ID: 1097277727

View in Genome Browser
Species Human (GRCh38)
Location 12:57824530-57824552
Sequence TCCCAACCTCAACCTGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 203}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097277725_1097277727 -8 Left 1097277725 12:57824515-57824537 CCAATGGATCAGTGGTCCCAACC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1097277727 12:57824530-57824552 TCCCAACCTCAACCTGGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 203
1097277720_1097277727 7 Left 1097277720 12:57824500-57824522 CCCCTCACCAGGCTTCCAATGGA 0: 1
1: 0
2: 2
3: 27
4: 140
Right 1097277727 12:57824530-57824552 TCCCAACCTCAACCTGGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 203
1097277717_1097277727 24 Left 1097277717 12:57824483-57824505 CCGGAGAACTGGCTGTACCCCTC 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1097277727 12:57824530-57824552 TCCCAACCTCAACCTGGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 203
1097277721_1097277727 6 Left 1097277721 12:57824501-57824523 CCCTCACCAGGCTTCCAATGGAT 0: 1
1: 0
2: 1
3: 9
4: 108
Right 1097277727 12:57824530-57824552 TCCCAACCTCAACCTGGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 203
1097277716_1097277727 25 Left 1097277716 12:57824482-57824504 CCCGGAGAACTGGCTGTACCCCT 0: 1
1: 0
2: 0
3: 19
4: 128
Right 1097277727 12:57824530-57824552 TCCCAACCTCAACCTGGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 203
1097277722_1097277727 5 Left 1097277722 12:57824502-57824524 CCTCACCAGGCTTCCAATGGATC 0: 1
1: 0
2: 1
3: 14
4: 139
Right 1097277727 12:57824530-57824552 TCCCAACCTCAACCTGGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 203
1097277723_1097277727 0 Left 1097277723 12:57824507-57824529 CCAGGCTTCCAATGGATCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1097277727 12:57824530-57824552 TCCCAACCTCAACCTGGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097277727 Original CRISPR TCCCAACCTCAACCTGGCTC AGG Intronic
900542273 1:3209094-3209116 TGCCAACCTAAACCTGGGGCAGG + Intronic
900813281 1:4824554-4824576 TCCAAATTTCAACCTGACTCTGG - Intergenic
901459301 1:9382202-9382224 CCCCATCCTCACCCTGGCCCTGG - Intergenic
902269582 1:15293889-15293911 TCCCAAGTTCAACATGGCACTGG - Intronic
902614838 1:17618221-17618243 TCCCAACCCCAGGCTGGCTAGGG + Intronic
903044987 1:20557796-20557818 TCTCAACCTCAACCTCACACAGG + Intergenic
904025604 1:27501506-27501528 TCCAAACCTCAAACAGGCCCTGG - Intergenic
904534803 1:31192206-31192228 TCCCATTCTCAGCATGGCTCTGG + Intronic
906576916 1:46899414-46899436 TCCCTACCTCATCTTTGCTCTGG + Intergenic
906690875 1:47791971-47791993 TGCCCACCTCATCCTGGCTGTGG - Intronic
908169820 1:61493474-61493496 TCCCAAACCCAACCTCTCTCTGG - Intergenic
914679326 1:149927907-149927929 TCCGAAACTTAACCTGGGTCGGG + Exonic
