ID: 1097278984

View in Genome Browser
Species Human (GRCh38)
Location 12:57832877-57832899
Sequence ATTTCTATGCTGAAATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097278979_1097278984 -8 Left 1097278979 12:57832862-57832884 CCTTGGACTTTCCCTATTTCTAT 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1097278984 12:57832877-57832899 ATTTCTATGCTGAAATTGGAGGG 0: 1
1: 0
2: 1
3: 28
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097278984 Original CRISPR ATTTCTATGCTGAAATTGGA GGG Intronic
904199414 1:28810342-28810364 ATATTTAAGCTGAAATTTGAGGG + Intergenic
904394953 1:30213876-30213898 ATTTCTCTGCTGAGATGGGTAGG - Intergenic
906700655 1:47855660-47855682 CTTCCTATGCTGAAATGTGATGG + Intronic
908438185 1:64127651-64127673 ATATCCATGCTGAAATTCAAAGG + Intronic
908488526 1:64619149-64619171 ATGTAGATGGTGAAATTGGAAGG + Intronic
908781299 1:67692985-67693007 ATTTCTCTGCAAAAATTGCAGGG + Intergenic
909659926 1:78070262-78070284 TTTTATATGCTGGAATAGGATGG - Intronic
909825651 1:80123575-80123597 ATTTTTATTCTGAAATTTGCAGG - Intergenic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
911728203 1:101264693-101264715 TTTTCTAGGCTCAAAATGGATGG - Intergenic
912227094 1:107746350-107746372 ATGTCTATGCAGATATTGGGAGG - Intronic
915364014 1:155303848-155303870 ATTTTGAAGCTGAAATTTGAAGG + Intergenic
919343274 1:196341624-196341646 AGTTCTATGTTTGAATTGGAAGG + Intronic
919534540 1:198770705-198770727 ATTATTTTGCTGAACTTGGATGG - Intergenic
919946855 1:202325814-202325836 ATTTATATGGTGAGATTTGAAGG + Intergenic
924245908 1:242084564-242084586 ACTTCTATGCCCAAATGGGAAGG + Exonic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
1064799797 10:19056712-19056734 AGTTCTATGCTGAAAATTGGTGG + Intronic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1066412587 10:35188057-35188079 TTTTCTATGCTGAATTGAGAAGG - Intronic
1067169347 10:43893502-43893524 GTTTCTATGCTCAAATTTGTTGG - Intergenic
1069535029 10:69246913-69246935 ATGTCTATGCAGAACTTGGCAGG + Intronic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1070896451 10:79986499-79986521 GTTTCTATGGTGAAATAGGAAGG + Intergenic
1072541025 10:96398043-96398065 ACTTCTATGCTGACCTTGGCGGG - Intronic
1078389130 11:10920527-10920549 ATTTCTATTCTGAAAATGGAGGG - Intergenic
1078628486 11:12980285-12980307 TTTTCTATGCTGAAATTAATAGG - Intergenic
1078918844 11:15807927-15807949 GTTTCTATGCTGCAAATGAATGG + Intergenic
1079704922 11:23602955-23602977 CTTTCTATTCTGAAATGAGAAGG + Intergenic
1081206243 11:40278988-40279010 ATTTCTATGGTGATATTTGAGGG + Intronic
1081436293 11:43030990-43031012 GTTTCTGTTCTGAAATTGCAGGG + Intergenic
1083415123 11:62520558-62520580 ATTTCTCTGCCCAAAGTGGAAGG - Exonic
1083415882 11:62525448-62525470 ATTTCTCTGCCCAAAGTGGAAGG - Exonic
