ID: 1097279561

View in Genome Browser
Species Human (GRCh38)
Location 12:57836333-57836355
Sequence CTCTCAAGAAGTACCAGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097279555_1097279561 -2 Left 1097279555 12:57836312-57836334 CCCTGGTATTCATCCCCACTACT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1097279561 12:57836333-57836355 CTCTCAAGAAGTACCAGGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 114
1097279556_1097279561 -3 Left 1097279556 12:57836313-57836335 CCTGGTATTCATCCCCACTACTC 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1097279561 12:57836333-57836355 CTCTCAAGAAGTACCAGGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 114
1097279554_1097279561 -1 Left 1097279554 12:57836311-57836333 CCCCTGGTATTCATCCCCACTAC 0: 1
1: 0
2: 0
3: 8
4: 143
Right 1097279561 12:57836333-57836355 CTCTCAAGAAGTACCAGGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097279561 Original CRISPR CTCTCAAGAAGTACCAGGTA AGG Intronic
901183213 1:7355961-7355983 CTCTCAGGAAGATCTAGGTATGG + Intronic
906918118 1:50033613-50033635 CTGTAAATAAGTACCAGTTAAGG - Intergenic
911947127 1:104126059-104126081 CTTTCATGAAGGACCTGGTAGGG + Intergenic
912444674 1:109726076-109726098 CTCTAAAGAAGTACTGGGAATGG + Intronic
915970134 1:160349085-160349107 CTCTCCAGCAGAACCATGTAAGG - Exonic
924150436 1:241124096-241124118 CTCTTAAGAAGAACCAGGATGGG + Intronic
1069095276 10:64251711-64251733 AACTCAAGAAGAACTAGGTATGG - Intergenic
1070734562 10:78854703-78854725 CTCTCAAGACCTACCATGTCTGG + Intergenic
1073280499 10:102350536-102350558 CTCAGAACAAGAACCAGGTAGGG - Intronic
1074575025 10:114660585-114660607 CACTCTAGAAGAACCTGGTAGGG - Intronic
1075798255 10:125136017-125136039 CTCTAATGAACAACCAGGTAGGG - Intronic
1078697298 11:13647311-13647333 CTCTTTTGAAGTACTAGGTAGGG + Intergenic
1080326648 11:31081856-31081878 CTCTCATGAAGTGCCACGTTAGG + Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1084036427 11:66514069-66514091 CTCTCTAGAAGTGCCTGGTGTGG + Intronic
1088358921 11:108970882-108970904 CACTCAAGAAGTCCCAGGAAGGG - Intergenic
1089280751 11:117372715-117372737 ATGTCAAGAAGTACAAGGGAAGG - Intronic
1091218474 11:133917715-133917737 CTCTCGAGGAGTACAAGGTTGGG - Intronic
1093508685 12:19900693-19900715 TTTTGAAGAAGTACAAGGTAAGG - Intergenic
1093870324 12:24283513-24283535 TTTTCAAGGACTACCAGGTATGG - Intergenic
1095694912 12:45133094-45133116 CTCTTCAGAGCTACCAGGTAGGG - Intergenic
1095883587 12:47165049-47165071 CTCTCAAGCAGTACCTGGGCAGG - Intronic
1097279561 12:57836333-57836355 CTCTCAAGAAGTACCAGGTAAGG + Intronic
1097335375 12:58376928-58376950 ATCTCAAAAAGTGCCAGGCATGG - Intergenic
1097850908 12:64408445-64408467 CTCTCAAGACCTATAAGGTAGGG - Intronic
1098257623 12:68633359-68633381 CTATAAAGAACTACCAGGCAAGG - Intronic
1099038610 12:77621824-77621846 ATCTCAAGAAGTCCCAGCAAAGG + Intergenic
1102050035 12:109855640-109855662 CCCTCAAGAAGTACCATGGCTGG - Exonic
1103016377 12:117497830-117497852 CTCTCAAAAAATAACAGCTAGGG - Intronic
1105605712 13:21925003-21925025 CTCGCAGGAAGAACCAGGTGAGG + Intergenic
1110291550 13:73813496-73813518 CTCTCAAGAATTTCAGGGTATGG + Intronic
1116909472 14:50444456-50444478 CCTGCAAGAAGGACCAGGTACGG + Intronic