915619776 1:157074067-157074089 TCTCAGCCTCAGCCTGGCTGCGG - Intergenic
915925972 1:160020043-160020065 ACCCACCCTCAACCTTGATCGGG + Intergenic
919920982 1:202166273-202166295 TCCCAACCCCCACCTGGCTTTGG - Intergenic
920711077 1:208295607-208295629 TCTCTACCTCCACCTTGCTCTGG + Intergenic
921219889 1:212965913-212965935 TCCCACCTCCAACCTGGCCCTGG - Intronic
922714184 1:227858172-227858194 TCCCCACCCCAGCCTGGCCCAGG - Intergenic
924829229 1:247574881-247574903 TCCCAATTCCAACCTGACTCTGG + Exonic
1070087111 10:73248017-73248039 CCCCAGCCTCAACCTTGCTTTGG - Exonic
1070640249 10:78163263-78163285 CCTCAGCCTCAAGCTGGCTCTGG + Intergenic
1071438613 10:85669543-85669565 CCACACCCTCACCCTGGCTCCGG + Intronic
1071656899 10:87458842-87458864 TCCCAACTTCAACCCTGCTTGGG + Intergenic
1071856440 10:89630053-89630075 TCTCACCCTCACCCTGGCTTAGG - Intronic
1073176388 10:101560025-101560047 TCCCAGGCCCACCCTGGCTCTGG + Intergenic
1073478078 10:103767431-103767453 TCCCTACCCCAGCCTTGCTCGGG - Intronic
1073511204 10:104043642-104043664 TGCCCACCACAACCTGGCTTGGG - Intronic
1073623691 10:105074723-105074745 TTCCAACCTCAGTCTGGGTCTGG + Intronic
1074489273 10:113924427-113924449 TCCCATCCTGAAGCTGTCTCGGG - Intergenic
1076995707 11:296579-296601 TGCCCACATCACCCTGGCTCTGG - Intergenic
1077302286 11:1852996-1853018 TCCAAACCTCAACCTGCAGCCGG + Intronic
1077572492 11:3352308-3352330 CCCCAACCCCGACCTGGTTCTGG - Intronic
1077610997 11:3642924-3642946 ACCCCACCTCCTCCTGGCTCTGG - Intergenic
1079078410 11:17397491-17397513 CCCCAACCTCCACCTGTCTGGGG + Intronic
1081611534 11:44565944-44565966 TCCGTCCCTCTACCTGGCTCTGG + Intronic
1083185966 11:61018083-61018105 TCCTGACCTCAGCCTGACTCAGG - Intronic
1084448050 11:69215523-69215545 TTCCAGCTCCAACCTGGCTCAGG + Intergenic
1086200341 11:84194694-84194716 TCCAAGTCTCAACCTGACTCAGG + Intronic
1088401424 11:109424752-109424774 TCCCACCCTCAGCCGGGCTCAGG + Exonic
1089599264 11:119603468-119603490 TCTCAGCCTCAGCCTGGCTGTGG + Intergenic
1089770235 11:120797231-120797253 TCCCAGCCTCACTGTGGCTCGGG + Intronic
1089809524 11:121120442-121120464 TCCCCACATCACCCTGGGTCGGG - Intronic
1089905115 11:122030516-122030538 TCCAAACATCCAGCTGGCTCTGG - Intergenic
1090383766 11:126344714-126344736 TGCCCACCTCCACCTTGCTCAGG - Intronic
1092429233 12:8396313-8396335 TCCCAACTTCAACCCGGGGCAGG + Intergenic
1094219072 12:27974291-27974313 TTCCAAGCCCCACCTGGCTCAGG + Intergenic
1095953073 12:47791864-47791886 TCCTCACCTCACACTGGCTCCGG + Exonic
1097277727 12:57824530-57824552 TCCCAACCTCAACCTGGCTCAGG + Intronic
1100822837 12:98447672-98447694 TCCCAACCTCTCCCAGCCTCTGG + Intergenic
1101020088 12:100545231-100545253 TCCCCACCTCAGCCAGGCTGGGG - Intronic
1104669859 12:130673259-130673281 TGCCAACCTCATCCTGGATCTGG + Intronic
1105603694 13:21909738-21909760 TCCTACCCTCTCCCTGGCTCTGG - Intergenic
1106462200 13:29980977-29980999 CCCCAACCCCAATCTGGCTTTGG - Intergenic