1087728436 11:101750711-101750733 ATTTCTATGCTAACATTGTGAGG - Intronic
1087951420 11:104224944-104224966 ATTTCTTTACTGAGATTGGAAGG + Intergenic
1087977530 11:104568069-104568091 GTTTCTTTGCTGAAATGGCAAGG - Intergenic
1088136404 11:106561151-106561173 ATTTTTATAGTAAAATTGGAGGG + Intergenic
1089417384 11:118303490-118303512 ACATCTAAGCTGAAATTTGATGG - Intergenic
1090091823 11:123704720-123704742 ATTCCTTGGCTGAAATTAGATGG + Intergenic
1090220238 11:125014812-125014834 ATTTCTAGGCATAAATTGGTTGG - Intronic
1091073705 11:132593523-132593545 CTTTCAATGTTGAAAATGGATGG + Intronic
1092796811 12:12119420-12119442 ACTTCTCTGCTAAAATTGAATGG - Exonic
1093698988 12:22196501-22196523 ATTTCTATTTTGCAAGTGGAAGG - Exonic
1096418354 12:51433230-51433252 ATTAAAATGCTGAAATTGCAAGG - Intronic
1096568849 12:52506942-52506964 ATTTTTTTGTTGAAAATGGATGG + Intergenic
1097278984 12:57832877-57832899 ATTTCTATGCTGAAATTGGAGGG + Intronic
1098445119 12:70558733-70558755 ATATCTCTGCTGAAATTGAGTGG + Intronic
1099212156 12:79804405-79804427 ATTTCTATGGTGAAATTTAGTGG - Intronic
1101130560 12:101686900-101686922 ATATCTCTGTTGAAATTGGTTGG + Intergenic
1104668482 12:130664765-130664787 ATTTTAAAGCTGAAATTGAAAGG - Intronic
1105234792 13:18539563-18539585 GTTTCTATGCAGAAATTGCATGG + Intergenic
1106966774 13:35080502-35080524 AAGTCCAAGCTGAAATTGGAGGG + Intronic
1107095777 13:36533547-36533569 ATCTCTATGCTGAGAGAGGAAGG + Intergenic
1107691608 13:42958945-42958967 ATTTTTATGCATGAATTGGATGG - Intronic
1107741853 13:43459085-43459107 ATTTGTATGCTGCTATAGGAGGG - Intronic
1108082058 13:46747036-46747058 ATTACTTTGCTGAGGTTGGAGGG - Intronic
1109962769 13:69654068-69654090 ATTTCTGTATTGAAATTGGGAGG + Intergenic
1110668276 13:78143745-78143767 AATTCAAAGCTGAAATTGGCAGG + Intergenic
1111151029 13:84253862-84253884 ATTTCTTTGGGGAAAATGGAAGG - Intergenic
1111465311 13:88600671-88600693 TTTTCTTTGCTAAAAATGGATGG - Intergenic
1111650711 13:91087659-91087681 ATGTCCATGCTTAGATTGGAAGG - Intergenic
1119049130 14:71349142-71349164 CTTTCTATGCTTACATTTGATGG + Intronic
1120418957 14:84258096-84258118 ATTTCTATTTTAAAATTGGCTGG - Intergenic
1120468228 14:84888626-84888648 GTTTCTATGGTGAAATTTGATGG + Intergenic
1123736021 15:23183830-23183852 ATTTCTTTGTTGAAATTGTAAGG + Intergenic
1124286735 15:28406812-28406834 ATTTCTTTGTTGAAATTGTAAGG + Intergenic
1124295968 15:28504824-28504846 ATTTCTTTGTTGAAATTGTAAGG - Intergenic
1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG + Intergenic
1126138768 15:45418997-45419019 ATGTATAAACTGAAATTGGAAGG + Intronic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1130604428 15:85302469-85302491 ATTTGTCTTCTGAAGTTGGAGGG - Intergenic
1131254741 15:90854727-90854749 ATTTCTTGGCTGAGCTTGGAAGG - Intergenic