1118291515 14:64528923-64528945 CTATCAAGAAGTACAAAGAAGGG + Intronic
1118879261 14:69812031-69812053 CTTTAAAGAAGTACTAGGAATGG + Intergenic
1119736342 14:76985088-76985110 CTCTCAAGCTGTACCAGGCCTGG - Intergenic
1120110822 14:80553586-80553608 TTCTGAAGAAGAACAAGGTAAGG - Intronic
1121643922 14:95504901-95504923 CTCTCCAGTAATAACAGGTAGGG + Intergenic
1127284006 15:57516970-57516992 CGCTGAAGAAGTACGAGGTGAGG + Exonic
1128725429 15:69984639-69984661 CTCTCTACAAGTACCAGTAAGGG + Intergenic
1130754144 15:86744955-86744977 CTCTCGAGAAGTACCTATTAGGG + Intronic
1131051708 15:89352558-89352580 CTCTGTAGAGGTACCAGGAAAGG + Intergenic
1133498963 16:6347134-6347156 CTCTGAAGAAGTTCCTGGAATGG + Intronic
1133589188 16:7226276-7226298 CTCTCATGAACTACAAGCTACGG + Intronic
1134194100 16:12145160-12145182 CCCTCAAGAAATCTCAGGTATGG - Intronic
1138975604 16:62203591-62203613 CTCTCAAAATGTCCCAGGTTAGG + Intergenic
1140090246 16:71832345-71832367 CTCTCAAGTAGTACCATTTCTGG - Intergenic
1148586258 17:48783011-48783033 CTTTGAAAAAGTACCAGTTAAGG - Intronic
1149410086 17:56395884-56395906 CACTGAAGAAGTTCCAGGGAAGG - Intronic
1153493135 18:5670328-5670350 CTCTGAAGAAGAACCAGATTGGG + Intergenic
1155391815 18:25346796-25346818 CTCTCCAGAGGTCCCTGGTATGG + Intronic
1156536279 18:37867571-37867593 CTCTGAAGAAGTACCAATCAGGG + Intergenic
1158154380 18:54408909-54408931 CTCACTAGAAGTGCCAGGCATGG + Intergenic
1158307166 18:56118652-56118674 CTCTCAGGAAGAACCAGCTCAGG - Intergenic
1167521971 19:49960546-49960568 CTTTCTAAAAGTAACAGGTATGG - Exonic
1167756655 19:51417076-51417098 CTTTCTAAAAGTAACAGGTATGG - Exonic
933374485 2:81461925-81461947 CTCAAAAGTAGTAGCAGGTATGG - Intergenic
933411875 2:81936053-81936075 GTCTCAAGTAGTACCAAGTATGG + Intergenic
934112019 2:88752803-88752825 GTCTCAAGAAGTGCCAGAGATGG + Intergenic
940196131 2:151096125-151096147 CTCTCAAGAAGGGACAGTTAAGG + Intergenic
940765545 2:157786130-157786152 CTCTGAGGAAGTAACATGTAAGG - Intronic
941222211 2:162796800-162796822 TTCTTAAAAAGTCCCAGGTATGG - Intronic
942530589 2:176905573-176905595 CTCTCCAGAAGTCAGAGGTAAGG + Intergenic
944960923 2:204872948-204872970 TTCTAAAGAAGTAAGAGGTAGGG + Intronic
948541292 2:238693045-238693067 CTCACTATAAGTACCATGTAAGG - Intergenic
1168905171 20:1397439-1397461 CTCTAAAGAAGTACTTGGAATGG + Intergenic
1169321448 20:4636218-4636240 CTCTCAAGAAATACTGGTTATGG - Intergenic
1172033585 20:31997300-31997322 CTCGCAAGAAGTACCCGGCCTGG + Exonic
1177749056 21:25257064-25257086 CTGTCAAGAAGTTCCAGGCTGGG + Intergenic
1178028244 21:28492881-28492903 CCCTCAAGAGTTACTAGGTAGGG - Intergenic
1179039855 21:37792977-37792999 CTCTAAAGATGTACCAGCTAAGG + Intronic
1182990914 22:34766666-34766688 CTCCCAAGTAGTTCCAGGGAAGG + Intergenic
1183315822 22:37136355-37136377 CTCTCAAGCAGAAGCAGGAATGG - Exonic
1185401321 22:50619327-50619349 CTCTCCAGAAGATCCAGCTAAGG - Intergenic
954900492 3:54014986-54015008 CTCTTAAGAATTCCCATGTAGGG + Intergenic
956119800 3:65954843-65954865 CACTGAGGAAGTGCCAGGTAAGG + Intronic
958943916 3:100343211-100343233 GTTTCAAGAAGTACCAAGGAAGG - Intronic
959510658 3:107207911-107207933 CTCTCAAGGACCACCAGGTAGGG + Intergenic
969721549 4:8895192-8895214 CTCTCAGGAGGTAACAGGTAGGG + Intergenic