1106813294 13:33380804-33380826 TCCCCACCTGAACCTGGCACGGG - Intergenic
1112144100 13:96678977-96678999 CCCCAACCTCACCCTGGGTGTGG + Intronic
1113867854 13:113539868-113539890 TCCCAGCCTCCACCTTGCCCAGG + Intronic
1114452139 14:22834337-22834359 TCCCTTCCTCACCCTGTCTCTGG + Exonic
1115140100 14:30160846-30160868 TCCCACACTCAACCTTACTCAGG + Intronic
1117314881 14:54565210-54565232 TCGCAACCTTCACCTGGATCTGG - Intergenic
1118628905 14:67685198-67685220 TGCCACCCCCAACCAGGCTCTGG - Exonic
1119113432 14:71996520-71996542 TCCCAACCTCAGGCTGAGTCAGG - Intronic
1122049105 14:99043068-99043090 GCCCAACAGCAACCTGGCTGTGG + Intergenic
1124103491 15:26716900-26716922 ACCCAACCACAGCCTAGCTCTGG + Intronic
1125841062 15:42801576-42801598 TCTCAGCCTCAGCCTGGCTGCGG + Intronic
1127960701 15:63888306-63888328 GCCCAGCCTCAGCCTGGCCCTGG + Intergenic
1128504203 15:68255087-68255109 TCCCCACATCAACCTAGCTTCGG - Intronic
1129027317 15:72589417-72589439 TCCCAATCTCATCCTGCCTTTGG - Exonic
1129453008 15:75661204-75661226 TGCCCACCGCATCCTGGCTCCGG - Exonic
1129669197 15:77597768-77597790 TCCCCACCCCAGCCTGGCTTAGG - Intergenic
1131114528 15:89785698-89785720 TCCCAGGCAAAACCTGGCTCAGG + Intronic
1131470632 15:92693695-92693717 TCCCACCCTCAGCCTCTCTCTGG - Intronic
1132038509 15:98505655-98505677 TCCCAACCACCACCTGCCCCCGG + Intronic
1132152486 15:99472707-99472729 TTCCCTCCACAACCTGGCTCAGG + Intergenic
1133765067 16:8832238-8832260 TCACAAACACAACCTGCCTCAGG - Intronic
1134007545 16:10828218-10828240 TCCAAGCCTCTTCCTGGCTCAGG + Intergenic
1134809937 16:17158719-17158741 TCCCACCCTCAACCTTTCTGTGG + Intronic
1137057270 16:35751732-35751754 TCCCAACCGCTCCCTGACTCTGG + Intergenic
1138650600 16:58458830-58458852 TCCCGGCCTCAGCCTGGCTCTGG - Intergenic
1139210672 16:65073669-65073691 TCCCAAACTAGACCTAGCTCTGG + Intronic
1140661628 16:77194957-77194979 TCCCATCTTCAACCAGGCGCCGG - Exonic
1141113799 16:81291518-81291540 TCCCCATCACTACCTGGCTCAGG - Intergenic
1143016039 17:3891858-3891880 TCACAACCTCCCCCTGGCTTTGG - Intronic
1143542773 17:7579536-7579558 TCCCACCCACAGCCTGACTCAGG - Exonic
1143679355 17:8464916-8464938 TCCCATCCTCAACCTGCTTGAGG + Intronic
1144958254 17:19030490-19030512 TCCCAAGCTCAGCTTGACTCTGG - Intronic
1144976904 17:19144034-19144056 TCCCAAGCTCAGCTTGACTCTGG + Intronic
1145123045 17:20277948-20277970 TCCCCACCCCATCCTGGGTCAGG + Intronic
1146686957 17:34847578-34847600 TACCAACCCCAAGCTGGGTCTGG + Intergenic
1147554654 17:41469159-41469181 TCTCAGCATCAACCTGACTCAGG + Intergenic
1148200657 17:45748026-45748048 TCCCACCCACAGCCTGGCTGAGG - Intergenic
1149999763 17:61426359-61426381 GCCCAACCTCAACCTGCTTTTGG - Intergenic
1150526293 17:65926366-65926388 TCCCACCCTCCACCTGGCAAAGG + Intronic
1150642993 17:66962265-66962287 TCACCACCTCATGCTGGCTCCGG - Intergenic