1131330524 15:91495076-91495098 ATTTATATGGGGAAATTGTATGG - Intergenic
1131566888 15:93493974-93493996 AGTTCTATGGGAAAATTGGATGG + Intergenic
1136024097 16:27458988-27459010 ATTTCTGTGCAGAGCTTGGAGGG + Intergenic
1137825741 16:51493307-51493329 ATTTCTATCCGGGAACTGGAAGG + Intergenic
1140145109 16:72299390-72299412 ATTCTTCTGCTGAAAATGGATGG + Intergenic
1140281572 16:73559490-73559512 TCTTCTAAGCTGAACTTGGAAGG - Intergenic
1140926034 16:79584562-79584584 AACTCTTTGCTGAAAATGGATGG + Intergenic
1148755540 17:49971296-49971318 ATTTCTCTGCTGGAACTGGTGGG + Intronic
1153734260 18:8047987-8048009 ATTTATTTACTGAAAATGGACGG - Intronic
1154024434 18:10694227-10694249 ATTCCTATACTGAAATCGAACGG + Intronic
1154514747 18:15150299-15150321 GTTTCTACGCAGAAATTGCATGG - Intergenic
1155999497 18:32369372-32369394 CTGTCTGTGCTGAAATTAGAAGG - Intronic
1160536871 18:79599179-79599201 ATTTCTAAGGTCAAAGTGGAAGG + Intergenic
1161463015 19:4410122-4410144 ATTTCTATGCTTAGACAGGAAGG - Intronic
1161694402 19:5757990-5758012 ATTTTTATGCTGATAAGGGAAGG - Intronic
1167734364 19:51282906-51282928 ATTTCTTATCTGGAATTGGAGGG - Intergenic
1168419429 19:56191533-56191555 ATGTCTTTGCGGAAACTGGATGG + Intronic
927816544 2:26222490-26222512 ATTTCAATGATCAAAGTGGATGG + Intronic
927955821 2:27206691-27206713 GTATCTGTGCTGGAATTGGAAGG + Intronic
930251663 2:49041636-49041658 CTTTCAATTCTGGAATTGGAAGG + Intronic
930313018 2:49765918-49765940 ATTTGTCTGCTGACATTGGAAGG - Intergenic
932018294 2:68055839-68055861 ATTTCTATAGTGAAATTAGATGG + Intronic
933457321 2:82532543-82532565 ATTAATATCCTGATATTGGAGGG - Intergenic
934681747 2:96288700-96288722 ATCTCACAGCTGAAATTGGAGGG - Exonic
935890680 2:107674548-107674570 ATTTATATGCTGCAATTTGGGGG + Intergenic
936000702 2:108826760-108826782 GTTTCTTTGCAGAAATTGAAAGG - Intronic
936548362 2:113412573-113412595 ATTTCTATTCTGAAAGAGGATGG - Intergenic
936686967 2:114838667-114838689 ATTCCTAGGGAGAAATTGGAGGG - Intronic
938514998 2:131995062-131995084 GTTTCTATGCAGAAATTGCATGG - Intergenic
939928623 2:148204220-148204242 ATTTCAAATATGAAATTGGAAGG + Intronic
941293448 2:163704948-163704970 ATTTTAATGCTAAAATTGGATGG - Intronic
942237223 2:173922497-173922519 ATGTATATGCTGATATTGGCAGG - Intronic
943442644 2:187944919-187944941 GTTTCTTTACTGAATTTGGAAGG + Intergenic
944508092 2:200435984-200436006 ATGTATATGCTGAAATGTGAAGG - Intronic
944874972 2:203954082-203954104 ATTTTCATGCTGAAATTGTTTGG - Intronic
944981781 2:205129056-205129078 AGTTCTATACTAAATTTGGAGGG + Intronic
945440216 2:209869505-209869527 ATTACTATACTGAAAATTGAGGG - Intronic
946651767 2:221899106-221899128 AGGTCTAAGCTGAGATTGGAAGG - Intergenic
946729544 2:222695579-222695601 ATTGCTATGCTATAATTGGCTGG - Intronic