970365984 4:15358914-15358936 CTCACAAGAAGTCCCAGGCATGG + Intronic
971662999 4:29444453-29444475 ATCTCTAGAAGTACCATATAGGG + Intergenic
975737895 4:77399563-77399585 CTCTAAAGAAGTACTGGGAATGG - Intronic
977236857 4:94518273-94518295 CTCTCAAGAGGTAATAGCTAAGG + Intronic
984394756 4:179181887-179181909 CTCACAAGAAGTAACTGGTGGGG + Intergenic
986997311 5:13621836-13621858 CTTTCCAGAAGTACCAGGAGGGG + Intergenic
987163277 5:15167307-15167329 GTCTCATGAAGTATCAGGTAAGG - Intergenic
990130270 5:52573600-52573622 GTTTCAAGAAGGACTAGGTAAGG + Intergenic
991968579 5:72115783-72115805 CTCTCCTGAAGTCCCAGGTGAGG + Exonic
999082423 5:148856875-148856897 TTCTCAAGAAGTGCCAGGCAAGG + Intergenic
1001042729 5:168348485-168348507 CTCTCAAGAAGTTCCGGGGTGGG + Intronic
1004280714 6:14277386-14277408 GCCTCAGGAAATACCAGGTATGG - Intergenic
1006229060 6:32566705-32566727 CTCTAAAGAAGTACTGGGAACGG - Intronic
1006781276 6:36634066-36634088 CTCTCAAGAAGTAGGGGCTAAGG - Intergenic
1007163368 6:39810786-39810808 CTCTCAGGAAGAACCAGAAAGGG - Intronic
1009037731 6:58138397-58138419 CTCTAGAGAAATTCCAGGTATGG + Intergenic
1009213518 6:60892029-60892051 CTCTAGAGAAATTCCAGGTATGG + Intergenic
1016272996 6:142311994-142312016 GTGTCAAAAAGAACCAGGTAAGG - Intronic
1018386742 6:163311229-163311251 CTTTCCAGAAGCACCAGGTCTGG + Intronic
1021626948 7:22602933-22602955 CTCCCAATAACTACCAGGAAAGG + Intronic
1024211412 7:47209007-47209029 CTATTAATAAGTCCCAGGTAAGG + Intergenic
1026820124 7:73541765-73541787 CTCCTAAGAAGTACTGGGTATGG - Intronic
1032197419 7:129797454-129797476 AACTCCAGAAGTACCATGTATGG + Intergenic
1032595327 7:133233853-133233875 CACTCAAGAAGTACAAGGCCAGG - Intergenic
1034935364 7:155196565-155196587 CTGTCCAGAAGAACCAGGAAAGG - Intronic
1036284479 8:7431674-7431696 CTCTCCAGAAGCTCCATGTAGGG + Intergenic
1036336997 8:7879856-7879878 CTCTCCAGAAGCTCCATGTAGGG - Intergenic
1038850411 8:31269799-31269821 CTCTCAATAAGTAGCAGGCTTGG + Intergenic
1040509977 8:48084874-48084896 CTCTGAAGAAGCTCCAGGGAAGG + Intergenic
1040792287 8:51246265-51246287 CTCTCAAGAAGACCCTGGTGTGG - Intergenic
1044094314 8:88043608-88043630 CTCTCAAGAAATTTCAGATAGGG + Intronic
1046868019 8:119172568-119172590 ATCTCAAGAAGCAGAAGGTAAGG + Intronic
1048207595 8:132427693-132427715 CTCTCCAGAATTACCTGGTGAGG + Intronic
1052945658 9:34166294-34166316 CTCTAAAGAAATACCTGGCAGGG + Intergenic
1058640652 9:107080640-107080662 CTCTCAAGAAGTAAAATTTAGGG - Intergenic
1059473220 9:114523021-114523043 TTCTCAAGAGATTCCAGGTAAGG - Intergenic
1059922659 9:119176060-119176082 CTCTTAATAAGTACCAAGTTTGG - Intronic
1061034183 9:128104351-128104373 GGCACAAGAAGTACTAGGTACGG - Intronic
1187958209 X:24541396-24541418 CTCACAAGCAGTACCATGTAAGG + Intergenic
1189973186 X:46438448-46438470 GGCTCAAGAAGGCCCAGGTAGGG - Intergenic
1190284632 X:48953995-48954017 CTCTCAAGTTGGACCAGGTGAGG + Intronic
1193296991 X:79845137-79845159 CTCTCAGGAAGTAGGAGGAAAGG + Intergenic
1193411888 X:81174938-81174960 TTCTCAAGCTGTACAAGGTAGGG + Intronic
1197350872 X:125381769-125381791 TTCTTAAGAAGTACCAGTGAAGG + Intergenic
1199179992 X:144842661-144842683 TTCTCAAGAAGAAGCAGGTTTGG + Intergenic
1199800512 X:151246834-151246856 CTCTGAAGAAGTAGCAGTTTAGG + Intergenic