1152279903 17:79379118-79379140 TCCCAGCCCCATCCTGGCACAGG + Intronic
1154410765 18:14141034-14141056 TCCCAACTTCAGCCTGACACTGG + Intergenic
1155145596 18:23080883-23080905 CCCCCACCTCAACCTGCCTTTGG + Intergenic
1157063590 18:44321399-44321421 TCTCAGCCTCAGCCTGGCTGCGG + Intergenic
1157584336 18:48791527-48791549 ACCCAGCCTCAGCCTGGCCCTGG + Intronic
1157589558 18:48828249-48828271 AACCAATCTCAACATGGCTCAGG + Intronic
1158939453 18:62393494-62393516 TCCCAACATCTGCCTGTCTCTGG - Intergenic
1160094722 18:75860963-75860985 CCCCCACCTCAGCCAGGCTCAGG - Intergenic
1160358171 18:78246336-78246358 TCCCAGCCTCCAGCTGGCTCAGG - Intergenic
1160702940 19:517369-517391 TCCCAGCCTCCACCCAGCTCAGG - Intronic
1160983148 19:1826001-1826023 CCCCAACCTCAAACTGCCCCCGG + Intronic
1162584804 19:11552182-11552204 TTCCATCCTCAGCATGGCTCCGG + Intronic
1162592651 19:11602784-11602806 TCAGAACCTTCACCTGGCTCTGG + Intronic
1163866365 19:19776577-19776599 TCCCAGCCTGTACCAGGCTCGGG - Intergenic
1165176805 19:33936364-33936386 TCCCCACCTCCAGGTGGCTCTGG - Intergenic
1165317144 19:35063307-35063329 TGCCAACCCCAACATGGCCCTGG - Intronic
1166783057 19:45352268-45352290 TGCCAACCTCAACCTGACCGTGG - Exonic
1168416663 19:56173548-56173570 ACCCAGCATCCACCTGGCTCTGG - Intergenic
925055333 2:852894-852916 TCCCCACTCCAACCTGGCCCTGG - Intergenic
925198270 2:1945341-1945363 TCCCCACCTGAACATGGCGCTGG - Intronic
925509638 2:4611115-4611137 TACCAACTCCAACCTGACTCTGG - Intergenic
926253655 2:11170960-11170982 TCCCAACTTCAAACTAGCTCTGG + Intronic
927997771 2:27498206-27498228 TCCCAACCTGAGCCAGGCCCTGG + Intronic
930076543 2:47410198-47410220 ACCCAACTCCAACCTGTCTCTGG - Exonic
931069226 2:58625514-58625536 TCCCGACTCCAACCTGGCTTGGG - Intergenic
935884652 2:107603588-107603610 CCTCAACCTCATGCTGGCTCAGG - Intergenic
937992595 2:127672868-127672890 TCCCAAAAGCAGCCTGGCTCTGG + Intronic
942936363 2:181561468-181561490 CCCCAACTCCAACCTGACTCTGG + Intronic
944763479 2:202840943-202840965 TCTCAGCCTCAGCCTGGCTGTGG + Intronic
945592311 2:211748609-211748631 GCCCAACCACACCCTGTCTCAGG - Intronic
947134233 2:226961129-226961151 TCACAACCTCAACATGGCATGGG + Intronic
1169437574 20:5606725-5606747 TCCAAACATCAACAGGGCTCAGG + Intronic
1170599240 20:17828436-17828458 TCCCACCTCCACCCTGGCTCTGG + Intergenic
1170606901 20:17881640-17881662 CCCCAACCTCTCCCTGACTCAGG - Intergenic
1171215535 20:23350027-23350049 TCCCAACCCCAGCCGGGCCCGGG + Intergenic
1171432212 20:25090246-25090268 TCCTAAGCTTAACTTGGCTCTGG - Intergenic
1172240722 20:33410989-33411011 TCCTTACCTCAGGCTGGCTCTGG - Intronic
1175920693 20:62449349-62449371 CCCCAGCCTCACCCTGGCTCAGG + Intergenic
1176862295 21:14017384-14017406 TCCCAACTTCAGCCTGACACTGG - Intergenic
1178304917 21:31483401-31483423 TCTCAGCCTCAACCTGGTGCTGG - Intronic
1179890376 21:44332184-44332206 TCCCATCCCCAGCCTGGCACAGG + Intronic