1170561063 20:17558936-17558958 TTTTCCATGCTGGAAGTGGAAGG - Intronic
1175134989 20:56816438-56816460 ATGTCTGTGCTGAAATCAGAAGG - Intergenic
1176778784 21:13167851-13167873 GTTTCTATGCAGAAATTGCATGG + Intergenic
1177672728 21:24254438-24254460 ATTTCTATGTTAAAATTTGAAGG + Intergenic
1177745687 21:25210640-25210662 ACTTCTATCCTGAAAATGGTGGG + Intergenic
1177976423 21:27856978-27857000 GTTTCTATGCAGAAATTGCATGG + Intergenic
1181526696 22:23493603-23493625 ATTTCTGAGCTTAAATTGGCTGG - Intergenic
1182747723 22:32618354-32618376 GTTTCCAAGCTGAAAGTGGATGG + Intronic
1184295905 22:43525229-43525251 ATCTCTCTGCTGAAATTGGCTGG + Intergenic
949102337 3:161166-161188 ATTACTATTCTGAACTTAGAAGG + Intergenic
951780004 3:26352175-26352197 TTTTCTCTTCTGAAATAGGAGGG + Intergenic
951965567 3:28380561-28380583 ATTTCCATGTTGAAATTCAATGG + Intronic
953836107 3:46345784-46345806 ATATCTAAGATGAAATTGCAGGG + Intergenic
955569271 3:60286843-60286865 ATTTATATTCCCAAATTGGAGGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956477929 3:69642978-69643000 ATTTCTCTGGTGAAATGGGAAGG + Intergenic
957244391 3:77699495-77699517 TTTTCTATGCTGAAAATTGATGG - Intergenic
957315766 3:78574747-78574769 ACTTCTATTCTGAAATAGCAGGG + Intergenic
958100488 3:89002808-89002830 ATTCCTACTCTGAAAATGGAAGG + Intergenic
960263060 3:115590083-115590105 ATTTCTATGCTGAAATGCAAGGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961925913 3:130480448-130480470 AATTCTATGGGGAAAGTGGAAGG + Intronic
964500820 3:157346451-157346473 GTTTCTAAGTTGAAATTAGATGG + Intronic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
966772066 3:183512878-183512900 CTTTCTTCCCTGAAATTGGATGG - Intronic
967360213 3:188622050-188622072 ATTTCTATGATGAAATCAGTTGG + Intronic
967522555 3:190451131-190451153 ATTTGTATGCAAAAATAGGAAGG + Intergenic
968141841 3:196264517-196264539 ATTTCTGAGCTGAACTTTGAAGG - Intronic
969296751 4:6274760-6274782 ATTTGTATGCTGATGTTGAAGGG + Intronic
969628292 4:8319879-8319901 ATTTTTATGCTGTATTTGGTAGG + Intergenic
969646205 4:8430934-8430956 ATTTCTAGGTAGACATTGGAAGG + Intronic
970728524 4:19075623-19075645 ATTTCTATGATGATTCTGGAAGG - Intergenic
972158112 4:36190166-36190188 ATATTTATGCTGAAATATGAAGG - Intronic
972887057 4:43505453-43505475 ATTTCTATTATAAAATTGCAGGG + Intergenic
973019614 4:45186363-45186385 ACCTATATGCTGAAATTTGAAGG + Intergenic
973802116 4:54488811-54488833 TTTTCTACTCTGTAATTGGAAGG + Intergenic
975610553 4:76198461-76198483 ATTTCTATCCTGAAAGTTGGAGG - Intronic
976662852 4:87558276-87558298 AATTCTATGCTGAAATATAAAGG + Intergenic
979135864 4:117112614-117112636 AGTTCTATACTAAAATTGGGTGG + Intergenic
979484623 4:121256424-121256446 CTTTCTTTTCTGAAATTAGATGG + Intergenic
979604288 4:122621120-122621142 ATTTCCAGGCTGCAATGGGAGGG - Intergenic
