182596283 22:31423441-31423463 CTGAATTGGAAGCCTTGTGATGG + Intronic
1184588993 22:45468467-45468489 ATTCAGTGGAAGACTGGTCAAGG + Intergenic
952974345 3:38681415-38681437 ATCTATAGCAAGCCTGGAGATGG + Intergenic
960372870 3:116862578-116862600 TTCCATTGGCAGCCAGGGGAAGG - Intronic
961340570 3:126214244-126214266 AGGCATTGGAAGCCTGGGAAGGG - Intergenic
963833562 3:150034055-150034077 ACCCAGTAGAAGCTTGGTGAAGG + Intronic
966030298 3:175338275-175338297 ATCCATTTTAAGCATTGTGATGG + Intronic
968362750 3:198159139-198159161 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
970400361 4:15711633-15711655 ATCCACAAGGAGCCTGGTGAGGG - Intronic
977689330 4:99887783-99887805 TTACATTGGAAGCCATGTGAAGG - Intronic
982026507 4:151257668-151257690 ATGCTTTGGGAGCCTGGGGAGGG + Intronic
983730684 4:170990221-170990243 ATCTATTGGCAGCCTGATGGGGG + Intergenic
984186169 4:176546273-176546295 AACCAGTGGCATCCTGGTGAGGG - Intergenic
989392429 5:40915210-40915232 ATCCAGTTGGAGTCTGGTGATGG - Intronic
996738121 5:126776067-126776089 ATCCATGAAAAGCCTGGTGCTGG + Intergenic
999745330 5:154587535-154587557 CACCATTGGAGGCCTGGTGTTGG + Intergenic
1000046744 5:157528140-157528162 TTCCATTTGAACCCTGGAGAAGG - Intronic
1010622159 6:78090026-78090048 ATTCAGTGGAAGGCTGGTCAAGG + Intergenic
1017989424 6:159473203-159473225 ATCCATGAAAAGCCTGGAGATGG - Intergenic
1018255463 6:161913949-161913971 GCCGATTGGAAACCTGGTGAGGG - Intronic
1019252933 7:29572-29594 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1022886013 7:34644616-34644638 GTCCATTGGAGCCCTGGTTAGGG - Intergenic
1023768328 7:43532420-43532442 ATCCATTGGAAGTTTCGTGTAGG - Intronic
1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG + Intergenic
1035171077 7:157017845-157017867 TTCCATTGAAAGGCTGGAGAAGG + Intergenic
1035380739 7:158439037-158439059 ATTCACTGGAAGGCTGGTCAAGG + Intronic
1045314021 8:101027756-101027778 CTCCCTTGGAAGCATGGTGTGGG + Intergenic
1046523687 8:115357941-115357963 CTAGATTGGAAGCTTGGTGAGGG - Intergenic
1049210653 8:141385039-141385061 CTCCATGGGGAGCCTGGTGGGGG - Intergenic
1050108529 9:2190976-2190998 AGCCATTGGGAGACAGGTGAAGG + Intronic
1057878308 9:98774267-98774289 ATCCAGAAGAAGCCTGGTGTTGG - Intronic
1059845773 9:118274935-118274957 ATACCTTGGAAGCCTCCTGAAGG - Intergenic
1061616641 9:131784764-131784786 ATCCAAGGGAAAGCTGGTGAGGG + Intergenic
1062747437 9:138222802-138222824 ATTCAGTGGAAGGCTGATGAAGG - Intergenic
1186923180 X:14304035-14304057 AAACATTGGAAGCCTGGAGGAGG - Intergenic
1187733927 X:22285007-22285029 TTCCATTTGGAGCCTGGTGAGGG - Intergenic
1189170464 X:38904500-38904522 CCCCCTTGGAAGTCTGGTGAAGG + Intergenic
1190654231 X:52597146-52597168 AGGCACTGGGAGCCTGGTGAGGG - Intergenic
1191232403 X:58106375-58106397 ATCATTAGGAAGCCTGGTGTAGG - Intergenic
1193085651 X:77446487-77446509 GGCCATTGGAAGCCTGGTGGGGG - Intergenic
1193213813 X:78839357-78839379 ATTCAGTGGAAGGCTGATGAAGG + Intergenic
1195899343 X:109781194-109781216 AACCAATGGAATCCTGGAGAGGG + Intergenic