1181055420 22:20258526-20258548 TCTCAACCTCACCCTGGGCCTGG + Intronic
1181672841 22:24433798-24433820 TCCCAGGCTCACCCTGGCTCCGG - Intronic
1183745692 22:39690394-39690416 TCTCAACCTGCACCAGGCTCCGG - Intergenic
1184737530 22:46408320-46408342 TGCCAACCACCACCTGGCTGTGG + Intronic
1184936506 22:47727560-47727582 TACCAACTCCAACCTGACTCTGG + Intergenic
1185077503 22:48691182-48691204 TCCTAAGCTCAAGCTGGCTCGGG + Intronic
1185362376 22:50416139-50416161 TCACATCTTCATCCTGGCTCGGG - Exonic
953493188 3:43366534-43366556 TCCCAACCCCACCATGGCCCAGG - Exonic
953569051 3:44057214-44057236 ACCCACCCTCAACCTGTCCCTGG + Intergenic
953913108 3:46902682-46902704 TCCCACCCTCAGCCAGGCCCGGG - Intronic
954199578 3:49016325-49016347 TCCCCAGCTCTTCCTGGCTCTGG - Exonic
959629267 3:108490155-108490177 TCTCCACCTCAACCTGGAACAGG - Intronic
963602896 3:147392710-147392732 TCCGAGCCTCAACAGGGCTCGGG - Intronic
964672450 3:159241508-159241530 TCACAGCATCACCCTGGCTCTGG + Intronic
964725886 3:159814170-159814192 TCCCAGCATCAACCTGTCTTTGG - Intronic
969490840 4:7498514-7498536 TCCCAACCCCTCCCTAGCTCTGG + Intronic
973062354 4:45743164-45743186 TGCCAAACTGAACATGGCTCTGG - Intergenic
979472353 4:121114419-121114441 ACCCAACCTCAAACTGGCAAGGG + Intergenic
982703104 4:158677653-158677675 TACCAACTCCAACCTGACTCTGG - Intronic
984180620 4:176478463-176478485 TGCTTACCTAAACCTGGCTCTGG - Intergenic
986309810 5:6543599-6543621 CCCCAACGGCATCCTGGCTCAGG + Intergenic
987144980 5:14983080-14983102 ACCCAACTCCAACCTGGCTCTGG + Intergenic
989289806 5:39750029-39750051 CTCCAACCTCAAGCTGGCCCTGG + Intergenic
991459002 5:66836780-66836802 TCCCAACCTCAAGTAGGTTCTGG - Intronic
993014480 5:82520040-82520062 TCCCCACCTCAACATTGCTGGGG - Intergenic
993299022 5:86183709-86183731 TACCAACTCCAACCTGACTCTGG + Intergenic
994846395 5:104993813-104993835 TCTCTACCTCACCATGGCTCTGG + Intergenic
995824432 5:116278750-116278772 TCCCCACCTCAAGCTGGTTAAGG - Intronic
996508972 5:124298017-124298039 GCCCAACCTCTACTTGGCACTGG + Intergenic
997585491 5:135040703-135040725 TCCCAACAGCAAGCAGGCTCAGG - Intronic
1003518110 6:6834564-6834586 TCCCCACCTCCACCTCCCTCCGG + Intergenic
1006453658 6:34120006-34120028 CCCCAACCCCAGCCTGGCCCTGG - Intronic
1006808685 6:36806023-36806045 TCTCAACCTCAGCCCTGCTCTGG - Intronic
1006838211 6:37011894-37011916 TCCCCACCTCCACCTGGCCAGGG - Intronic
1007614530 6:43172196-43172218 TCCCCACCCCAACCGGGCCCCGG - Intronic
1007664261 6:43505258-43505280 TCCCCTCCTCTACCAGGCTCAGG - Exonic
1007760238 6:44128740-44128762 TCCCCACCTCACCCTGGCCTGGG - Intronic
1008226508 6:48924840-48924862 ACCCAACTCCAACCTGACTCAGG + Intergenic
1013478256 6:110529639-110529661 TGCCAGCCTCCACCTGGCTAAGG + Intergenic
1017539529 6:155385947-155385969 TCCCAAGCTCATCCTTGCTGAGG - Intergenic
1018317231 6:162569120-162569142 ACCCAACCTCAGCCGGGCTGAGG + Intronic