980577555 4:134704628-134704650 ATTTCTCTCCTGATTTTGGAAGG + Intergenic
981469508 4:145114893-145114915 ATCTCCATTCTGAAATTTGATGG + Intronic
983088356 4:163474322-163474344 AATTCTATTCTGCAATTGGGTGG - Intergenic
986775869 5:11013249-11013271 ATTTTTATGCTTAAGTTTGATGG - Intronic
986898335 5:12399135-12399157 ATAAATATGCTGAAATGGGATGG - Intergenic
986968838 5:13308018-13308040 ATTTCTATGCAAGATTTGGAGGG + Intergenic
987150193 5:15030720-15030742 ATTTCTAAGCTGAAATCACAAGG - Intergenic
987672232 5:21024769-21024791 ATTTCCATGCTGACATTTGAGGG - Intergenic
990490860 5:56301501-56301523 ACTTCTACGTTGAAAATGGAAGG - Intergenic
990578191 5:57143883-57143905 TGTTCAATGCTGAAACTGGAGGG + Intergenic
990674420 5:58167645-58167667 ATTTCTATGCTGGAATTAAACGG + Intergenic
992293659 5:75305578-75305600 AGCTCTATGCTTAAATTGGGAGG - Intergenic
992669902 5:79048935-79048957 ATTTCTTTGCTGAAACTTGTGGG - Intronic
993302547 5:86228998-86229020 CTTTCTAGAATGAAATTGGAAGG + Intergenic
995637283 5:114208219-114208241 ATTTGGATCCTGAAATTGAACGG + Intergenic
998305825 5:141076264-141076286 TACTCTATGCTGAAAATGGAGGG + Intergenic
998889973 5:146735552-146735574 TTTTATATGATTAAATTGGATGG + Intronic
999859267 5:155627956-155627978 ATTTTTAAGGGGAAATTGGAGGG + Intergenic
1000283489 5:159803952-159803974 ATTACTATCCTGGAATTGCAGGG - Intergenic
1001848190 5:174940063-174940085 ATTTGGATGCTCAATTTGGAAGG - Intergenic
1002912731 6:1502734-1502756 ATTTCTATCCTGAAATTTATAGG - Intergenic
1003725829 6:8762400-8762422 ATTTTTATTGTGAAATAGGAAGG - Intergenic
1003816114 6:9842292-9842314 AATTCTATGCTGAAATAGAATGG - Intronic
1004004983 6:11630120-11630142 ATATTTATGATGGAATTGGAGGG + Intergenic
1005055849 6:21728164-21728186 CTTTCTTTTCTGAAATTGCAGGG + Intergenic
1007034798 6:38663322-38663344 ATTCCTATGCTCAATTTTGATGG + Intergenic
1009480754 6:64155647-64155669 ATTGCTATGCAGAAAAAGGAAGG + Intronic
1009832240 6:68953078-68953100 ATTTCTATGAAGAATTAGGAAGG - Intronic
1016032187 6:139349418-139349440 ATTTCAATTCTGAAATAGCAGGG + Intergenic
1016469230 6:144357749-144357771 ATTTATTTGCTGATATTGGTTGG + Intronic
1017289556 6:152720222-152720244 ATTTATATGCTGACAATGGCAGG + Intronic
1018151512 6:160944294-160944316 ATTTCTGTGCTGATATCTGAAGG + Intergenic
1019972368 7:4551335-4551357 ATTTCTATGCTGCAGTCTGAAGG + Intergenic
1021289674 7:18827491-18827513 TGTTCTATGCTGACAATGGAGGG - Intronic
1026418397 7:70207236-70207258 ATCTCTATGCTTACATTGGGTGG + Intronic
1026551832 7:71375318-71375340 ATTTCTCTGCTGACGTTGCAGGG + Intronic
1027110573 7:75435747-75435769 ATTGCTATTTTGAAATTGCATGG + Intronic
1027245345 7:76363281-76363303 ATTTCTATTCTGAAATTAATCGG + Intergenic
1028185916 7:87785201-87785223 CTTTCTGTGCTGAAATTGCGGGG + Intronic
1028246239 7:88481238-88481260 ACTTCAATGCTAAAATTGTAGGG + Intergenic
1029435912 7:100563995-100564017 ATCTCTATGCAGAGATGGGATGG - Intronic
1030610770 7:111686663-111686685 ATTTCTATGCAGAATATTGAAGG + Intergenic
1033057980 7:138077525-138077547 ATTTCTATGCTGATATGGTTTGG - Intronic
1036599651 8:10248638-10248660 ATTTCTATGTGGAAATTGATAGG + Intronic
1037090631 8:14912399-14912421 ATTTCTATGCTGAGGTAAGATGG - Intronic
1038195901 8:25367347-25367369 CTTTCTCTGCTGAAATGGCAGGG - Intronic
1038423368 8:27448472-27448494 AGTTTTATTATGAAATTGGAAGG + Intronic
1040976922 8:53203803-53203825 CTTTCTCATCTGAAATTGGATGG + Intergenic
1042992797 8:74659472-74659494 ATTTTTTTGCTGAAGCTGGAGGG + Intronic
1045930856 8:107624706-107624728 ATGTTTAAGCTGAAACTGGAAGG - Intergenic
1046423446 8:114014370-114014392 AGATCTATGCTGAGACTGGATGG - Intergenic
1047144018 8:122176547-122176569 ATTTCTAATTTGAAATTGTAGGG + Intergenic
1047471413 8:125177130-125177152 GTCTCTATGCTGAAGTTAGAAGG + Intronic
1047754611 8:127908906-127908928 GGTTCAAAGCTGAAATTGGATGG - Intergenic
1049169759 8:141152351-141152373 ATTTCCCTTCTAAAATTGGACGG - Intronic
1050986976 9:12094721-12094743 ATTTCTATGAAGAATATGGAAGG - Intergenic
1052597417 9:30577230-30577252 ATTCCTATGCTTTAATTGCAGGG - Intergenic
1053727202 9:41016174-41016196 ATTTCTATTCTGAAAGAGGATGG + Intergenic
1054701315 9:68415914-68415936 ATTTCTATTCTGAAAGAGGATGG - Intronic
1055260817 9:74431155-74431177 ATTTTTATGCTGAAATTTATTGG + Intergenic
1055421355 9:76146479-76146501 ATTTATATGTTGGACTTGGAAGG - Intronic
1057333726 9:94140469-94140491 ATTTGTATGCAGAAAATAGAGGG + Intergenic
1060303047 9:122387176-122387198 ATGTCCAAGCAGAAATTGGAAGG + Intronic
1186494849 X:10004377-10004399 ATTTCTAGACTGAACTTAGAAGG - Intergenic
1186680871 X:11872362-11872384 ATTAGTCTTCTGAAATTGGATGG - Intergenic
1187643578 X:21320796-21320818 ATTTCTATGCTCAAATGACATGG - Intergenic
1188995785 X:36883572-36883594 ATTTCCATCCTGAAATTAGGAGG + Intergenic
1189816059 X:44825029-44825051 ATATTTTTGCTGAAATTGGAGGG - Intergenic
1189925533 X:45949896-45949918 ACTTATATGCTGAATTTTGAGGG - Intergenic
1194827739 X:98583356-98583378 ATTCTTATGTTGAAATTGTATGG + Intergenic
1195430523 X:104784121-104784143 AATTTCATGCTGAAATTGGGTGG + Intronic
1195836623 X:109122504-109122526 ATTTCAATGCTCAAATAAGAAGG + Intergenic
1196262269 X:113597301-113597323 ATCCCTATGCTGAAATGGGAGGG - Intergenic
1196328865 X:114443697-114443719 ACTTCCATTCTAAAATTGGATGG + Intergenic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1199945936 X:152667566-152667588 AATCCTTGGCTGAAATTGGATGG + Intergenic
1200363537 X:155636325-155636347 ATTTCTATGCTGAATAGTGAAGG + Intronic
1200403830 Y:2788566-2788588 ATTTCTTTGCTGAAATAAAATGG + Intergenic