1019157524 6:170049309-170049331 TGCCCACCTCAACCTGCATCTGG - Intergenic
1019573520 7:1725076-1725098 TCCCCAGCCCAACCTTGCTCAGG - Intronic
1024194532 7:47046043-47046065 TCCTAAACTCAACCTTGCACTGG - Intergenic
1024716509 7:52085658-52085680 TACCAACTCCAACCTGACTCAGG - Intergenic
1026931174 7:74223798-74223820 TCCCAGCCCCAGCCTGCCTCTGG - Intronic
1027162578 7:75813457-75813479 TCCCAGCCTCCCCTTGGCTCTGG + Intronic
1029201207 7:98840379-98840401 TCCCCACCACAACCCTGCTCCGG + Intergenic
1029640832 7:101817653-101817675 GCTCACCTTCAACCTGGCTCCGG - Intronic
1031384980 7:121138356-121138378 TCCCAGTCTCAACTTGTCTCAGG - Intronic
1031451941 7:121931965-121931987 TTCCATCCTCACCCTGACTCTGG - Intronic
1032215353 7:129952940-129952962 TCCCTACCCCAGCCTCGCTCTGG + Exonic
1032511724 7:132478012-132478034 TCCCTGCCTCAACCAGGCTGTGG - Intronic
1035230510 7:157463182-157463204 TCCACACCACAACCTGGCTGTGG - Intergenic
1035375003 7:158401980-158402002 TTCCCACCTCTCCCTGGCTCTGG - Intronic
1038489262 8:27958196-27958218 CCCCAACTTCTACCCGGCTCAGG + Intronic
1041739936 8:61147203-61147225 TGCAAACCTCAAGCTGGCTTGGG + Intronic
1047207509 8:122814892-122814914 TCCCTACCTCATCCTAGGTCTGG + Intronic
1048233069 8:132663017-132663039 TCTCAACCTCTACATTGCTCTGG - Intronic
1048390508 8:133959167-133959189 TCCCTACCTCCACATGGATCTGG - Intergenic
1048449542 8:134521810-134521832 TGCCAGCATCAGCCTGGCTCAGG - Intronic
1049487628 8:142874795-142874817 ACACAGCCTCAACCTGGCCCAGG + Intronic
1058424729 9:104866442-104866464 TCCCATCCTCAAGCTGGGTTAGG + Intronic
1059423113 9:114205190-114205212 TCCCAGCCCCTACCTGTCTCTGG + Intronic
1059588632 9:115633019-115633041 TTCCAACCTCAATATGGATCAGG - Intergenic
1059617129 9:115963238-115963260 TCCCAAGGTCATCCTGGTTCTGG - Intergenic
1061183427 9:129038073-129038095 CCCCAACCCCAGGCTGGCTCAGG - Intronic
1061230916 9:129315414-129315436 CCCCACCCCCACCCTGGCTCCGG - Intergenic
1061886516 9:133593743-133593765 TCCCTGCCTCATCCTGGCCCAGG + Intergenic
1062023544 9:134330187-134330209 CCCCAACCCCCAGCTGGCTCAGG + Intronic
1062249841 9:135588543-135588565 TCCCCACCCCACCATGGCTCTGG - Intergenic
1062444474 9:136587922-136587944 TCCCAACCCCAACCCAGCCCTGG + Intergenic
1189630598 X:42948572-42948594 CCCCAATATCACCCTGGCTCAGG + Intergenic
1193850814 X:86535585-86535607 TACCAACTCCAACCTGACTCTGG + Intronic
1194186788 X:90780649-90780671 ACCCAACTCCAACCTGACTCTGG + Intergenic
1195427349 X:104749289-104749311 TCTCTTCCTCAACCTGACTCTGG + Intronic
1195894592 X:109733024-109733046 ACCCAACCTCCTCCCGGCTCAGG + Intronic
1196061194 X:111410101-111410123 TGACAACATCAACCTGCCTCAGG - Exonic
1196628837 X:117911553-117911575 TCCCAGCCTCCAACAGGCTCTGG + Intronic
1198874999 X:141214974-141214996 TCCCATCCTTACCCTGCCTCAGG - Intergenic
1200533385 Y:4362723-4362745 ACCCAACTGCAACCTGACTCTGG + Intergenic